ID: 1200155263

View in Genome Browser
Species Human (GRCh38)
Location X:153971704-153971726
Sequence GCTCTTTGAAGCGGCTCCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200155263_1200155267 9 Left 1200155263 X:153971704-153971726 CCACAGGAGCCGCTTCAAAGAGC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1200155267 X:153971736-153971758 GCCCCGAAGCGGCAACTGTACGG 0: 1
1: 0
2: 0
3: 2
4: 27
1200155263_1200155271 21 Left 1200155263 X:153971704-153971726 CCACAGGAGCCGCTTCAAAGAGC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1200155271 X:153971748-153971770 CAACTGTACGGCAGAAGAAGCGG 0: 1
1: 0
2: 0
3: 7
4: 113
1200155263_1200155272 27 Left 1200155263 X:153971704-153971726 CCACAGGAGCCGCTTCAAAGAGC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1200155272 X:153971754-153971776 TACGGCAGAAGAAGCGGTAACGG 0: 1
1: 0
2: 1
3: 7
4: 128
1200155263_1200155266 -2 Left 1200155263 X:153971704-153971726 CCACAGGAGCCGCTTCAAAGAGC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1200155266 X:153971725-153971747 GCTAGAGTTAGGCCCCGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200155263 Original CRISPR GCTCTTTGAAGCGGCTCCTG TGG (reversed) Exonic
900272386 1:1797962-1797984 GCTCCTTGGAGCCGATCCTGGGG - Intronic
900479560 1:2891515-2891537 GCCCGAGGAAGCGGCTCCTGTGG + Intergenic
902456103 1:16535076-16535098 GCTCTCTAAAGCTGCTCCCGCGG + Intergenic
902496063 1:16872835-16872857 GCTCTCTAAAGCTGCTCCCGCGG - Intronic
902525141 1:17052439-17052461 GGTCTTTGCAGGGCCTCCTGAGG - Intronic
903946664 1:26968410-26968432 GCTCTTTGCAGTGGCTCCTCTGG + Intergenic
904477718 1:30775625-30775647 GCTCCCAGAAGCGTCTCCTGGGG - Intergenic
907932283 1:59011698-59011720 ACTCTCTGCAGAGGCTCCTGGGG - Intergenic
911460592 1:98184582-98184604 GCTCTTTGGAGAGGCTTTTGAGG + Intergenic
913337499 1:117722026-117722048 GTTGATTGAATCGGCTCCTGAGG - Intergenic
913661452 1:121009354-121009376 GCTCTCTAAAGCCGCTTCTGCGG + Intergenic
914012817 1:143792534-143792556 GCTCTCTAAAGCCGCTTCTGCGG + Intergenic
914165012 1:145168651-145168673 GCTCTCTAAAGCCGCTTCTGCGG - Intergenic
914651442 1:149701143-149701165 GCTCTCTAAAGCCGCTTCTGCGG + Intergenic
916983835 1:170168724-170168746 GTTCATTGCAGCTGCTCCTGGGG + Intergenic
917701292 1:177584189-177584211 GCTATTTGATGGGGCTCATGAGG - Intergenic
918690069 1:187468585-187468607 GCCCTTGGAAGCTGCTCCTTTGG - Intergenic
922044180 1:221927830-221927852 GCACTGTGCAGCGGCTGCTGGGG - Intergenic
1064125455 10:12656150-12656172 GCTCGTTGATGCCCCTCCTGTGG + Intronic
1070698166 10:78578460-78578482 GCTCTGTGGAGAGGCTGCTGAGG - Intergenic
1073069357 10:100783426-100783448 GCTCTTTGAGGAGGGGCCTGAGG + Intronic
1073138686 10:101233776-101233798 GCTCTTTGAATGGGCTTCAGGGG + Intergenic
1075021968 10:118958861-118958883 GCTCTGAGAAGAGGCTTCTGTGG - Intergenic
1075855709 10:125627908-125627930 AATCTTTGAAGAGTCTCCTGTGG - Intronic
1084764535 11:71299620-71299642 GCCCTTTGGAGCGGATTCTGTGG - Intergenic
1089209474 11:116790661-116790683 GCTCTTTGAAGCGGCCGGTGTGG + Exonic
1090834775 11:130446450-130446472 ACTCTTGGAAGCGCCCCCTGGGG - Intergenic
1091001961 11:131917347-131917369 GCTGTGTGAGGCTGCTCCTGTGG + Intronic
1092205577 12:6612857-6612879 GCTGTTTGAAGGGGCCCCTGGGG - Intergenic
1103206884 12:119136771-119136793 TTTCTTTGAAGCCTCTCCTGAGG - Intronic
1105424155 13:20280241-20280263 GTTCTTTGAGGATGCTCCTGAGG - Intergenic
1106759630 13:32856075-32856097 ACTCTTTCAGTCGGCTCCTGTGG - Intergenic
1107303589 13:38993825-38993847 GCTCTTTGTAGTGGCTCCCAGGG - Intergenic
1111853619 13:93608004-93608026 TCTCTTTGGAGCCACTCCTGTGG + Intronic
1112292014 13:98152380-98152402 GGTCTTTGAAGAGGATTCTGGGG + Intronic
1118081642 14:62368113-62368135 GGTCTTTGAAGCTTCTACTGAGG + Intergenic
1118785603 14:69043175-69043197 GCTCTGTGGAGCAGCTCCTGTGG + Intergenic
1122853367 14:104548413-104548435 CCCCTCTGCAGCGGCTCCTGGGG - Intronic
1129061921 15:72867199-72867221 GTGCTTTGCAGCTGCTCCTGTGG + Intergenic
1130600966 15:85272917-85272939 GTTCTTTGGGGCGGCTGCTGAGG - Intergenic
1131590914 15:93747203-93747225 GCCCTGGGAAGCAGCTCCTGGGG + Intergenic
1134733546 16:16481697-16481719 GCTTTTCGAAGCGGCATCTGTGG + Intergenic
1134905801 16:17978503-17978525 GCTATTTGATGAGGGTCCTGAGG - Intergenic
1134933954 16:18230585-18230607 GCTTTTCGAAGCGGCATCTGTGG - Intergenic
1136567800 16:31080454-31080476 GATCTTTGGAGCGGCACCTGCGG + Exonic
1143901224 17:10176243-10176265 CCTCTTTGAAGTTGCTTCTGAGG - Intronic
1146070637 17:29677907-29677929 TCTCTTTAAAACAGCTCCTGAGG - Intronic
1148145463 17:45361827-45361849 TTTCTTTGAAGGGGCTTCTGGGG - Intergenic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1158066691 18:53419098-53419120 GCTCTATGAAGCGGGTGCAGAGG + Intronic
1160671295 19:365004-365026 GCTCTGTGAAGAGGCTCCTGGGG + Intronic
1161167447 19:2796023-2796045 GCTCTTTGGAGCGGCTGCACTGG + Intronic
1161177960 19:2859025-2859047 GCGCTTTGAGGCTGCTCCTGAGG - Exonic
1161606317 19:5216738-5216760 GCTCCCTGAGGGGGCTCCTGAGG + Exonic
1164775077 19:30846606-30846628 GCCCTTTGAAGATGCTTCTGAGG - Intergenic
1165894753 19:39134953-39134975 TCTCTTTGTAGCATCTCCTGGGG + Intronic
1166045229 19:40226145-40226167 GCTCTTTGCAGTCCCTCCTGGGG - Intronic
1166864935 19:45830090-45830112 GCGCTGTGAAGCGGATCCTGCGG - Exonic
1202706992 1_KI270713v1_random:31432-31454 GCTCTCTAAAGCTGCTCCCGCGG + Intergenic
927819641 2:26252085-26252107 GCCTTATGAAGAGGCTCCTGTGG - Intronic
929060731 2:37922189-37922211 GCTCTTTGAAGCGGGGGTTGGGG + Intergenic
932208990 2:69911580-69911602 GCTCTCTGAAGCGGCATCTCCGG + Intronic
938500655 2:131830050-131830072 GCGCTTGGAAGCGGGTCCCGGGG + Intergenic
940465727 2:154024473-154024495 GTTCATTGCATCGGCTCCTGAGG + Intronic
942188045 2:173443418-173443440 GCTCCTTGGAGAGGTTCCTGGGG + Intergenic
944920451 2:204407521-204407543 GTTCTTTGAAGCGGCTTCCTGGG - Intergenic
945875101 2:215269952-215269974 GATCTTGTAAGCGGCTCCTCTGG + Intergenic
1168864173 20:1070642-1070664 GCTCTTTGGCTTGGCTCCTGAGG + Intergenic
1170159709 20:13298873-13298895 GCTCCTTGAAGCACCTCCTGTGG + Intronic
1171144245 20:22767665-22767687 GCCCTTTGGAGAGGCACCTGCGG + Intergenic
1175145235 20:56890869-56890891 GCTCTTTCGGGTGGCTCCTGTGG - Intergenic
1177110240 21:17018704-17018726 GCTCTTTCAGTTGGCTCCTGTGG - Intergenic
1177245557 21:18518247-18518269 GCTCTTTGAAGGCGATTCTGAGG + Intergenic
1180615371 22:17122531-17122553 GACCTTTGAAGCTGCTGCTGCGG + Intronic
1184763339 22:46558014-46558036 GCTCTTAGCAGAGGCTTCTGAGG + Intergenic
1184890641 22:47376904-47376926 GCTCCCTGAAGGGGCTCCCGGGG - Intergenic
949226196 3:1699302-1699324 GGTCTTTGCAGCGGCTGCTCCGG - Intergenic
954902713 3:54033801-54033823 GCTCTGTGAAACATCTCCTGTGG + Intergenic
955035264 3:55261639-55261661 GGTGTTGGAAGCGGCTCCTGAGG - Intergenic
964356225 3:155854219-155854241 GCTCTTTGACGCCGTTCCAGGGG - Exonic
980178581 4:129376408-129376430 GCAGTTAGAAGCTGCTCCTGAGG - Intergenic
981162629 4:141516992-141517014 GCCCTGTGAAGAGGCTCATGTGG - Intergenic
983797851 4:171887506-171887528 ACTACTTGAAGAGGCTCCTGTGG + Intronic
986530565 5:8732201-8732223 GCTGATTGAATCGGCTACTGAGG - Intergenic
987731302 5:21776149-21776171 GCTCTATGGAGATGCTCCTGTGG + Intronic
990356271 5:54969251-54969273 GCTCTTTGAAGCTCCTCTTTGGG - Intergenic
991590319 5:68244525-68244547 GCTCTCTGAAGCGGCGGCGGGGG - Intronic
992755737 5:79903648-79903670 GTTGTTTGCATCGGCTCCTGAGG - Intergenic
1002770067 6:282810-282832 GGACTTGGAAACGGCTCCTGGGG + Intergenic
1010325635 6:74559052-74559074 GATGTTTGGGGCGGCTCCTGAGG + Intergenic
1014618743 6:123638445-123638467 GCTCTGGGAAGCTGCTCTTGAGG - Intergenic
1015442438 6:133264243-133264265 GCCCCTTGAAGGGGCTCCAGGGG - Intronic
1016726953 6:147382790-147382812 GCTCCTTGAAGCCTTTCCTGAGG - Exonic
1017212612 6:151873513-151873535 GCTCTTGGAAGCGTCTACTCAGG + Intronic
1018969046 6:168512698-168512720 GCTCTCTGAAATGGATCCTGAGG - Intronic
1023487366 7:40701322-40701344 GCTCTCTGAAGTGGCTGCCGTGG - Intronic
1030748311 7:113196720-113196742 GCTCTTTGGAGCTCCTCATGGGG + Intergenic
1034393890 7:150805249-150805271 CCTCTTTGAGGCTGATCCTGTGG + Intergenic
1036193843 8:6697042-6697064 GCTCTTTGAGGTGGTTCTTGAGG - Intergenic
1037773893 8:21820040-21820062 GCTGATTCAAGCTGCTCCTGAGG + Intergenic
1040276343 8:46015977-46015999 CCTCTTTGAAGTGACACCTGTGG + Intergenic
1041861991 8:62525003-62525025 TCTCTTTGAAGAGGCTACTGTGG + Intronic
1046783727 8:118243343-118243365 GCTCTTTCAAGGGACTCTTGTGG - Intronic
1052117550 9:24667613-24667635 GTTCATTGAATCGGCTACTGAGG + Intergenic
1056710680 9:88990399-88990421 ACTCTCTGCAGCGGCCCCTGCGG + Intergenic
1056925729 9:90833025-90833047 GCTCTTTGGGGAGGCTCATGTGG - Intronic
1060442489 9:123654892-123654914 GCTCCCTGCAGCTGCTCCTGGGG - Intronic
1187330148 X:18330688-18330710 GCTCTTTCAAGCTGTTGCTGTGG - Intronic
1196736132 X:118982369-118982391 GCTCTTTCAAGCCACTACTGAGG + Intronic
1197972958 X:132133980-132134002 GTTCATTGCATCGGCTCCTGAGG - Intergenic
1200155263 X:153971704-153971726 GCTCTTTGAAGCGGCTCCTGTGG - Exonic
1202138453 Y:21694473-21694495 TCTCTTTCAAGCTGCTCCAGAGG - Intergenic
1202191740 Y:22253073-22253095 GCTCTTTGAAGGGGCCCCATGGG + Intergenic