ID: 1200162906

View in Genome Browser
Species Human (GRCh38)
Location X:154018464-154018486
Sequence TAGGGTCCCTGGCCCCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200162906_1200162909 -10 Left 1200162906 X:154018464-154018486 CCACCAAGGGGCCAGGGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1200162909 X:154018477-154018499 AGGGACCCTACGCCAGAATGAGG 0: 1
1: 0
2: 0
3: 2
4: 63
1200162906_1200162917 10 Left 1200162906 X:154018464-154018486 CCACCAAGGGGCCAGGGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1200162917 X:154018497-154018519 AGGGCTGAAGGAGTTGTGTGGGG 0: 1
1: 0
2: 1
3: 32
4: 295
1200162906_1200162919 19 Left 1200162906 X:154018464-154018486 CCACCAAGGGGCCAGGGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1200162919 X:154018506-154018528 GGAGTTGTGTGGGGAAGCGAGGG 0: 1
1: 0
2: 1
3: 21
4: 281
1200162906_1200162916 9 Left 1200162906 X:154018464-154018486 CCACCAAGGGGCCAGGGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1200162916 X:154018496-154018518 GAGGGCTGAAGGAGTTGTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 245
1200162906_1200162918 18 Left 1200162906 X:154018464-154018486 CCACCAAGGGGCCAGGGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1200162918 X:154018505-154018527 AGGAGTTGTGTGGGGAAGCGAGG 0: 1
1: 0
2: 2
3: 21
4: 292
1200162906_1200162910 -9 Left 1200162906 X:154018464-154018486 CCACCAAGGGGCCAGGGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1200162910 X:154018478-154018500 GGGACCCTACGCCAGAATGAGGG 0: 1
1: 0
2: 1
3: 5
4: 58
1200162906_1200162922 26 Left 1200162906 X:154018464-154018486 CCACCAAGGGGCCAGGGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1200162922 X:154018513-154018535 TGTGGGGAAGCGAGGGGGAAAGG 0: 1
1: 0
2: 2
3: 75
4: 851
1200162906_1200162913 -2 Left 1200162906 X:154018464-154018486 CCACCAAGGGGCCAGGGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1200162913 X:154018485-154018507 TACGCCAGAATGAGGGCTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 77
1200162906_1200162920 20 Left 1200162906 X:154018464-154018486 CCACCAAGGGGCCAGGGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1200162920 X:154018507-154018529 GAGTTGTGTGGGGAAGCGAGGGG 0: 1
1: 0
2: 2
3: 25
4: 295
1200162906_1200162915 8 Left 1200162906 X:154018464-154018486 CCACCAAGGGGCCAGGGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1200162915 X:154018495-154018517 TGAGGGCTGAAGGAGTTGTGTGG 0: 1
1: 0
2: 2
3: 20
4: 317
1200162906_1200162921 21 Left 1200162906 X:154018464-154018486 CCACCAAGGGGCCAGGGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1200162921 X:154018508-154018530 AGTTGTGTGGGGAAGCGAGGGGG 0: 1
1: 0
2: 0
3: 35
4: 829
1200162906_1200162923 30 Left 1200162906 X:154018464-154018486 CCACCAAGGGGCCAGGGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1200162923 X:154018517-154018539 GGGAAGCGAGGGGGAAAGGCTGG 0: 1
1: 0
2: 7
3: 128
4: 1565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200162906 Original CRISPR TAGGGTCCCTGGCCCCTTGG TGG (reversed) Intronic
900188802 1:1344795-1344817 TGTGGGCCCTGGCCCCCTGGCGG - Intronic
902719739 1:18296005-18296027 TATGCTCCTTGGCCCCTTGGGGG + Intronic
902903076 1:19533666-19533688 GAGGGTTCCTGGACTCTTGGAGG + Intergenic
903754726 1:25652770-25652792 CAGGGTGCCTGGCCCGTAGGAGG + Intronic
905168898 1:36098669-36098691 TGGGGTCCCAGGACTCTTGGGGG - Exonic
905347914 1:37323935-37323957 TAGAGTCCCAGGCCGCTTTGGGG - Intergenic
909487016 1:76185725-76185747 CATGGTCCCTGCCCTCTTGGAGG + Intronic
909950279 1:81711804-81711826 TGGGGTCCCTGGACCCTTTCAGG - Intronic
919757749 1:201076416-201076438 CAGGGTCCCTGGCCTCCTGGAGG - Intronic
920209808 1:204320055-204320077 GTGGCTTCCTGGCCCCTTGGTGG - Intronic
922130482 1:222772286-222772308 TGGTTTCCCTGGCCCCTAGGTGG + Intergenic
1064443044 10:15370852-15370874 GAGGGTCCCGGGCCGCGTGGTGG - Intronic
1065020454 10:21497472-21497494 AGGCGTCCCTGGCGCCTTGGGGG - Intergenic
1065628601 10:27655174-27655196 CAGGCTCCCTGGCCCATTGGAGG + Intergenic
1066088327 10:31992917-31992939 TATGGTCCATGGACCTTTGGAGG + Intergenic
1066535754 10:36389690-36389712 TACCGTGCCTGGCCCCTTTGGGG - Intergenic
1067105218 10:43362031-43362053 CAGGGTCCCGGGCCCCCTGCGGG + Intergenic
1067777764 10:49175696-49175718 GGGGGGCCCTGCCCCCTTGGAGG - Intronic
1069457004 10:68561119-68561141 TTGGTTCCCTGGCCCCTTTGGGG + Intronic
1070830229 10:79413541-79413563 GCTGGTCCCTGTCCCCTTGGAGG + Intronic
1071260415 10:83914433-83914455 CAGGGTGCCTGGGCCCCTGGAGG - Intergenic
1072597367 10:96887005-96887027 TGTGGTCCCTGGGCCCCTGGTGG + Intronic
1073148963 10:101298805-101298827 TAGTCTCCCTGGCCCCTTTTGGG + Intergenic
1076179579 10:128396600-128396622 TAGGGTCGCTGTCCCCTCTGAGG - Intergenic
1077089979 11:773958-773980 TGGGGTGCCTGGGACCTTGGAGG - Intronic
1077551485 11:3202452-3202474 CAGGGTCCCTGGCGTCGTGGGGG - Intergenic
1079794910 11:24789079-24789101 TAGTGTTCATGGACCCTTGGTGG + Intronic
1081112128 11:39149284-39149306 GAGGTTCCCTGGGCCCTGGGTGG - Intergenic
1083689152 11:64396274-64396296 TCGGGTCTGAGGCCCCTTGGAGG - Intergenic
1089009245 11:115119301-115119323 AAGCGTCCCTGACACCTTGGTGG + Intergenic
1095987122 12:48005868-48005890 TGGGGTCCCAGGACCCCTGGTGG - Intergenic
1099343672 12:81471265-81471287 TATGGTCCCAGCCACCTTGGAGG - Intronic
1103526687 12:121573916-121573938 TAAGTTCCCTGCCCTCTTGGTGG - Intronic
1105696934 13:22898055-22898077 CAGGGACCCTGGCCTCTTGGGGG - Intergenic
1106225184 13:27780361-27780383 TATGGTCCCTGGGCCCTTTCTGG + Intergenic
1114614178 14:24059596-24059618 TTGTGTCCCTGGCCCCTAGTAGG + Intronic
1119750621 14:77075054-77075076 TAGGGCCCCTAACTCCTTGGTGG - Intergenic
1120273417 14:82343090-82343112 TATTGTCCGTGTCCCCTTGGTGG + Intergenic
1120709721 14:87780886-87780908 GTGGGTCCCTGACCCCTGGGTGG - Intergenic
1121177178 14:91899295-91899317 TCGGGTGCCTGGGCACTTGGAGG + Intronic
1121310669 14:92933528-92933550 TGGGGTCCCTGGCAGCTAGGCGG + Intronic
1121783778 14:96639574-96639596 CAGACTCCCTGCCCCCTTGGTGG - Intergenic
1122952044 14:105050461-105050483 GAGGGCGCCTGCCCCCTTGGAGG + Exonic
1128262339 15:66241169-66241191 TAGAGACCCTGGGCCCTGGGAGG - Intronic
1128561684 15:68672832-68672854 TGCAGTCCCTGGCCACTTGGTGG - Intronic
1128621738 15:69157063-69157085 TAGTGGTTCTGGCCCCTTGGTGG + Intergenic
1130916903 15:88312296-88312318 AAAGCTCCCTGGCCTCTTGGAGG + Intergenic
1130977669 15:88789700-88789722 TGGGGGCCCTGGACCTTTGGTGG - Intergenic
1131054438 15:89367413-89367435 TGGGCTCCCTGGGCCCTGGGAGG + Intergenic
1131309867 15:91280246-91280268 AAGGGTCACTGGCCCATTGTAGG + Intronic
1132539156 16:500205-500227 CAGGCTCCCTGGGCCCTGGGTGG + Intronic
1133484683 16:6208475-6208497 AAGAGTCCCTGCCCCTTTGGAGG + Intronic
1137558414 16:49487997-49488019 TGTGGTCCCTGGCCTCATGGAGG - Exonic
1138456742 16:57125360-57125382 CCAGGTCCCAGGCCCCTTGGTGG + Intronic
1142123856 16:88400551-88400573 TTGGGTCCCTGGCCCCAGGAAGG - Intergenic
1142141428 16:88474396-88474418 TAGGGTCCCTGGGCTGCTGGGGG - Intronic
1143402061 17:6652289-6652311 TGAGGGCCCTGGCCCCTTGGTGG - Exonic
1146560073 17:33860415-33860437 TAGGCTCTCTGGCCCCCAGGAGG - Intronic
1147039688 17:37708901-37708923 TCGAGTCCCTGGCTCCCTGGAGG - Intronic
1147844477 17:43395167-43395189 TTGGGCCCTTGGGCCCTTGGGGG - Intergenic
1149573498 17:57694739-57694761 TAGAATCCCTGGCCCCTTTTTGG + Intergenic
1151314168 17:73311688-73311710 TAGGGTCCCAGGCACCGCGGTGG + Intronic
1153140762 18:1970185-1970207 AAGGGACTCTGGCTCCTTGGAGG - Intergenic
1154434830 18:14335391-14335413 CAGGGTCCCTGGACCCTGGCTGG + Intergenic
1156149855 18:34228224-34228246 TAGTGTCACTGGCCACTTTGAGG + Intergenic
1156378438 18:36534929-36534951 TAGGGCCTCTGCCCCCATGGTGG - Intronic
1157311927 18:46559418-46559440 GAGGGTCTCTGGCCCCTGGGTGG - Intronic
1157659906 18:49431927-49431949 TGGGGCCCCTGTCCCCTTGCAGG - Intronic
1158383930 18:56967484-56967506 TAGGGTCCCTGACTCCTTAGCGG + Intronic
1161404093 19:4082087-4082109 TGGGCTCCCTGGGCTCTTGGAGG - Intergenic
1161929380 19:7326389-7326411 AATGGTCCCTGCCCTCTTGGAGG + Intergenic
1163495792 19:17645935-17645957 CTGGGTCCCTGGCCCCATGTGGG - Intronic
1163572685 19:18091506-18091528 TAGGGTCTCTTGCCACATGGAGG - Intronic
1164461873 19:28455977-28455999 TATGGTCACTGGCTCCCTGGAGG + Intergenic
1164844536 19:31420592-31420614 TAGAGATCCTGGCACCTTGGGGG + Intergenic
1165061400 19:33206886-33206908 TCGGGTCTCAGGTCCCTTGGGGG + Intronic
1165158084 19:33799973-33799995 TAGGTTCCCTGGCCCATGGAGGG + Intronic
1165335974 19:35169802-35169824 AAGGCTACCTGGCGCCTTGGGGG + Exonic
1166045991 19:40231639-40231661 TCTGGTCCCTGGTCCCTTGCTGG + Exonic
1166620105 19:44290006-44290028 CAGCTGCCCTGGCCCCTTGGGGG + Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
928204135 2:29272007-29272029 AAGGGTCCTTGGGCCCTGGGGGG + Intronic
929414864 2:41737030-41737052 GAGGCTCCCTGGCCCCAGGGAGG + Intergenic
941660860 2:168193897-168193919 GTGGGTACCTGGCCCCTTCGGGG - Intronic
943009334 2:182427540-182427562 TAGGCTCCCAGGCACTTTGGAGG - Intronic
946160054 2:217830486-217830508 AGGGCTCCCTGGGCCCTTGGTGG - Intronic
947743602 2:232496548-232496570 TAGGGGCCCAGCCCCCATGGAGG - Intergenic
1170890926 20:20374740-20374762 TAGGATCACTGGGCTCTTGGGGG - Intergenic
1172658353 20:36550123-36550145 GAGGGTTCCAGGCCTCTTGGGGG + Exonic
1172781738 20:37440416-37440438 GAGGGTCCCAGTGCCCTTGGGGG - Intergenic
1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG + Intronic
1176271409 20:64236842-64236864 TGGGGTCCCTGGCCCTGAGGAGG + Intronic
1179084657 21:38206488-38206510 GAGGATCCCTGGGACCTTGGTGG - Intronic
1179156639 21:38857107-38857129 GAGGGTCCCTCGGACCTTGGTGG + Intergenic
1179508986 21:41859755-41859777 TGGGGACCCTGGCCCCATGAGGG + Intronic
1179645199 21:42771273-42771295 CAGGCTCCCTGGCCCCTGAGAGG - Intronic
1180022288 21:45136046-45136068 TGGTGTCCCTGGGCCCATGGGGG + Intronic
1180648534 22:17359753-17359775 CAGGGTCCATGGCAGCTTGGAGG + Intergenic
1181110807 22:20601818-20601840 CAGGGTCCCTGACCACGTGGGGG - Intergenic
1181274533 22:21680193-21680215 CAGGGCCCCTGGCCACTGGGTGG + Intronic
1182429524 22:30291661-30291683 AGGAGTCCCTGCCCCCTTGGTGG + Intronic
1184571983 22:45331010-45331032 TAGGAGCCCTGGCCATTTGGTGG + Intronic
949895077 3:8762609-8762631 TGGGGGACCAGGCCCCTTGGAGG - Intronic
953058440 3:39406777-39406799 TAGCGTCCCTGGCGCCTTCCAGG + Intronic
954105080 3:48405585-48405607 TGGGGGGCCGGGCCCCTTGGTGG - Intronic
955525295 3:59813722-59813744 TTGGGTCCCTGACCTTTTGGTGG - Intronic
956729474 3:72183541-72183563 TAGGGTCCTAGGCCACTTTGAGG - Intergenic
961647555 3:128400607-128400629 TGGGGTCACTGGCCCCTTTGTGG - Intronic
962687799 3:137864146-137864168 TTGTGTCTCTTGCCCCTTGGAGG + Intergenic
963989322 3:151634902-151634924 TAAAGTCCCTGTCCTCTTGGAGG + Intergenic
968581798 4:1398750-1398772 GAGGGCCCCTGGCCCCCGGGGGG + Intergenic
968817519 4:2829586-2829608 TAGGGGACCGGGGCCCTTGGAGG - Exonic
969529070 4:7719823-7719845 AAGGGTCCCGGCCCCCTGGGCGG - Intronic
973827629 4:54724490-54724512 TAGGGTTCAAGGCCCCTGGGAGG + Intronic
980969699 4:139556784-139556806 TAGCTTCCCTGGCACTTTGGAGG - Intronic
984793209 4:183633112-183633134 CAGGGTCCCGGGGCCCGTGGTGG + Intergenic
985821540 5:2164009-2164031 TAAGGTCCCTGGACCCCGGGGGG - Intergenic
986449286 5:7850202-7850224 TTGGGGCCCAGGCGCCTTGGCGG + Intronic
986782919 5:11083844-11083866 TGGGGTGCCTGCCCCCATGGGGG - Intronic
987238483 5:15968451-15968473 TAGGGTACCTGGCACATTTGGGG + Intergenic
991298613 5:65105947-65105969 TAGGGTACATGGCCTGTTGGTGG - Intergenic
996603067 5:125289135-125289157 TAGAGTCTCTGGACCCTTTGTGG - Intergenic
1001241209 5:170071092-170071114 TAGGGTGCCTGGGCGCTGGGTGG - Intronic
1002159551 5:177307296-177307318 GAGGCTTCCTGTCCCCTTGGGGG + Exonic
1007201811 6:40115976-40115998 TAGGGGCCCTGGGCCCGTAGGGG + Intergenic
1007389271 6:41540999-41541021 CCGGGTGCCTGGGCCCTTGGAGG - Intergenic
1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG + Intronic
1007936508 6:45737377-45737399 CAGTGTCCCTGGCCCCATGGGGG + Intergenic
1012324448 6:97898074-97898096 TGGGGTTTCTGGTCCCTTGGAGG + Intergenic
1016936445 6:149451816-149451838 CAGGGTCCCTGGGCAATTGGAGG - Intronic
1017633813 6:156424091-156424113 TCAGGCCCCTGGCCCCCTGGAGG - Intergenic
1018108705 6:160513905-160513927 TAGGGTGCTTGGCTCCATGGGGG - Intergenic
1019371996 7:666843-666865 GATGGTGCCTTGCCCCTTGGAGG - Intronic
1026805045 7:73424154-73424176 CAGGTTCCCTGGCCCCTCTGTGG + Intergenic
1033097272 7:138442390-138442412 AGGGGTCCGTGGCCCCTTGCTGG + Intergenic
1033362025 7:140644604-140644626 TATGGTGCCTGGCCCATGGGAGG + Intronic
1036234529 8:7026826-7026848 TAGCGACCCTGTCCTCTTGGAGG + Intergenic
1044737383 8:95293097-95293119 ATGGGTCCCTGGGCCCCTGGAGG - Intergenic
1045166336 8:99609970-99609992 TAGGGTCTCTGGGACCTCGGGGG + Intronic
1047643591 8:126846556-126846578 TATGCTCCATGGCCCCTGGGAGG - Intergenic
1049095876 8:140547791-140547813 GAGGGTCCCTGGTCCCGAGGGGG + Intronic
1049242006 8:141542786-141542808 TGGAGGCCCTGGCCCCTTGCTGG + Intergenic
1049494254 8:142922377-142922399 GAGGGTCCCTGGGGCTTTGGCGG - Intergenic
1057383260 9:94587518-94587540 TAGGGTCCCAGGCTCTTTGCTGG - Intronic
1057726731 9:97573245-97573267 CAGGGTCCCTGGTGCCCTGGGGG - Intronic
1059063606 9:111059331-111059353 AAGAGTCCCTGGCCCCTTTGGGG + Intergenic
1060597410 9:124856655-124856677 AAGGGTCCCAGGCCACTTAGGGG + Intronic
1061540875 9:131277377-131277399 TGGGGTCCCTCGGCCCTCGGAGG + Intergenic
1061631505 9:131875039-131875061 TGGGGCGCCTGGCACCTTGGCGG - Intronic
1062055543 9:134468135-134468157 TGGAGCCCCTGGCCCCTTGAGGG + Intergenic
1062102477 9:134735671-134735693 TGCTGTCCCTGGCCCCTTGATGG + Intronic
1187958009 X:24539577-24539599 CAGGGTCCCAGGGCCCTAGGTGG - Exonic
1199875355 X:151923799-151923821 TCTGGTCCCTGGCACCCTGGAGG + Exonic
1200162906 X:154018464-154018486 TAGGGTCCCTGGCCCCTTGGTGG - Intronic
1201992547 Y:20043305-20043327 TAGTTTCCCGGGCCCCATGGGGG + Intergenic