ID: 1200161880

View in Genome Browser
Species Human (GRCh38)
Location X:154013789-154013811
Sequence GCTGCTGCCGCGCCCCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 1, 2: 5, 3: 44, 4: 488}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200161880_1200161889 29 Left 1200161880 X:154013789-154013811 CCAGCAGGGGGCGCGGCAGCAGC 0: 1
1: 1
2: 5
3: 44
4: 488
Right 1200161889 X:154013841-154013863 GGAGCTGGGCTCCGCAAAGCAGG 0: 1
1: 0
2: 0
3: 19
4: 204
1200161880_1200161881 1 Left 1200161880 X:154013789-154013811 CCAGCAGGGGGCGCGGCAGCAGC 0: 1
1: 1
2: 5
3: 44
4: 488
Right 1200161881 X:154013813-154013835 CTTTCCTTCTCTCTATGTGAAGG 0: 1
1: 0
2: 5
3: 76
4: 1121
1200161880_1200161882 2 Left 1200161880 X:154013789-154013811 CCAGCAGGGGGCGCGGCAGCAGC 0: 1
1: 1
2: 5
3: 44
4: 488
Right 1200161882 X:154013814-154013836 TTTCCTTCTCTCTATGTGAAGGG 0: 1
1: 0
2: 0
3: 42
4: 390
1200161880_1200161883 3 Left 1200161880 X:154013789-154013811 CCAGCAGGGGGCGCGGCAGCAGC 0: 1
1: 1
2: 5
3: 44
4: 488
Right 1200161883 X:154013815-154013837 TTCCTTCTCTCTATGTGAAGGGG 0: 1
1: 0
2: 5
3: 25
4: 286
1200161880_1200161888 15 Left 1200161880 X:154013789-154013811 CCAGCAGGGGGCGCGGCAGCAGC 0: 1
1: 1
2: 5
3: 44
4: 488
Right 1200161888 X:154013827-154013849 ATGTGAAGGGGGTCGGAGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 169
1200161880_1200161887 14 Left 1200161880 X:154013789-154013811 CCAGCAGGGGGCGCGGCAGCAGC 0: 1
1: 1
2: 5
3: 44
4: 488
Right 1200161887 X:154013826-154013848 TATGTGAAGGGGGTCGGAGCTGG 0: 1
1: 0
2: 1
3: 5
4: 139
1200161880_1200161886 8 Left 1200161880 X:154013789-154013811 CCAGCAGGGGGCGCGGCAGCAGC 0: 1
1: 1
2: 5
3: 44
4: 488
Right 1200161886 X:154013820-154013842 TCTCTCTATGTGAAGGGGGTCGG 0: 1
1: 0
2: 0
3: 15
4: 168
1200161880_1200161884 4 Left 1200161880 X:154013789-154013811 CCAGCAGGGGGCGCGGCAGCAGC 0: 1
1: 1
2: 5
3: 44
4: 488
Right 1200161884 X:154013816-154013838 TCCTTCTCTCTATGTGAAGGGGG 0: 1
1: 0
2: 1
3: 11
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200161880 Original CRISPR GCTGCTGCCGCGCCCCCTGC TGG (reversed) Intronic
900032429 1:381200-381222 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032445 1:381268-381290 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032461 1:381336-381358 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032477 1:381404-381426 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032493 1:381472-381494 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032509 1:381540-381562 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032525 1:381608-381630 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900052979 1:609386-609408 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900052995 1:609454-609476 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053011 1:609522-609544 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053027 1:609590-609612 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053041 1:609654-609676 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053057 1:609722-609744 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053073 1:609790-609812 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053089 1:609858-609880 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053121 1:609994-610016 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053137 1:610062-610084 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053151 1:610126-610148 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053167 1:610194-610216 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053183 1:610262-610284 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053199 1:610330-610352 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053231 1:610466-610488 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053263 1:610602-610624 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053279 1:610670-610692 CCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053297 1:610738-610760 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900091156 1:921249-921271 GCTGCTCCGGGTCCCCCTGCTGG - Intergenic
900204494 1:1426262-1426284 GCTGCTGCCCGGCCGGCTGCTGG + Exonic
900331996 1:2139919-2139941 GCTGCTGGAGAGCCCTCTGCTGG + Intronic
900512644 1:3067870-3067892 GTTGCTGCCCCGCACCCTTCCGG - Intergenic
900985849 1:6072526-6072548 GCTGCTGGCACGGGCCCTGCTGG - Intronic
901060614 1:6470280-6470302 GCAGCTGCCGCGTCTCCTCCGGG + Exonic
901234035 1:7657941-7657963 GCGGCTGCCGCACCCCCATCAGG + Intronic
901476807 1:9495408-9495430 GGCGCTGCTGCGCCCCCTGGTGG - Intergenic
901496878 1:9627322-9627344 TGTGCTGCCGCCACCCCTGCAGG - Intergenic
901642926 1:10702175-10702197 GCTGCTGCCTTGCTCCCCGCAGG + Intronic
902398532 1:16145160-16145182 GCAGCTGGCGGGGCCCCTGCTGG - Intronic
902447840 1:16478391-16478413 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902467740 1:16628604-16628626 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902506840 1:16944124-16944146 CCTGCTGCTGGGCCACCTGCAGG - Exonic
903230418 1:21918977-21918999 GCTGCTGCTGCCCGCCCTACAGG + Intronic
904274210 1:29369712-29369734 GCTGCTGTCCAGCCCCCTCCTGG + Intergenic
904274219 1:29369741-29369763 TCTGCTTCCAGGCCCCCTGCTGG + Intergenic
904291499 1:29488822-29488844 GCTGCTGCCAACCCCTCTGCAGG + Intergenic
904337098 1:29805057-29805079 GCTGCTGCTGTGCCCACTGTAGG + Intergenic
904364501 1:30001802-30001824 GCTGCTGCCCAGCCCCCTCCTGG + Intergenic
904423754 1:30410377-30410399 GCTGCTGTCCAGCCCCCTCCTGG - Intergenic
904772145 1:32886454-32886476 GCTGCTGCGGCGCGCGCGGCAGG - Exonic
904773287 1:32893023-32893045 GCCCGCGCCGCGCCCCCTGCCGG + Intronic
905876079 1:41432888-41432910 GCTGCTGCAGCGCCCCCTGCTGG + Intergenic
906950749 1:50333160-50333182 GATGCGGCAGCGCCCCCTGCCGG + Intergenic
907298433 1:53470310-53470332 GCTGCCGTCGCGCCCTCTCCCGG - Intergenic
911017219 1:93346084-93346106 GCCGCTGCCGCTGCCGCTGCTGG - Exonic
911184128 1:94886507-94886529 GCTGCTGCCTCCTACCCTGCTGG + Intronic
912576140 1:110674527-110674549 GCCGCTGCCGCCCTCACTGCCGG - Exonic
913578054 1:120197137-120197159 GCTGCTGTCGCGCGTCCCGCCGG + Intergenic
913630085 1:120701102-120701124 GCTGCTGCCCAGCTCCCGGCTGG + Intergenic
913630117 1:120701215-120701237 GCTGCTGTCGCGCGTCCCGCCGG - Intergenic
914559970 1:148808557-148808579 GCTGCTGTCGCGCGTCCCGCCGG + Intronic
914560003 1:148808670-148808692 GCTGCTGCCCAGCTCCCGGCTGG - Intronic
914612830 1:149321545-149321567 GCTGCTGCCCAGCTCCCGGCTGG + Intergenic
914612863 1:149321658-149321680 GCTGCTGTCGCGCGTCCCGCCGG - Intergenic
915041523 1:152971899-152971921 GCTGCTGCCGCTGCTGCTGCTGG - Exonic
915216734 1:154345404-154345426 GTTCCTGCAGCGCCTCCTGCTGG + Exonic
919857953 1:201718508-201718530 GCTGGTGACGCGCCCTCTGTGGG + Exonic
920171505 1:204074799-204074821 GCAGCTGCCGCGGGCCCTCCAGG - Intronic
920535194 1:206732556-206732578 GGTGCTGCCGTGCCCCCAGGAGG + Exonic
920705045 1:208244434-208244456 GCTGGGGCCGCGCCCGCTGCTGG + Intergenic
921556139 1:216601073-216601095 GCTGCTGCCGCCCGCGCTGCCGG - Intronic
922486933 1:225980700-225980722 GCTGTTGCCCTGCTCCCTGCAGG - Intergenic
922539490 1:226408146-226408168 GCGGCGCGCGCGCCCCCTGCCGG + Intergenic
922674605 1:227542697-227542719 CCTGCGGGCGCGCCCCCTGGTGG + Intergenic
1062760090 10:11459-11481 ACCGCTGGCGCGCCCCCTGGTGG - Intergenic
1063963655 10:11328000-11328022 GCTGCTGCCTCCCCCAGTGCTGG + Intronic
1065019989 10:21495848-21495870 GGGGCAGCAGCGCCCCCTGCAGG - Exonic
1065189828 10:23199021-23199043 GCTCCTGCCGAGCCCGCTCCTGG + Intergenic
1067040780 10:42952098-42952120 CCTGCTGCCCCGCCCCTGGCTGG - Intergenic
1067337107 10:45374652-45374674 GCGGCGGCCGCGACCCCTGTCGG + Intronic
1067769941 10:49115636-49115658 GCGGCTCCCGCGCCCGGTGCGGG - Intergenic
1068669540 10:59709622-59709644 GCTGCGGCCCCGGCCCCTGCCGG + Exonic
1070257937 10:74826738-74826760 GCAGCGGCAGCGCCCCCGGCAGG + Exonic
1072102314 10:92240281-92240303 GCTGCTGCCGCTGCTGCTGCTGG + Exonic
1072188454 10:93062770-93062792 CATGCCGCAGCGCCCCCTGCAGG - Exonic
1072520948 10:96229712-96229734 ACTGCAGCTGCGCCCCCTGCTGG - Intronic
1072731512 10:97850007-97850029 CCCGCTGCCGCGGCTCCTGCAGG - Intergenic
1073380230 10:103072592-103072614 GCTGCTGCCGACTGCCCTGCAGG + Intronic
1073650623 10:105354457-105354479 ACTGCTGCAGAGGCCCCTGCTGG + Intergenic
1074121587 10:110497772-110497794 CCCGCTGCCCCGCCCCCTGCAGG + Intergenic
1074591876 10:114821726-114821748 GCTGCGGCGGCGCCCCCTGCAGG + Exonic
1074801505 10:117005267-117005289 GCTGCGGCCGCTTCACCTGCAGG + Exonic
1075129492 10:119726067-119726089 GCCGCTGCCGCCGCCGCTGCCGG + Intergenic
1075351276 10:121726940-121726962 TCTGCTCCCGAGCTCCCTGCAGG + Intergenic
1075568463 10:123521276-123521298 GCTGCTAGCTCGCCTCCTGCTGG + Intergenic
1075699833 10:124462051-124462073 CCTGCCGCCCCGCCCCCTGCCGG - Intronic
1076624911 10:131815862-131815884 GCTGCTGCCTGGACCCCTCCTGG - Intergenic
1076724036 10:132405099-132405121 GCCGCTGCCCAGCCTCCTGCGGG - Exonic
1076795635 10:132796909-132796931 GCTGCTCCCTCGCACTCTGCAGG + Intergenic
1077037496 11:502492-502514 GCTGCTGTCCCGCCCTCTGTGGG - Exonic
1077444457 11:2583843-2583865 GCTGCTACCACGCCCCATGGAGG + Intronic
1077538358 11:3135019-3135041 GCTTCTGCCTGGCCCTCTGCAGG + Intronic
1078318040 11:10307941-10307963 GAGGCTGTAGCGCCCCCTGCAGG + Intergenic
1080905780 11:36543394-36543416 GCTGCTGCCAGGCCACATGCCGG + Intronic
1083277709 11:61606567-61606589 GATGCTGCCGTGCCCACTGGGGG + Intergenic
1083571249 11:63763285-63763307 CCCGCGGCCGCGCCCCCCGCTGG - Exonic
1083827999 11:65213950-65213972 GCTGCTGCCCTGCGGCCTGCTGG + Intergenic
1084178700 11:67436215-67436237 GCTGCTGCTGCTCCTACTGCTGG - Exonic
1084275215 11:68047824-68047846 GGTGCTGCGGGGCCCCCAGCCGG - Intronic
1084387714 11:68854710-68854732 GCTGCAGCCCCCTCCCCTGCCGG + Intergenic
1084435187 11:69135357-69135379 GGTGCTGCCGGTCCCCCTCCTGG + Intergenic
1084496924 11:69510597-69510619 GCTGCTCCCACAGCCCCTGCTGG + Intergenic
1084697912 11:70767214-70767236 GCTGCTGCCTGGCCCTCTCCTGG - Intronic
1089397452 11:118145576-118145598 GCTCCTGCCGCACCCACTCCAGG + Intronic
1089494551 11:118901690-118901712 GCTGCTGCGGCACCAGCTGCTGG - Exonic
1091661436 12:2386779-2386801 GCTGGTGCTGCACTCCCTGCTGG - Intronic
1092489510 12:8932717-8932739 GCTGCTGCTGCGCCAACTGGAGG - Exonic
1092630257 12:10368809-10368831 GCTCCTGCTGCGAGCCCTGCTGG - Intergenic
1096459488 12:51814419-51814441 GCAGCTGCAGCGTCGCCTGCTGG + Intergenic
1096771587 12:53939119-53939141 CCTGCTTCCGCACCCCGTGCTGG + Exonic
1096946425 12:55413455-55413477 GCTGCTGCTGCGCCAACTGGAGG + Intergenic
1099202160 12:79690200-79690222 GCTGCCGCCGAGGCCGCTGCTGG + Exonic
1100433164 12:94548291-94548313 GCTGCTGCCCCGCTTCCTGGTGG + Intergenic
1104835409 12:131786878-131786900 GCTGCTGCCCCTCTACCTGCTGG + Intronic
1105805906 13:23951477-23951499 CCTGATGCAGCTCCCCCTGCAGG - Intergenic
1105858910 13:24392766-24392788 GCTGCTGCTCCCCCTCCTGCAGG + Intergenic
1106087617 13:26557659-26557681 GCCGCGGCCACGCCCCCTCCCGG - Intergenic
1107975464 13:45683969-45683991 CCTGCTGCTGCTCCCTCTGCTGG + Intergenic
1108313954 13:49220367-49220389 GCGGCTCCCGCGCCCCCTCGGGG - Exonic
1112325790 13:98442122-98442144 TCTGCCCCCGCGCCCTCTGCGGG + Intronic
1112450282 13:99501657-99501679 GCTGCTGTCGCTGCTCCTGCTGG + Exonic
1113200787 13:107866359-107866381 GCTGCTGCCGCTGCTGCTGCTGG + Exonic
1113765919 13:112881214-112881236 CCTCCTGCCGCTCCCCTTGCTGG + Intronic
1114658786 14:24331856-24331878 GCTGATGGAGCGCGCCCTGCGGG - Exonic
1114866200 14:26598002-26598024 GCTGCCGCCGCCGCCGCTGCCGG + Intergenic
1117097701 14:52314680-52314702 GCTGCTGGCGCGCCGCTGGCGGG + Exonic
1117119601 14:52553175-52553197 GCCGCTGCCGCCCCCGCAGCCGG + Exonic
1117409837 14:55440592-55440614 GCTTCTCTCGCGCCCTCTGCAGG - Exonic
1117755505 14:58970494-58970516 GCTGCTTCCGCGCCCCTCCCAGG - Intergenic
1119003891 14:70907489-70907511 GCCGCCGCCGCGACCCCCGCCGG - Exonic
1119106771 14:71932386-71932408 GCTGCAGCGGCGCCCGCTGTCGG - Intergenic
1119296787 14:73539223-73539245 CCTGCTGCCTAGCTCCCTGCTGG + Intronic
1119773820 14:77236602-77236624 GCTGCTGCCTCCCTCCCTGCAGG + Exonic
1119840711 14:77790775-77790797 GCTGCTGCTGCCCTTCCTGCTGG - Intergenic
1121042212 14:90758566-90758588 GCGGCTCCCGCGACCCCTGGCGG + Intronic
1121711048 14:96039448-96039470 GCTGCTGCCGCTGCCGCTGCGGG - Exonic
1122226835 14:100285389-100285411 GCGGCGGCGGCGCACCCTGCGGG - Intergenic
1122296698 14:100709873-100709895 GAGCCCGCCGCGCCCCCTGCCGG - Intergenic
1122369599 14:101222057-101222079 GCCGCTGCCCCTGCCCCTGCTGG + Intergenic
1122504943 14:102226510-102226532 CCTGCTGCCGGGGCCCCGGCGGG - Intronic
1122624180 14:103075718-103075740 GGTGCTCCAGCGCCCCCTCCCGG - Intergenic
1122630436 14:103105109-103105131 GGCGCTCGCGCGCCCCCTGCTGG - Intronic
1122742451 14:103880134-103880156 GCTGCTGCCCCACCCCCACCCGG + Intergenic
1122899824 14:104777815-104777837 GCTGGTCCCGAGCCCCCTCCTGG - Intronic
1122925145 14:104896008-104896030 GCCTCTGCCGTGGCCCCTGCTGG + Exonic
1122975324 14:105168518-105168540 GCCGCTGCCGCTGCCTCTGCGGG - Exonic
1124584468 15:30991954-30991976 GCTGCCGCCGTGGCCCCCGCAGG - Intergenic
1126150866 15:45522714-45522736 GCGCCCGCCGCGCCCGCTGCTGG + Exonic
1128209980 15:65891103-65891125 GCTGGTGCCACGCCCCTTTCTGG + Exonic
1128736135 15:70055012-70055034 GCTGCTGCGCCGCCTCCAGCTGG - Intronic
1128866307 15:71117190-71117212 GCTGGTGCCCCGCCCAGTGCTGG - Intronic
1129389124 15:75211797-75211819 GCTGCTGCCGCCACCCCAGGAGG + Exonic
1129853771 15:78810600-78810622 GCTGCTGGCGCGGCCCCTGGCGG - Intronic
1130023646 15:80251958-80251980 CCCGCTGCCGCGGCGCCTGCGGG - Intergenic
1132368667 15:101277444-101277466 CCTGCCGCCGCGCCTCCAGCCGG + Exonic
1132393240 15:101454012-101454034 GCTCCTGCCAGGCCCCCTCCTGG + Intronic
1132521617 16:392806-392828 GCTGCTGCTCCGCCACCTCCTGG - Intergenic
1132692709 16:1188777-1188799 GCCGCTTCCTCGCCCCCTCCTGG + Intronic
1132999694 16:2842634-2842656 CCTCCTGCAGCGCCCCCTGTTGG - Intergenic
1133209244 16:4253925-4253947 GCTGCGGCCCCGCCCCTTCCCGG - Intergenic
1133346145 16:5071888-5071910 GCTGCTGCCGCTGCTGCTGCTGG + Exonic
1133401526 16:5490749-5490771 GAAGCTGCCGCGCCCCCTGCAGG + Intergenic
1134492143 16:14703329-14703351 GCTGCTGCGGTGCCGCCTGTAGG + Intergenic
1134497524 16:14742451-14742473 GCTGCTGCGGTGCCGCCTGTAGG + Intronic
1135970338 16:27067472-27067494 GCTGCTGCCGCTGCCGCTGCCGG - Intergenic
1136156108 16:28383331-28383353 CCTGCTGCTGCGCAGCCTGCAGG - Exonic
1136206978 16:28731957-28731979 CCTGCTGCTGCGCAGCCTGCAGG + Exonic
1136687334 16:32003044-32003066 GCAGCTGCCCCGCCCCAGGCAGG + Intergenic
1136787944 16:32946595-32946617 GCAGCTGCCCCGCCCCAGGCAGG + Intergenic
1136881837 16:33907194-33907216 GCAGCTGCCCCGCCCCAGGCAGG - Intergenic
1137655310 16:50153794-50153816 GCTGCTGCCGCTCCCGCCGGTGG - Exonic
1139466047 16:67154765-67154787 GCTGCTGCGGCGCTTCGTGCAGG - Exonic
1139890901 16:70252765-70252787 CCAGCTGCAGCGCCTCCTGCAGG + Exonic
1140093572 16:71856343-71856365 GCTGCTGCCACACACACTGCAGG - Exonic
1140205182 16:72927683-72927705 GCTGCTGCAGCTCCCCCGGGCGG - Intronic
1140222956 16:73057766-73057788 GCGGCCGCCTCGCCCCCTCCGGG + Intronic
1141079132 16:81035743-81035765 GCGGCCGCGGCGCCCCCTGCCGG - Intergenic
1141428158 16:83956926-83956948 GGGGCAGCCGCGCCCTCTGCTGG - Intronic
1141462701 16:84187111-84187133 GGTCCTGGCGCGCCCCCTCCCGG + Intergenic
1142007015 16:87694153-87694175 GCTGCTGCCCCTCCTCCTCCTGG - Intronic
1142132374 16:88436941-88436963 GCTGCTGCGGGGGCACCTGCAGG + Exonic
1142206342 16:88784904-88784926 GCTGCTGCCCTGCGCGCTGCTGG - Exonic
1142409848 16:89910457-89910479 GCTGCTGCTCTGCCCCCTGGCGG + Intronic
1203090174 16_KI270728v1_random:1208252-1208274 GCAGCTGCCCCGCCCCAGGCAGG + Intergenic
1142496566 17:309465-309487 GCTCCTGCCAGCCCCCCTGCTGG + Intronic
1142496591 17:309525-309547 GCTCCTGCCAGCCCCCCTGCTGG + Intronic
1142672001 17:1491691-1491713 GCTGCGGCCCGGCCCCCGGCGGG - Intronic
1142699119 17:1649014-1649036 GCAGCTGCAGCGCCTCCTGCTGG - Exonic
1144608709 17:16690006-16690028 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1144608718 17:16690054-16690076 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1144608727 17:16690102-16690124 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1144758647 17:17694841-17694863 GCTGAGGCCCCGCCCCCTGGCGG + Intronic
1144904089 17:18625725-18625747 GGAGCTGCAGCGCCACCTGCAGG - Intergenic
1145058150 17:19716493-19716515 GCTGCTGCCCTGCCCTCAGCAGG - Exonic
1145128484 17:20320921-20320943 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1145128492 17:20320969-20320991 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1145241345 17:21242491-21242513 GCTGCAGGCCCGCCCCTTGCTGG - Exonic
1145271202 17:21405773-21405795 GCGGCTGCTGTGGCCCCTGCAGG + Intronic
1145309406 17:21693160-21693182 GCGGCTGCTGTGGCCCCTGCAGG + Intronic
1146339677 17:32007869-32007891 GCTGCCCCCGCGCCCCCGCCGGG - Intronic
1146352999 17:32111531-32111553 GGTGCTGTGGCGCCCCCAGCAGG + Intergenic
1146716214 17:35089107-35089129 GCTGCGGCCGCCCTCCCGGCCGG + Exonic
1146793131 17:35764230-35764252 GCCGCAGCAGCGCCACCTGCTGG - Exonic
1146957666 17:36946244-36946266 CCTCCTGCTGCGCCTCCTGCGGG - Intergenic
1147148313 17:38498713-38498735 GCAGCTGCCCCGCCCCGGGCAGG + Intronic
1147587824 17:41662807-41662829 GGAGCAGCAGCGCCCCCTGCCGG + Intergenic
1147672420 17:42184294-42184316 TCGGCTGCAGCGCCTCCTGCAGG - Exonic
1147943504 17:44066607-44066629 GCTGCTGCCGCCGCCGCCGCCGG - Exonic
1148156782 17:45429244-45429266 GCTGCTGCCCCAAGCCCTGCTGG - Intronic
1148178418 17:45586359-45586381 GCAGCAGCCGCGCCTCCTGCAGG - Intergenic
1148262249 17:46193571-46193593 GCGGCGGCCGCGCCTCCTGGCGG - Intronic
1148270741 17:46260096-46260118 GCAGCAGCCGCGCCTCCTGCAGG + Intergenic
1148336047 17:46841982-46842004 TCTGCAGGAGCGCCCCCTGCCGG - Intronic
1148838389 17:50478741-50478763 GGGGCTGCGGCGCCACCTGCCGG - Intergenic
1149263129 17:54900624-54900646 GCACCTGCAGCGCGCCCTGCGGG - Exonic
1150388495 17:64778031-64778053 GCTGCTGCCCCAAGCCCTGCTGG - Intergenic
1150790966 17:68199923-68199945 GCTGCTGCCCCAAGCCCTGCTGG + Intergenic
1151414574 17:73952904-73952926 GCCGCGGCCGCGCCCCCTGCCGG + Intergenic
1151477391 17:74351860-74351882 GCTGCTCCAGCGCCAGCTGCAGG - Exonic
1151611884 17:75182183-75182205 GCCGCTGCCCCTCCCCCTTCGGG + Intergenic
1151785208 17:76271992-76272014 CCTCCTGCCTCGCCCTCTGCTGG + Intergenic
1151840645 17:76615128-76615150 GGTGCTGCCTCCTCCCCTGCTGG + Intergenic
1152099032 17:78290338-78290360 GCCGCTGCCGCCCAGCCTGCAGG - Intergenic
1152306185 17:79521987-79522009 TCTGCTGCTGCTCCCGCTGCTGG + Intergenic
1152702494 17:81825968-81825990 CCCCCTGCCTCGCCCCCTGCTGG + Exonic
1152721845 17:81927366-81927388 GGGTCTGCCGCGCACCCTGCTGG - Intronic
1152729349 17:81961918-81961940 ACTGCTGCCGGGCCCTCGGCTGG - Intergenic
1152848279 17:82615894-82615916 GGTGCTGTGGCGCCCCCAGCTGG + Exonic
1152947399 17:83205506-83205528 GCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947415 17:83205574-83205596 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947431 17:83205642-83205664 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947447 17:83205710-83205732 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947465 17:83205778-83205800 CCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947481 17:83205846-83205868 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947499 17:83205914-83205936 CCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1153928771 18:9859459-9859481 TTTCCTGCCCCGCCCCCTGCAGG - Exonic
1155212995 18:23619182-23619204 GCTGGTGCTGCGCCTCCTGCAGG - Intronic
1155264349 18:24076465-24076487 GCTGCTGGAGCGGCCCCTGTAGG + Intronic
1156036159 18:32770321-32770343 GCTGCTGCGGCGGCTGCTGCTGG + Exonic
1159922102 18:74235903-74235925 GCTGCTGCCGAGACCACTGCTGG - Intergenic
1160534992 18:79586945-79586967 CCTGCTGCCCCGGCACCTGCGGG + Intergenic
1160583165 18:79899111-79899133 GTTCCTGCTGCGCTCCCTGCAGG + Exonic
1160621141 18:80171397-80171419 GCTGCTGTGGCGCCCCCTGCTGG - Exonic
1160832095 19:1108908-1108930 GCCGCAGCCGCAGCCCCTGCAGG + Exonic
1160858677 19:1228547-1228569 GCTGCTGCCGCCGGCCCTGAGGG - Exonic
1161158703 19:2749381-2749403 GTGGCTGCCGCGCCCCCTGGCGG + Intergenic
1161393761 19:4034203-4034225 GCTGTGGCCTCGCGCCCTGCCGG - Intronic
1161412446 19:4123965-4123987 GCTGCGGCCGCGGCCCAGGCCGG + Exonic
1161564963 19:4996891-4996913 GCTGCTGCTCAGCACCCTGCAGG - Intronic
1162126659 19:8503039-8503061 GCCACTGCCCCGGCCCCTGCTGG + Exonic
1162374175 19:10295366-10295388 CTTGCTGCCTCGCCCCCTGGAGG + Exonic
1162481107 19:10927692-10927714 GCTGCTGCTGCTGCTCCTGCAGG + Exonic
1162486086 19:10961260-10961282 GCTGCCGGCGCGCCCTGTGCGGG + Intronic
1162524120 19:11197601-11197623 GCTGGTCCCGCCCCCCCAGCCGG + Intronic
1162534517 19:11254860-11254882 GCACCTGCTGTGCCCCCTGCTGG - Intronic
1162805465 19:13135931-13135953 GCTGCTGCCACCCCACCGGCTGG - Exonic
1162923681 19:13918934-13918956 GCTGCTCCAGCGCCTCCAGCAGG - Exonic
1163158125 19:15449873-15449895 GCCGCTGCCGCTCCCGGTGCCGG + Exonic
1163321237 19:16576245-16576267 GCAGCTGCCTGGCCCCTTGCCGG + Exonic
1163422104 19:17219516-17219538 GCTGGTGCTGTGCCCTCTGCTGG - Intronic
1164402092 19:27909689-27909711 GCTGTTGCCGCCCCCGCGGCTGG + Intergenic
1164594978 19:29526559-29526581 GCCGCCACCGCGCCCCCCGCGGG + Exonic
1165861626 19:38912104-38912126 GCTGCTGCGGCTGCTCCTGCTGG - Exonic
1165899719 19:39163387-39163409 CCTCCTGCCCCGCCCCCTCCAGG - Intronic
1165922428 19:39307483-39307505 GAGGCTGCCCCGCCCCCTCCCGG + Exonic
1166389558 19:42401576-42401598 GCTGCTGCGGCGACCGCCGCAGG - Exonic
1166390699 19:42407393-42407415 GCTGTGGCCGCGCCCCCAGCAGG - Exonic
1166694745 19:44846235-44846257 GCTCCGGCCCCGCCCCCTCCTGG - Intronic
1166963419 19:46513628-46513650 GGTCCTGCAGCGCCCCCTGGTGG + Intronic
1167285536 19:48596867-48596889 GCTGCTGCCTCCCAGCCTGCTGG + Exonic
1167375070 19:49106832-49106854 CCAGCTGCAGCGCCACCTGCTGG + Intronic
1167509862 19:49890350-49890372 GCCGCTGCCCCGCCACATGCAGG - Exonic
1167660000 19:50790770-50790792 GCTGCTGGCGGACCCCCTCCTGG - Exonic
1167926073 19:52821751-52821773 GCTCCGGCCCCGCCCTCTGCGGG - Intronic
1167930257 19:52857737-52857759 GCTCCGGCCCCGCCCTCTGCGGG - Intergenic
1167972439 19:53197006-53197028 CCTCCGGCCCCGCCCCCTGCCGG + Intergenic
1168293824 19:55369519-55369541 GCTTCTGCCGCCCACCCGGCGGG - Intronic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
925383986 2:3449165-3449187 GCTCCTCCCACGCGCCCTGCAGG + Intronic
925609861 2:5693486-5693508 GCTGCTGCCCCGGCGGCTGCAGG - Exonic
925907126 2:8546174-8546196 CCTCCTGCCGCCCGCCCTGCCGG + Intergenic
926197277 2:10771614-10771636 GCTGCTGCCTCCTCCCCTCCAGG - Intronic
930700566 2:54455905-54455927 GCTGCTGCCGCTACCCGAGCAGG - Intergenic
930847764 2:55923796-55923818 CCTGCCGCCGCGGCCGCTGCCGG - Exonic
931355838 2:61537474-61537496 GCCGCCGCCGCGCCCCACGCCGG + Intronic
934588490 2:95526586-95526608 GCTGACGCCGCGCTCCATGCGGG + Intergenic
934966854 2:98731106-98731128 GCCGCTGCCGCCGCCGCTGCGGG + Intronic
935013186 2:99154938-99154960 GATGCTGCCCCGCCCCCTGAGGG - Exonic
935060320 2:99601558-99601580 GCTGCTGCTGCTGCCCTTGCTGG + Exonic
935854037 2:107255929-107255951 GCTGCCTCTGCGCCTCCTGCTGG - Intergenic
936076063 2:109402569-109402591 GCTGCTGCAGTGGCCCTTGCTGG - Intronic
936561418 2:113542252-113542274 GCCGCCGCCGCGCCCTCTCCTGG + Intergenic
936661342 2:114547310-114547332 GCTGCTGCTGCTGCCCCTGCAGG + Intronic
937044254 2:118842900-118842922 GCCGCGCCCGCGCCCCCTCCCGG - Exonic
937956063 2:127422426-127422448 GCTGCTGCGGCGGCTGCTGCTGG - Intronic
938319898 2:130355825-130355847 TCGGCTGCCGCGCCCACTGGTGG - Intergenic
938383232 2:130848224-130848246 GCTGCTCCCGCCCACCCTGTGGG + Intronic
938392404 2:130916209-130916231 GCTGCTGCAGCACCGCCTTCGGG - Intronic
938770831 2:134499424-134499446 GCTGCTGCCTCCCAACCTGCAGG - Intronic
940775127 2:157876494-157876516 GCCGTCCCCGCGCCCCCTGCAGG + Intergenic
940945716 2:159615669-159615691 GCTGCTCCCCCACTCCCTGCCGG - Intronic
941979089 2:171434747-171434769 GCGGCGGCCGAGCCTCCTGCGGG + Exonic
943890275 2:193277312-193277334 GGTGCTGCCGCTCCCGCTTCCGG + Intergenic
945245165 2:207711370-207711392 CCTGCTGCCCCGCCCCCGCCTGG - Intergenic
946109390 2:217401091-217401113 GCTGCTGCTGCTCTTCCTGCAGG - Intronic
947593184 2:231396279-231396301 GCTGCGGGCGCTCCACCTGCCGG - Intronic
947761354 2:232605979-232606001 GCGCCTGGCGCGCCCTCTGCTGG - Intergenic
948661298 2:239508144-239508166 GCTGCTGCAGCGCCCTGTGGCGG + Intergenic
948843732 2:240672980-240673002 GCTGCAGCGGCGCCAGCTGCGGG - Intergenic
948850034 2:240701338-240701360 GCTGCTGCGGCGCCAGCCGCGGG + Intergenic
1169213045 20:3778217-3778239 GCTGCTTACGCTCCGCCTGCTGG + Exonic
1169853346 20:10077252-10077274 TCCACTGCAGCGCCCCCTGCAGG + Intergenic
1172446824 20:34997541-34997563 GCTTCTGCCGCACCCGCTGCAGG - Exonic
1174386499 20:50190913-50190935 GCTGCTGCTGCCGCCGCTGCCGG - Exonic
1174467919 20:50731643-50731665 GCTGCGGCCGCCCCCTCTGCAGG + Exonic
1175159199 20:56995410-56995432 GGTGCTGCCGCACCTCCAGCAGG - Intergenic
1175865276 20:62172716-62172738 GCTGCTGCGCGGCACCCTGCTGG - Exonic
1175915362 20:62423471-62423493 GCTGCAGCTCCGCCCCCTCCTGG - Intronic
1175950040 20:62578498-62578520 CCTGCAGCCCCGCCTCCTGCTGG + Intergenic
1176030532 20:63009153-63009175 GCCCCTGCTGCGGCCCCTGCGGG + Intergenic
1176207097 20:63895153-63895175 GCCGCTGCCGCTGCCGCTGCCGG + Intergenic
1177783000 21:25639854-25639876 GCTGCTGCTGCGCTACCTGGTGG + Exonic
1178365391 21:31985619-31985641 CTGGCTGCCCCGCCCCCTGCCGG - Intronic
1179798895 21:43801432-43801454 GCTGATGACGCGCCCGCTGGCGG - Intronic
1179810653 21:43866961-43866983 GGTGCTGCCCCGCCCCAGGCTGG + Intronic
1180222286 21:46366641-46366663 GCTGCTCCTGGGCCTCCTGCAGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1180950667 22:19719144-19719166 GCTGCCGCCGCCCCCGCGGCTGG + Intronic
1181030960 22:20148763-20148785 GCTGCTGCTGGGCGCCCTGCTGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1181130545 22:20729085-20729107 GCTGCTGCAGCACCCCAGGCAGG + Intronic
1181309914 22:21939079-21939101 GCTGCTGCCCCGAGACCTGCTGG + Intronic
1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG + Intergenic
1182150373 22:28023218-28023240 ACTGCTGCCGTGGCTCCTGCAGG - Intronic
1184080263 22:42214357-42214379 GCTGCTGCTGCTGCCCCTGTTGG + Exonic
1184549841 22:45198587-45198609 GCTGCAGCCCTGCTCCCTGCTGG + Intronic
1184587359 22:45457047-45457069 GTTCCTGCCTCGCCCCCTCCAGG + Intergenic
1184662270 22:45970867-45970889 CCTGCTGCCCCGCCCCCCTCAGG + Intronic
1185130822 22:49037619-49037641 GCTGCGGCCTCTCCCGCTGCAGG - Intergenic
1185211739 22:49574361-49574383 GCTGCTGCCTGGCCCCCCGCAGG - Intronic
1185371197 22:50461688-50461710 GCTGCGGCCGCGCCTGCTGCCGG - Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950053912 3:10010856-10010878 AGTGCGGCCGCGTCCCCTGCGGG - Intronic
950415836 3:12868763-12868785 AGTGCGGCCGCGTCCCCTGCGGG - Intronic
950417286 3:12875882-12875904 AGTGCGGCCGCGTCCCCTGCAGG - Intergenic
950429062 3:12940562-12940584 GCAGCTGCCTCTGCCCCTGCTGG - Intronic
950483108 3:13256874-13256896 GCTGGTGCTGCACCCGCTGCTGG - Intergenic
950509830 3:13419697-13419719 GCTGCCCCGGCGCCCCCTCCCGG + Intronic
950668017 3:14509074-14509096 GCTCCTGGAGCGCCCCCTGCTGG - Intronic
952301218 3:32106374-32106396 GCTCCCGCCGCGCCACATGCAGG - Intronic
952816471 3:37452033-37452055 GGCGCGGCAGCGCCCCCTGCGGG - Intergenic
955201519 3:56856046-56856068 TCTGCGGCAGGGCCCCCTGCTGG - Intronic
956417861 3:69052100-69052122 GGTGCTGCCGCCGCCACTGCCGG - Exonic
956675043 3:71725333-71725355 CCGGCCGCCGCGCCCCCCGCCGG - Exonic
958141875 3:89571817-89571839 CCTGCTGCCACGGCCCCTTCTGG - Intergenic
959840576 3:110969613-110969635 GTTGTTGCCGCGGCCCCAGCAGG - Intergenic
960024319 3:112990911-112990933 CCCGCTGCCGCGACGCCTGCTGG - Exonic
961044098 3:123696941-123696963 GCTGCTGCGGGGCCCCCGCCTGG + Intronic
961483275 3:127197353-127197375 GCTGCTCCCGCTCCTCCTCCCGG + Exonic
964548948 3:157865527-157865549 GAGGCTGCCACGCCCCCTGCTGG - Intergenic
966593816 3:181709700-181709722 GTGGCTGGTGCGCCCCCTGCTGG - Intergenic
966985049 3:185172482-185172504 GCTGCTGTCTCTCCCACTGCTGG + Intergenic
968433817 4:575186-575208 GCTGCAGCCGCCGCCCCCGCCGG + Intergenic
968472172 4:787172-787194 GATGCGGCCGCGGCCCCAGCAGG + Intronic
968845378 4:3038278-3038300 GCTCCTGCCCAGCCCCGTGCGGG - Intronic
968939666 4:3631284-3631306 GCTCCTGCCTCGCGCTCTGCTGG - Intergenic
969676557 4:8617644-8617666 GTTGCTGCTGAGCCCCGTGCAGG + Intronic
969718939 4:8882427-8882449 CCATCTGCCGCACCCCCTGCTGG + Intergenic
971918772 4:32909890-32909912 GCTGCTGTGGTGCCCCCTCCTGG - Intergenic
978503471 4:109433562-109433584 GCCGCCGCAGCGCCCCCTGCAGG - Intergenic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
984463052 4:180059416-180059438 GCTGCAGCCGCCCTCCCTGGCGG + Intergenic
984578198 4:181475963-181475985 GCTGGAGCCGCACCGCCTGCTGG - Intergenic
985664320 5:1174031-1174053 GCTGCTTCCCCTCCCTCTGCTGG + Intergenic
986733085 5:10649498-10649520 GCTGACGCCGCGCTCCGTGCGGG + Exonic
988663366 5:33297995-33298017 TCTGCTATCGCGCACCCTGCTGG + Intergenic
991702926 5:69332799-69332821 GCTGCCGCCGCGCGTCCTCCGGG + Intronic
996056430 5:118988221-118988243 GAGGGTGCGGCGCCCCCTGCCGG - Intronic
999298294 5:150474345-150474367 ACTGCTCCCTCACCCCCTGCTGG + Intergenic
1001456268 5:171862690-171862712 GCTGCTGCTGTGGCCCCAGCAGG - Exonic
1002006567 5:176238891-176238913 GCTCCTGGCGCGCCTGCTGCAGG + Intronic
1002135610 5:177105755-177105777 GCAGCTGCAGCTCCCACTGCGGG + Intergenic
1002193734 5:177491576-177491598 AATGACGCCGCGCCCCCTGCTGG - Intronic
1002219811 5:177671745-177671767 GCTCCTGGCGCGCCTGCTGCAGG - Intergenic
1002352382 5:178592135-178592157 GCTGCTTCGGCCTCCCCTGCTGG - Intergenic
1002572083 5:180145814-180145836 GCTGCTGCTGGGACCTCTGCAGG + Intronic
1002741295 5:181437260-181437282 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002741311 5:181437328-181437350 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002741327 5:181437396-181437418 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002741343 5:181437464-181437486 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002741359 5:181437532-181437554 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002741375 5:181437600-181437622 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002741391 5:181437668-181437690 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002928388 6:1618229-1618251 GCTTCTCCCGGGCCCCCTCCTGG + Intergenic
1003072053 6:2952692-2952714 CCCGCTACCGCGCCTCCTGCTGG - Intronic
1004203871 6:13574221-13574243 TCGGCTGCAGCGGCCCCTGCCGG - Intergenic
1004320919 6:14630713-14630735 GCTGCTGCCGTTACCTCTGCTGG - Intergenic
1004615022 6:17281328-17281350 TCTCCTCCCGCCCCCCCTGCCGG - Exonic
1005959522 6:30685724-30685746 GCTGCTGCTGCCGCTCCTGCCGG + Exonic
1006154236 6:32005706-32005728 GCTGCTGCTGCTGCCCCTGCTGG + Intergenic
1006160540 6:32038440-32038462 GCTGCTGCTGCTGCCCCTGCTGG + Exonic
1006614965 6:35319948-35319970 GCTGCTGCTGGGCCTGCTGCAGG - Exonic
1007967385 6:46015432-46015454 GCACCTGCCGCGCCTCCCGCCGG - Intronic
1008045653 6:46849116-46849138 GAGGCTCGCGCGCCCCCTGCTGG - Intergenic
1011806281 6:91076071-91076093 GCTGCTGCAGCTCCTGCTGCTGG - Intergenic
1012426834 6:99124095-99124117 CTTGCAGCCCCGCCCCCTGCCGG - Intergenic
1012749575 6:103140527-103140549 CCTGCTGCCTCGGCCCCTTCTGG - Intergenic
1013464820 6:110408999-110409021 GCTGGAGGCGAGCCCCCTGCAGG + Intronic
1014632529 6:123803895-123803917 GCTGCCGCTGCTGCCCCTGCGGG + Intergenic
1015149106 6:130019307-130019329 GCCGCCCCCGCGCCCCCCGCCGG - Intronic
1015554954 6:134451719-134451741 CCAGCTTCCACGCCCCCTGCAGG + Intergenic
1017450391 6:154549368-154549390 GCTCCTGCCCCGCCCACTGCGGG + Intergenic
1017719633 6:157235802-157235824 GCTGCTGCCCCGCTCCCTTGCGG + Intergenic
1018911279 6:168101863-168101885 GCTGCTGGCGACCCCGCTGCCGG + Intergenic
1018974818 6:168556316-168556338 GCTGCTCCCGCACCCCATGTGGG - Intronic
1019216516 6:170447360-170447382 GCTGCTGGTGCGGGCCCTGCCGG + Intergenic
1019246413 6:170712957-170712979 CCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246429 6:170713025-170713047 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246445 6:170713093-170713115 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246461 6:170713161-170713183 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246477 6:170713229-170713251 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246493 6:170713297-170713319 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246509 6:170713365-170713387 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246525 6:170713433-170713455 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019253770 7:35468-35490 GCTGCTGCCGCCGCCGCCGCCGG + Intergenic
1019527348 7:1486735-1486757 GCAGCTGCTGGGCCGCCTGCAGG - Exonic
1019613410 7:1948130-1948152 GCCACTCCCTCGCCCCCTGCAGG - Intronic
1019670981 7:2278192-2278214 GCTGCTGTCCCACACCCTGCAGG - Exonic
1020001239 7:4757151-4757173 CCTGCTTCCGCACCCCCTTCGGG + Exonic
1022505827 7:30908200-30908222 GCTGTTCCCTCGCCCTCTGCTGG - Intergenic
1023054982 7:36283980-36284002 GCTGCTGCCGCCGCCACTGGGGG - Intronic
1023381121 7:39609683-39609705 ACTACTGCCGCGTCCCCTCCCGG + Intronic
1023418261 7:39951234-39951256 GCTGCTGCGGCGGTCCCGGCGGG - Exonic
1023801512 7:43839017-43839039 GCGGCTCGCACGCCCCCTGCTGG + Intergenic
1026595848 7:71733444-71733466 GATGCTCTAGCGCCCCCTGCTGG + Intergenic
1026883526 7:73922242-73922264 GCTGCTGGCGAGCCCGATGCTGG + Intergenic
1028814908 7:95132684-95132706 GCTGCTCACCCGCCCGCTGCAGG + Intronic
1029123192 7:98281724-98281746 GCCGCCGCCGCGTCCCCCGCCGG + Exonic
1029701403 7:102248858-102248880 GCAGCAGCAGCGCCCCCCGCAGG + Exonic
1030855860 7:114556376-114556398 GCTGCTGCTGCTTCCCCTGCAGG + Intronic
1031145530 7:117993605-117993627 GCTGCTGCTGCTGCCCCTACAGG - Intergenic
1032020707 7:128405965-128405987 GCTGCTGCCGCGGGCCGGGCGGG + Intronic
1032160080 7:129502988-129503010 GCGGCTGCTGCGCCCCCAGCAGG - Intronic
1033658984 7:143390963-143390985 GCTGCACCCGCGCCCTCGGCCGG + Exonic
1034182137 7:149147377-149147399 GCGGCCAGCGCGCCCCCTGCCGG - Intronic
1034462291 7:151204616-151204638 GCGGCTGCTGCGACGCCTGCTGG - Exonic
1034959972 7:155358991-155359013 TCTGCAGCCCCGCCCACTGCAGG + Intronic
1035075233 7:156173485-156173507 GCTGCTGCCGCGTCTCCTCTGGG + Intergenic
1035446340 7:158945559-158945581 GCTTCTGCCCCTCTCCCTGCAGG + Exonic
1035501614 8:94528-94550 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
1035501630 8:94596-94618 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
1035501646 8:94664-94686 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
1035501662 8:94732-94754 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
1035501677 8:94800-94822 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
1036755307 8:11467295-11467317 GCCGATGCCGCGCCCCTGGCGGG - Intronic
1039476984 8:37844155-37844177 ACTGCTGCGGCTCCTCCTGCAGG - Exonic
1039558827 8:38496614-38496636 GCTGCTGCCGCCCCCTCACCAGG + Intergenic
1040079598 8:43274173-43274195 GGTGCTGCTGCCTCCCCTGCAGG + Intergenic
1040386424 8:46917830-46917852 GCGCCTGGCGCGCCCCCTGCTGG - Intergenic
1040415238 8:47189238-47189260 GCTGCTGCGGCGGCCGCGGCCGG - Intergenic
1040727353 8:50398336-50398358 TCTCCTGCAGCGGCCCCTGCTGG + Intronic
1040862008 8:52008641-52008663 GCAGCTGCCCTGCCCTCTGCTGG + Intergenic
1043441188 8:80278439-80278461 TCTGCCGCCTCGTCCCCTGCAGG + Intergenic
1044927132 8:97218867-97218889 GCTCCTGCCACCCTCCCTGCTGG + Intergenic
1044988622 8:97776141-97776163 GTTGCTTCCGCGCCCCTAGCTGG + Intronic
1045259525 8:100559831-100559853 GCCCCCGGCGCGCCCCCTGCAGG + Intergenic
1048321008 8:133400143-133400165 GCTGCTGACCCGTCCTCTGCAGG + Intergenic
1049104579 8:140603919-140603941 GCTTCTGCTGTGCCCTCTGCTGG + Intronic
1049254612 8:141606983-141607005 GCTGCTGCCCGAGCCCCTGCAGG - Intergenic
1049404707 8:142447257-142447279 ACTGCTTCCGGGCGCCCTGCTGG + Intergenic
1049509779 8:143021744-143021766 GCTGCTGCTGAGCCTGCTGCCGG + Exonic
1049689337 8:143951884-143951906 GCTGCTGCCGCCCCCACTGAGGG + Intronic
1049791820 8:144475739-144475761 GCCGCTGCAGGGCCCCATGCGGG + Exonic
1049891268 9:73088-73110 GCCGCCGCCGCGCCCTCTCCTGG - Intergenic
1050123873 9:2336266-2336288 GCTGTTACTGCACCCCCTGCTGG - Intergenic
1050335107 9:4583066-4583088 GCTGCTGGCGTGCCCCAGGCTGG + Exonic
1050364909 9:4864897-4864919 GCTGCTGCCGGACTCCCTGGGGG + Intronic
1052295450 9:26892500-26892522 GCTGCCGCCGCTCCCACCGCCGG + Exonic
1053503685 9:38621961-38621983 GCTGCAGCGGTGCCCGCTGCAGG - Intergenic
1054764951 9:69035720-69035742 GGTGCTGCGGCGACCCCTGGTGG - Exonic
1056163546 9:83921263-83921285 GCCGCTCCCGCGCCCCCAGCCGG - Intronic
1056309053 9:85321317-85321339 GCTGCTGCTGGCCCCCCTGTGGG + Intergenic
1057250248 9:93495071-93495093 GCTGCTGCTGGCCCCCCTGTAGG - Intronic
1057261334 9:93586483-93586505 GCTGCTGGCCCTCCCCCAGCTGG - Intronic
1057489190 9:95508557-95508579 GCTGCGGCCGCGGCCGCTGCCGG + Exonic
1058826114 9:108777423-108777445 GCTGCAGGCTCGCCACCTGCAGG - Intergenic
1058885882 9:109320823-109320845 GCTGCTCCCGCGCCGCGCGCCGG + Exonic
1059096591 9:111422659-111422681 GCTGCTTCCACGCCCAGTGCAGG - Intronic
1059119770 9:111631470-111631492 GCTGCTGGCGCCCCTGCTGCCGG + Exonic
1059769832 9:117414794-117414816 GCTGCCGCCGCCGCCGCTGCTGG - Exonic
1060881991 9:127123800-127123822 CCTGCTGCCGGGCACCCTGCGGG + Intronic
1060979619 9:127785120-127785142 AGTGCCGCCGCGCCCCCTGGCGG + Intergenic
1061009776 9:127948126-127948148 GGTGCTGCTGCCCCCACTGCTGG + Exonic
1061968863 9:134032734-134032756 GCTGCTGCCGCGCCACCCTTGGG - Exonic
1061993136 9:134170917-134170939 GGTGCGGCCCCGCCCCCTGGTGG - Intergenic
1062185149 9:135214277-135214299 GCTGGTGCAGGGCCCACTGCAGG + Intergenic
1062350321 9:136135521-136135543 GCAGCTGCCGTGGCCCTTGCTGG + Intergenic
1062397646 9:136358838-136358860 GCTCCTGTCGAGGCCCCTGCAGG - Exonic
1062475194 9:136723228-136723250 ACTGCTGCCGCCTGCCCTGCAGG + Exonic
1062535469 9:137019306-137019328 GCCCCTGCCTCACCCCCTGCAGG - Exonic
1062566484 9:137166034-137166056 GCTGCCGCCACACCTCCTGCAGG - Intronic
1062574719 9:137200782-137200804 GCCGCGGCCACGCCCCCTCCCGG + Exonic
1062592238 9:137279496-137279518 GCTCATGCCGCGGCCGCTGCTGG + Exonic
1062746626 9:138217075-138217097 GCTGCTGCTGCCGCCGCTGCCGG - Intergenic
1203607174 Un_KI270748v1:68340-68362 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607190 Un_KI270748v1:68408-68430 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607206 Un_KI270748v1:68476-68498 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607222 Un_KI270748v1:68544-68566 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607238 Un_KI270748v1:68612-68634 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607254 Un_KI270748v1:68680-68702 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607270 Un_KI270748v1:68748-68770 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607286 Un_KI270748v1:68816-68838 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607302 Un_KI270748v1:68884-68906 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1185736651 X:2500947-2500969 GCCGCTTCCGCGCCGCCCGCGGG + Exonic
1186618548 X:11214685-11214707 GCTGGGGCCACGCCCCCTGCAGG - Intronic
1187163649 X:16786199-16786221 GCTGTGGCCGCACGCCCTGCTGG + Intergenic
1187507252 X:19887727-19887749 GCTCCTGCAGCTCCGCCTGCCGG + Intergenic
1188225450 X:27592140-27592162 GCTGCTGCCTGGCCCCGTCCAGG + Intronic
1190248093 X:48704034-48704056 GCTGCTGCTCTGCCCCCTCCTGG - Intronic
1190297726 X:49038385-49038407 GCTGCCGGCGCGCCTGCTGCAGG + Exonic
1190979527 X:55443647-55443669 GCAGTTGCCCCTCCCCCTGCTGG - Intergenic
1191226955 X:58054059-58054081 GCTGCTGCCCCACCCCCACCTGG + Intergenic
1192759865 X:74085933-74085955 GCTGCTGCTGCTTCCACTGCTGG + Intergenic
1196214623 X:113035928-113035950 GCTGCTGCTGCCGCCACTGCTGG + Intergenic
1198031920 X:132761425-132761447 GGTGCTGGCTCGCCCCCTGCTGG - Intronic
1198312630 X:135436649-135436671 GCTCCTGCCGCGTCGCCTCCAGG - Intergenic
1198707612 X:139465684-139465706 GCTGCTGCTGCTTCTCCTGCTGG - Intergenic
1199236869 X:145502789-145502811 GCTGCTGCCGTTCCCACTACTGG - Intergenic
1200068831 X:153517964-153517986 CCTGCCGCCGCACCACCTGCCGG - Intronic
1200161880 X:154013789-154013811 GCTGCTGCCGCGCCCCCTGCTGG - Intronic