ID: 1200155484

View in Genome Browser
Species Human (GRCh38)
Location X:153972561-153972583
Sequence GCGCCGCAGCAAAATGAGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200155470_1200155484 19 Left 1200155470 X:153972519-153972541 CCAGGCTGCGGGGCCCGCCCTCG 0: 1
1: 0
2: 5
3: 29
4: 273
Right 1200155484 X:153972561-153972583 GCGCCGCAGCAAAATGAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1200155474_1200155484 5 Left 1200155474 X:153972533-153972555 CCGCCCTCGGGCGCCACCGCCTC 0: 1
1: 0
2: 2
3: 19
4: 316
Right 1200155484 X:153972561-153972583 GCGCCGCAGCAAAATGAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1200155473_1200155484 6 Left 1200155473 X:153972532-153972554 CCCGCCCTCGGGCGCCACCGCCT 0: 1
1: 0
2: 3
3: 26
4: 301
Right 1200155484 X:153972561-153972583 GCGCCGCAGCAAAATGAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1200155469_1200155484 20 Left 1200155469 X:153972518-153972540 CCCAGGCTGCGGGGCCCGCCCTC 0: 1
1: 0
2: 1
3: 27
4: 287
Right 1200155484 X:153972561-153972583 GCGCCGCAGCAAAATGAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1200155477_1200155484 -8 Left 1200155477 X:153972546-153972568 CCACCGCCTCCGCCCGCGCCGCA 0: 2
1: 2
2: 28
3: 288
4: 2743
Right 1200155484 X:153972561-153972583 GCGCCGCAGCAAAATGAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1200155476_1200155484 1 Left 1200155476 X:153972537-153972559 CCTCGGGCGCCACCGCCTCCGCC 0: 1
1: 0
2: 16
3: 268
4: 2506
Right 1200155484 X:153972561-153972583 GCGCCGCAGCAAAATGAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1200155468_1200155484 27 Left 1200155468 X:153972511-153972533 CCAGGCTCCCAGGCTGCGGGGCC 0: 1
1: 0
2: 2
3: 68
4: 573
Right 1200155484 X:153972561-153972583 GCGCCGCAGCAAAATGAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1200155475_1200155484 2 Left 1200155475 X:153972536-153972558 CCCTCGGGCGCCACCGCCTCCGC 0: 1
1: 0
2: 2
3: 36
4: 261
Right 1200155484 X:153972561-153972583 GCGCCGCAGCAAAATGAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1200155467_1200155484 28 Left 1200155467 X:153972510-153972532 CCCAGGCTCCCAGGCTGCGGGGC 0: 1
1: 0
2: 3
3: 67
4: 530
Right 1200155484 X:153972561-153972583 GCGCCGCAGCAAAATGAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200155484 Original CRISPR GCGCCGCAGCAAAATGAGCC GGG Exonic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
912263829 1:108134464-108134486 ACTCCACGGCAAAATGAGCCTGG + Exonic
912490087 1:110057998-110058020 GAGCCTCAGCAAAATGAGCTGGG + Intronic
917668747 1:177251250-177251272 ACACCGCAGCAAAATGTTCCTGG - Intronic
921592274 1:217018522-217018544 GCTGAGCAGCAAAATGAGGCTGG - Intronic
922589117 1:226760039-226760061 TCCCTGCAGCAAAAGGAGCCAGG + Intergenic
924783794 1:247175799-247175821 GATCCGCAGCCAAATGAGACGGG + Intergenic
1069374548 10:67780780-67780802 GCCCTGGAGAAAAATGAGCCTGG - Intergenic
1071502294 10:86212492-86212514 GGGCAGCAGAAAAAAGAGCCAGG + Intronic
1075721367 10:124589531-124589553 GGGGCTCAGCAGAATGAGCCGGG + Intronic
1079349159 11:19678070-19678092 GCGCCGCAGGAATAGGAGCGAGG + Intronic
1085509620 11:77081713-77081735 GGGCCGCAGCAGAATGTGCTAGG + Intronic
1090852052 11:130579242-130579264 GAGCCACAGCAAAATGATCCCGG + Intergenic
1092074343 12:5660792-5660814 GAGCACCACCAAAATGAGCCCGG - Intronic
1116960665 14:50965210-50965232 GCTTGGCAGCAAAATGAGCAAGG - Intergenic
1129246606 15:74282817-74282839 GCACTGCAGCCAAATGAGCAGGG - Intronic
1131473492 15:92716368-92716390 TCGCCGCAGTAAAAGGAGTCAGG + Intronic
1136749357 16:32619235-32619257 CAGCAGCACCAAAATGAGCCTGG + Intergenic
1139361509 16:66402658-66402680 CCGCCGCAGGAAGATGAGCAGGG - Exonic
1140536303 16:75713144-75713166 GTGCTGCAGCAACATCAGCCTGG - Intronic
1141600281 16:85121707-85121729 GCCGCACAGCAAAGTGAGCCAGG + Intergenic
1203051489 16_KI270728v1_random:878449-878471 CAGCAGCACCAAAATGAGCCTGG + Intergenic
1159554637 18:69932603-69932625 GCGCAAAAGCAAAATGAGGCTGG - Intronic
926511640 2:13788068-13788090 GAGCCGCTGCGAAATGAGCATGG + Intergenic
937928024 2:127182829-127182851 GAGCCACAGAAACATGAGCCAGG + Intergenic
938440874 2:131331250-131331272 GCGCTGCAGCCACCTGAGCCGGG + Intronic
940752220 2:157639026-157639048 GGGCCACAGGAGAATGAGCCTGG - Intergenic
941424350 2:165323344-165323366 GCGCCACAGCAATGTCAGCCAGG + Exonic
946213287 2:218164356-218164378 GCGCCGCAACAACATCGGCCGGG - Exonic
1172046166 20:32081862-32081884 GTGGGGCAGGAAAATGAGCCTGG + Intronic
1175213917 20:57379734-57379756 GGGCAGCAGAGAAATGAGCCTGG - Intergenic
1176265005 20:64204549-64204571 GTGCCCCAGCAAACGGAGCCAGG - Intronic
1179959328 21:44759330-44759352 GAGCCTCAGCAGAAGGAGCCAGG - Intergenic
1181064175 22:20297917-20297939 TCTCTCCAGCAAAATGAGCCTGG + Intergenic
1184508417 22:44917937-44917959 GGTCCTTAGCAAAATGAGCCCGG + Intronic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
964878411 3:161395825-161395847 GCCCAGCAGCATGATGAGCCAGG - Intergenic
987355533 5:17060364-17060386 GCGCCTCAGCAAGTTGAGGCAGG + Intergenic
998853259 5:146371163-146371185 CCACCCCAGCAAAATTAGCCTGG - Intergenic
1017027148 6:150191239-150191261 GCAACGCAGGAAAAGGAGCCAGG - Intronic
1022793616 7:33714378-33714400 GGGCTGCAGCAGAAAGAGCCTGG - Intergenic
1058176486 9:101741072-101741094 TGGCCGGAGCAAAATGATCCAGG + Intergenic
1058467485 9:105244366-105244388 GTGCCACAGCTAAATAAGCCCGG + Intergenic
1062310290 9:135931766-135931788 AGGCCACAGCAAGATGAGCCAGG + Intergenic
1062629431 9:137457194-137457216 GCTCCTCAGCAAAATCTGCCAGG - Intronic
1200155484 X:153972561-153972583 GCGCCGCAGCAAAATGAGCCGGG + Exonic