ID: 1200154910

View in Genome Browser
Species Human (GRCh38)
Location X:153970229-153970251
Sequence AGCCCGCTGGGTAACGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200154899_1200154910 -9 Left 1200154899 X:153970215-153970237 CCAGCCCCAGCCCCAGCCCGCTG 0: 1
1: 1
2: 61
3: 337
4: 2143
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1200154897_1200154910 -7 Left 1200154897 X:153970213-153970235 CCCCAGCCCCAGCCCCAGCCCGC 0: 3
1: 26
2: 317
3: 701
4: 3262
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1200154895_1200154910 -3 Left 1200154895 X:153970209-153970231 CCCGCCCCAGCCCCAGCCCCAGC 0: 188
1: 236
2: 392
3: 1492
4: 5295
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1200154892_1200154910 20 Left 1200154892 X:153970186-153970208 CCTGCGCCAAGGGGACACATCCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1200154893_1200154910 14 Left 1200154893 X:153970192-153970214 CCAAGGGGACACATCCGCCCGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1200154894_1200154910 0 Left 1200154894 X:153970206-153970228 CCGCCCGCCCCAGCCCCAGCCCC 0: 3
1: 29
2: 137
3: 829
4: 5007
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1200154896_1200154910 -4 Left 1200154896 X:153970210-153970232 CCGCCCCAGCCCCAGCCCCAGCC 0: 11
1: 37
2: 137
3: 1039
4: 4615
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1200154898_1200154910 -8 Left 1200154898 X:153970214-153970236 CCCAGCCCCAGCCCCAGCCCGCT 0: 1
1: 5
2: 91
3: 499
4: 1805
Right 1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200154910 Original CRISPR AGCCCGCTGGGTAACGGTGT GGG Intronic
904050264 1:27634460-27634482 AGCCCGCAGGGTAACGTTAGCGG - Intronic
923613358 1:235514976-235514998 AGCCTGCTGGGCAACAGAGTGGG + Intergenic
1070449939 10:76547979-76548001 AGCCTGCTAAGTAAGGGTGTGGG + Intronic
1081163809 11:39785010-39785032 AGCCAGCTGGGGAGCGGTGAGGG + Intergenic
1083746703 11:64741114-64741136 AGCCTGCTGGGTGATGGTGGGGG - Intronic
1092730362 12:11527147-11527169 ATCCCACTGGGTAAAGTTGTTGG + Intergenic
1103336682 12:120194955-120194977 AGCCCGCGGTGTAACGCTATGGG + Intergenic
1103556535 12:121770087-121770109 AGCCCGCTGGGTGTAGCTGTAGG + Intronic
1105021385 12:132818847-132818869 AGCCTGCTGGGTAAAGGCCTGGG + Intronic
1119325727 14:73758867-73758889 AGGCCTCTGGGTAAAGGTCTAGG - Intronic
1119618646 14:76115032-76115054 AGCCTGCTGGGTAAGGCTGCAGG + Intergenic
1131122314 15:89830259-89830281 AGCCAGCTGGGAAACTGAGTGGG - Intergenic
1132501858 16:288015-288037 AGCCCGATGGGGAACAGTGTTGG - Exonic
1132614075 16:831755-831777 GGCCCGCTGGGAACAGGTGTGGG + Intergenic
1135949351 16:26898738-26898760 AGCCTGCTGGGTGATGGTGTTGG - Intergenic
1137489200 16:48916969-48916991 AGCCCCCTGGAAAATGGTGTAGG + Intergenic
1138341460 16:56292101-56292123 AGCCTGCTGGGGAACGCTGATGG - Intronic
1140728963 16:77838925-77838947 AGCCCTGGGGGTAACTGTGTTGG + Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161522043 19:4730107-4730129 AGCCCGCTGGGGAGGGGTGTGGG - Intergenic
1165670400 19:37673677-37673699 ATCCAGGTGGGTAAGGGTGTTGG - Intronic
932357521 2:71078492-71078514 AGCCCCCTAGGAAAAGGTGTAGG - Exonic
932369978 2:71178757-71178779 AGCCCCCTAGGAAAAGGTGTAGG - Intergenic
936163414 2:110101458-110101480 CTCCCGCTGGATAACAGTGTTGG + Intronic
936276365 2:111101340-111101362 AGCCCGGCGGGTATGGGTGTGGG - Intronic
1170262484 20:14425732-14425754 AGTCCCCAGGGTAACGGTGAGGG - Intronic
1176665085 21:9678965-9678987 AGCCGGCTGGGTTTCTGTGTCGG - Intergenic
965652448 3:170947672-170947694 AGCCAGCTGGGCTACTGTGTCGG + Intergenic
1029457188 7:100677332-100677354 AGCCTGGTGGGGAACGGTGTAGG - Exonic
1033671902 7:143501085-143501107 AGCCTGGTGGCTAAAGGTGTAGG + Intergenic
1034885370 7:154794581-154794603 AGCCCGCTGGGGGAGGCTGTCGG - Intronic
1045096305 8:98801036-98801058 AGCCAGCTGGGTTCCTGTGTTGG + Intronic
1049855754 8:144860819-144860841 AGCCCTGTGTGTGACGGTGTGGG + Intergenic
1049905851 9:215353-215375 AGGCGCCTGGGTAACCGTGTTGG + Exonic
1049911428 9:272251-272273 AGCGCGCTGGGGAACGCTTTAGG - Intronic
1055822505 9:80284132-80284154 AGCCTGCTGGGTCAAGGTGCTGG + Intergenic
1055979052 9:81983643-81983665 AGACTTCTGGGTGACGGTGTAGG + Intergenic
1058651803 9:107181890-107181912 AGCCCTCTGGGTAAATGTGGTGG - Intergenic
1060668486 9:125447838-125447860 AGTCAGCTGGGTAAAGGTGAGGG + Intronic
1061532669 9:131227310-131227332 AGCCCACTGGGCAGCAGTGTTGG + Intronic
1203661016 Un_KI270753v1:42784-42806 AGCCGGCTGGGTTTCTGTGTCGG + Intergenic
1198096702 X:133387045-133387067 AGCCAGCTTGCTAGCGGTGTAGG - Intronic
1198221569 X:134607341-134607363 AGCACACTGGGTAACAATGTAGG - Intronic
1199093941 X:143719144-143719166 AGCCCTGTGTGTGACGGTGTGGG - Intronic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic