ID: 1200163104

View in Genome Browser
Species Human (GRCh38)
Location X:154019258-154019280
Sequence GGCGGGTGCAGGGATGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 1, 2: 1, 3: 46, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200163099_1200163104 -8 Left 1200163099 X:154019243-154019265 CCAGGCCTCGGCCTCGGCGGGTG 0: 1
1: 0
2: 4
3: 22
4: 198
Right 1200163104 X:154019258-154019280 GGCGGGTGCAGGGATGCTGCTGG 0: 1
1: 1
2: 1
3: 46
4: 371
1200163095_1200163104 1 Left 1200163095 X:154019234-154019256 CCGGGGGCTCCAGGCCTCGGCCT 0: 1
1: 0
2: 3
3: 45
4: 427
Right 1200163104 X:154019258-154019280 GGCGGGTGCAGGGATGCTGCTGG 0: 1
1: 1
2: 1
3: 46
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200163104 Original CRISPR GGCGGGTGCAGGGATGCTGC TGG Exonic
900087402 1:904995-905017 GGGGGGTGCGGGAAGGCTGCGGG + Intergenic
900184428 1:1326295-1326317 CGGGGGTGGGGGGATGCTGCCGG - Intronic
900680619 1:3914405-3914427 GGTCTGTGCGGGGATGCTGCAGG + Intergenic
901763066 1:11483068-11483090 GCCGGAGGCATGGATGCTGCGGG + Intronic
902776087 1:18675937-18675959 TCCTGGTGCAGGGATGCTGGTGG - Intronic
903370337 1:22831196-22831218 GGCGGCTGCAGGGATGGTGATGG + Intronic
903780306 1:25816330-25816352 GGCGTGGTCAGGGAAGCTGCAGG - Exonic
904263403 1:29304064-29304086 GGCCTCTGCAGGGATCCTGCTGG - Intronic
904291356 1:29488152-29488174 GGCTTGTGCAGGGGTCCTGCTGG + Intergenic
905016164 1:34780393-34780415 GTCGGGTGCAAAGATGCCGCTGG + Intronic
905366057 1:37452185-37452207 GGCGGGTGCCCGGAAGGTGCTGG + Intergenic
906204323 1:43979144-43979166 GGCGGGTGCGGGCGTGCTGGAGG + Intronic
906297700 1:44659219-44659241 GGTGAGTGGAGGGATGCTGAGGG + Intronic
906614446 1:47225143-47225165 CGCGGGTGCAGGCATGTGGCTGG - Intronic
907272614 1:53299684-53299706 GGCCTGTGCAGGGAGTCTGCTGG + Intronic
908456363 1:64308571-64308593 GGCGGGTGGGGGGCTGCTGTTGG - Intergenic
910163971 1:84303414-84303436 GGGGGGAGAAGGGAGGCTGCTGG - Intronic
910553140 1:88499057-88499079 GGCGTGTGCAGGCATGGTGGCGG - Intergenic
915360310 1:155282588-155282610 GGAGGGTGCTGAGATCCTGCTGG + Exonic
916890479 1:169107854-169107876 GGAGGGGGCAGTGATGCAGCAGG - Intronic
918296781 1:183164599-183164621 GGCGGGTGCAAGGAACCTGCTGG + Intergenic
919615818 1:199807264-199807286 GGTTGGTGCAGTCATGCTGCTGG - Intergenic
920574966 1:207052707-207052729 GGTGGGTCCAGGGAAGCTTCTGG + Intronic
920841893 1:209562154-209562176 AGGGGGTGCAGGGAAGCTGGTGG + Intergenic
921065925 1:211621855-211621877 GGTGGGTGAAGGGAGGCTCCAGG - Intergenic
921167009 1:212514785-212514807 GGCGGGGGCTGGGAGGCTGCGGG - Intergenic
922099705 1:222470595-222470617 GGTGGGTGCAGGGCCGCTGGGGG + Intergenic
922445442 1:225693045-225693067 GGCAGGTGCAGGGGTGCTGGTGG - Intergenic
922796010 1:228340249-228340271 GGGGGGTGCAGGGAGGCTGTGGG - Intronic
922822815 1:228495555-228495577 GGCAGGGGCAGGGATGCTCAGGG - Exonic
1062844151 10:691073-691095 GCCGGGAGCAGAGGTGCTGCGGG - Intergenic
1063169112 10:3490447-3490469 GGTGGGTGCTAGAATGCTGCAGG + Intergenic
1063410162 10:5831250-5831272 TGCTGGGGCAGGGAAGCTGCTGG + Intronic
1065830217 10:29608428-29608450 GTAGGGTGCAGGGCTCCTGCTGG - Intronic
1067038110 10:42933851-42933873 GCGGGGTGCAGGGAAGCCGCAGG - Intergenic
1069292843 10:66804362-66804384 CGCGGATGTAGGGATGATGCTGG - Intronic
1069572168 10:69500886-69500908 CCCTGGTGCAGGGATGCTGTGGG - Intronic
1070369698 10:75770713-75770735 GGTGGGTGAAGTGAGGCTGCTGG + Intronic
1070678955 10:78435377-78435399 GGTGGGTGGAGGGCTGCTTCTGG - Intergenic
1073054312 10:100689261-100689283 GGGGGGCACAGGGATGCTGAAGG + Intergenic
1073075933 10:100825964-100825986 GGTGGGGGCAGGGAGTCTGCAGG + Intronic
1073326177 10:102644983-102645005 GGGCGGTGGAGGGCTGCTGCAGG - Exonic
1073426644 10:103459145-103459167 GGAGAGTCCAGGGCTGCTGCAGG + Intergenic
1074043989 10:109819992-109820014 GGAGGGTGGAGAGAAGCTGCAGG - Intergenic
1075647500 10:124106168-124106190 GGTGGGTGGACGGATGCTACGGG - Intergenic
1076721360 10:132394776-132394798 TGCGGGGGCAGGGCTGCTGGGGG + Intergenic
1076830586 10:132992379-132992401 GGTGGGTGCAGGGGTGCTGGTGG + Intergenic
1077478238 11:2801047-2801069 GGTGGGTGCAGGGCTGGGGCAGG + Intronic
1077740484 11:4840211-4840233 GGTGGGTCCAGAGATGCTGTCGG - Intronic
1078182105 11:9020540-9020562 GGTGGGTGGAGGGAGCCTGCAGG + Intronic
1078370458 11:10740536-10740558 GGAGGCTGGAGGGATGTTGCAGG + Intergenic
1079451312 11:20601737-20601759 GGCGGGTGCACGTATGCTGATGG + Intronic
1081990032 11:47332763-47332785 GGCTGGGGCAGGGAGGCTGTGGG - Intronic
1083184242 11:61008196-61008218 GGCGGGGACAGGGAAGCGGCGGG - Intronic
1083757016 11:64797177-64797199 GGTGGGGGCAGGGTTCCTGCAGG + Exonic
1084052703 11:66610945-66610967 GGTGGGGGCGGGGATGCTGCTGG + Intergenic
1084378990 11:68798654-68798676 GGTGGATGCAGGGATGGTGTGGG - Intronic
1084400370 11:68939732-68939754 GGGGCGTGCAAGGATGCGGCCGG - Exonic
1084547041 11:69819656-69819678 GGCGGCGGCAGGGAGGCTCCGGG + Intergenic
1084892533 11:72243730-72243752 AGCGGGCCCAGGGATTCTGCAGG + Intronic
1085516123 11:77112906-77112928 GGCTGGTGCAGGCACGCAGCAGG + Intronic
1088058220 11:105610529-105610551 GGCTGGTGCAGGCTTGCTGGGGG + Intronic
1088166933 11:106950330-106950352 GGCTGCTGCTGGGCTGCTGCTGG - Intronic
1088884957 11:113999067-113999089 GGTGGGTGGAGGGGCGCTGCTGG + Intergenic
1089085798 11:115815827-115815849 GGTGTGTGCAGGGAGGATGCTGG - Intergenic
1089591612 11:119545870-119545892 GGCTGCTGCAGGGAGGGTGCTGG + Intergenic
1089734066 11:120537626-120537648 GGCGGGTGCAGAGCATCTGCAGG - Intronic
1089754040 11:120673400-120673422 GGACTGTGCAGTGATGCTGCTGG + Intronic
1091192960 11:133709362-133709384 GGCGAGGGCAGGCATGCTGAGGG - Intergenic
1091759604 12:3077869-3077891 CGCGGGTGCCGGGGGGCTGCAGG - Intronic
1092002319 12:5043220-5043242 AGCGGGTGGAGGGGTTCTGCTGG + Intergenic
1094199120 12:27779790-27779812 GGGGGCTGCAGTGATGCTCCGGG - Intergenic
1094473341 12:30823189-30823211 CGCGAGTGCAGGGAAGCTGCGGG - Intergenic
1095812670 12:46387095-46387117 GGGAGGGGCAGGCATGCTGCGGG - Intergenic
1096583663 12:52604854-52604876 GGCCAGTGCAGGGATGATGCTGG - Intergenic
1096847909 12:54418231-54418253 GGCGGGTGCTGGGATGTGTCGGG - Intronic
1100539876 12:95548275-95548297 GGAGGGTGGAGGGATGCGGCTGG + Intronic
1102043847 12:109817444-109817466 GGAGGGTGCAGGCATGGTGGGGG - Intronic
1102278101 12:111598552-111598574 GGAGGGGGCGGGGATGCTGCGGG + Intronic
1102643293 12:114385392-114385414 GGGAGGTGCTGGGTTGCTGCTGG + Intronic
1103524884 12:121561024-121561046 GGCGGAGGGAGGGAGGCTGCTGG - Intronic
1103558724 12:121781021-121781043 GGCGGGATCAGGGGTGCGGCCGG + Exonic
1104155364 12:126126146-126126168 GGTGGGTGCACAGATGATGCTGG + Intergenic
1104270352 12:127277898-127277920 GGTGGCTGCAGGGAGGATGCGGG + Intergenic
1104607612 12:130201394-130201416 CAAGGGTTCAGGGATGCTGCTGG + Intergenic
1104770897 12:131363679-131363701 GGCGGGTGGAGGAAGTCTGCAGG - Intergenic
1104927644 12:132321952-132321974 GGCGGGGGCTGGGGTGGTGCAGG - Intronic
1105072426 12:133242847-133242869 GGGTGCTGCAGGGCTGCTGCTGG - Intergenic
1107452059 13:40518674-40518696 GGTGGGTGAAGGGTGGCTGCTGG + Intergenic
1108048324 13:46404397-46404419 GGTGGGGGTAGGGATGCTGAAGG - Intronic
1110318268 13:74134537-74134559 GGCGGGGGCAGGGGTGGGGCGGG - Intergenic
1110450772 13:75636048-75636070 GGCGGGTGCGGGAAGGATGCGGG + Intronic
1110472394 13:75874917-75874939 GGTGGGTCCAGGGAGGCTGGGGG - Intronic
1113105977 13:106771951-106771973 GCTGGGTGCAGGGATGGTGAAGG - Intergenic
1113415493 13:110125447-110125469 GGCTGGTGCAGTTCTGCTGCAGG + Intergenic
1113569457 13:111343424-111343446 GGAGGCTGCAGGGCTGCTGTGGG + Intronic
1113629659 13:111873689-111873711 GGCGGGGGCAGAGCTGCTGTTGG + Intergenic
1114532106 14:23402789-23402811 GCCTGGTGCAGACATGCTGCTGG - Exonic
1115772519 14:36680699-36680721 AGGTGGTGCAGTGATGCTGCTGG - Exonic
1118911348 14:70064551-70064573 GGCGGCGGCGGGGATGCTGGGGG + Intronic
1119261412 14:73240131-73240153 GGCGGGTGCAGCCAAGGTGCAGG + Intronic
1119494736 14:75069249-75069271 GGCGGGAGCGGGGCTGCTGCTGG - Intronic
1119588281 14:75859278-75859300 GGAGGTTGCAGGTATGCTGCAGG + Intronic
1119658805 14:76436220-76436242 GACGGGTGCAGGGAGGCAGTTGG + Intronic
1120171064 14:81247655-81247677 GTTGGGGGCAGGGGTGCTGCAGG + Intergenic
1121021784 14:90584730-90584752 GGAGGGGTCAGGGAGGCTGCCGG - Intronic
1121412674 14:93758813-93758835 GGTGGGTTCAGGGATGATGAGGG + Intronic
1121502847 14:94452062-94452084 GCCTGGTGGAGGGATGCTGCTGG + Intronic
1121796116 14:96736704-96736726 CTCGTGTGCAGGGATGATGCGGG + Intergenic
1122142662 14:99672160-99672182 GGAGTGGGCAGGGAAGCTGCAGG + Intronic
1122421621 14:101581510-101581532 GGGGGCTGCAGGGATGTAGCAGG - Intergenic
1122438985 14:101717333-101717355 GGCGGGTGAAGGGTGGCTGGGGG - Intergenic
1122657921 14:103274190-103274212 GGCTGCTGCGGGGCTGCTGCGGG - Intergenic
1202856521 14_GL000225v1_random:54601-54623 GGTGGTAGCTGGGATGCTGCAGG - Intergenic
1125832916 15:42729158-42729180 GGCGGGGACAGGGAGGCTGGAGG - Intronic
1128697604 15:69780362-69780384 GGGGGGTGAAGGGTTGCTGGTGG - Intergenic
1129394157 15:75235218-75235240 AGTGGCTGCAGGGATGCTGGAGG + Intergenic
1129924359 15:79349701-79349723 GGCTGGAGCAGGGAGGCAGCTGG - Intronic
1131149084 15:90035726-90035748 GGCGGGTGCAGGAAGGCAGCAGG - Intronic
1132568319 16:633279-633301 GGCCGGGGCTGGGATGCTGGGGG - Exonic
1132653106 16:1030479-1030501 GGAGGGCTCAGGGCTGCTGCCGG + Intergenic
1132679270 16:1133076-1133098 GGCTGGGCCAGGGGTGCTGCTGG + Intergenic
1132711909 16:1272613-1272635 GGCTGGGTCAGGGAGGCTGCTGG - Intergenic
1133242079 16:4420790-4420812 GGGGGTTGGGGGGATGCTGCTGG - Intronic
1134202357 16:12209610-12209632 GGTGGCTGAAGGGATGCTCCTGG + Intronic
1135045884 16:19154990-19155012 GGCGGGGGCAGTGGTGCAGCTGG + Intronic
1135488462 16:22886433-22886455 GTGAAGTGCAGGGATGCTGCCGG + Intronic
1135495437 16:22947797-22947819 GTTGGGTGCAGGGCTGATGCTGG + Intergenic
1135979673 16:27138207-27138229 GGAGGATCCAGGGATGATGCTGG + Intergenic
1137677771 16:50312212-50312234 GGCGGGGGCAGGGAGGCGGACGG + Intronic
1138103107 16:54270304-54270326 GGTAGCTGCTGGGATGCTGCTGG - Intronic
1138189726 16:55004474-55004496 GGAGAGGCCAGGGATGCTGCTGG + Intergenic
1138392757 16:56682389-56682411 GGCGGGTGCAAGGACGAGGCGGG + Intronic
1138553641 16:57760164-57760186 AGTGGGGGCAGGGAAGCTGCCGG - Intronic
1138591401 16:58001249-58001271 GCGGGGTGCCGGGAGGCTGCAGG + Intronic
1138906276 16:61338930-61338952 TGCGGGAGCATGGATGCAGCTGG + Intergenic
1140223213 16:73058550-73058572 GGCGGCTGCAGCGGCGCTGCTGG + Intronic
1140252273 16:73304605-73304627 GAAGGGGGCAGGGATGCTGTGGG - Intergenic
1141900583 16:86987972-86987994 TGCGTGTGGAGGGCTGCTGCTGG + Intergenic
1142285509 16:89169978-89170000 GGCGGGGCCAGGGAAGCAGCCGG - Intergenic
1143625812 17:8109681-8109703 GGCGGGGGCGGTGAGGCTGCGGG + Intronic
1143636086 17:8164317-8164339 GGAAGGTGCAGGGAGGCTGATGG + Intergenic
1144344691 17:14339183-14339205 GGCGGGGCCAGGGTTGCTGGAGG + Intronic
1144864710 17:18327770-18327792 GGCTGGTGCAGGAGTGCAGCTGG + Intergenic
1145970957 17:28956221-28956243 GGCGGGGGCGGGGCAGCTGCAGG + Exonic
1147428207 17:40356300-40356322 GGTGGGGGCAGGGCTGGTGCGGG - Exonic
1148081087 17:44968039-44968061 CGCGGGTGTGGTGATGCTGCTGG - Exonic
1148558771 17:48594116-48594138 GGCGACTGCAGGGAGCCTGCAGG - Intronic
1148581562 17:48747482-48747504 GGCGGGAGCGGGGAGGCGGCTGG - Intergenic
1149430827 17:56594488-56594510 GGCGGGGGCGGGGGTGCAGCTGG + Exonic
1149865701 17:60149957-60149979 CGCGGGTGCAGCGATCCTGCCGG - Exonic
1151155767 17:72122275-72122297 GGCGGGAGGAGGGAGGCTACTGG + Intronic
1151158321 17:72142988-72143010 GGTGGCTGCATGGATGCTGAAGG + Intergenic
1151869029 17:76824098-76824120 GGTGGGTGGAAGGATGCTGAAGG - Intergenic
1151953190 17:77366623-77366645 GGCAGGGGCAGGGATGGTGGTGG - Intronic
1151975014 17:77479758-77479780 GGAGGGTTGAGGGATGCTGGGGG + Intronic
1152041990 17:77909543-77909565 GGCTGGAGCAGGGATTCTTCTGG + Intergenic
1152209432 17:78995260-78995282 GCCAGGTGCAGGGGTGCGGCGGG - Intronic
1152342518 17:79733195-79733217 TGCGTGTGCAGGGATCCTGGTGG - Intronic
1152352852 17:79793019-79793041 GGGGAGGGCAGGGAGGCTGCGGG + Exonic
1152360772 17:79832180-79832202 GGCGGGCGCGGGGCTGCTCCCGG - Intergenic
1152461991 17:80446350-80446372 TCCTGGAGCAGGGATGCTGCAGG - Intergenic
1152642556 17:81455229-81455251 GGTGGGTGCAGGGCAGATGCAGG - Intronic
1152714513 17:81891982-81892004 GGCGGGTGCCTGGGAGCTGCTGG + Intronic
1152744902 17:82034079-82034101 GGCAGGTGCAGGGAAGCCCCAGG + Exonic
1152786972 17:82253417-82253439 GGAGTGTGGAGGGTTGCTGCAGG - Intronic
1152800225 17:82327366-82327388 GGCGGGGGCTGGGAGGCTGGGGG + Intronic
1152809295 17:82374024-82374046 GGGGGGGGCAGGGGTCCTGCTGG + Intergenic
1153834520 18:8951949-8951971 GGGCGGTGCAGGGGTGCAGCAGG - Intergenic
1155690032 18:28608631-28608653 GGTGGGTGCAGGGATGTGGCTGG - Intergenic
1156036674 18:32772319-32772341 GGCGGGCGTGGGGGTGCTGCCGG - Intronic
1157136688 18:45063507-45063529 GGCGGGGGCAGGGGTGGTGGCGG - Exonic
1159562779 18:70013018-70013040 GGCAGGTGCAGTGATGTTTCGGG + Intronic
1160322978 18:77913923-77913945 GGCGGGTGCTGGGCGGGTGCTGG + Intergenic
1160322982 18:77913934-77913956 GGCGGGTGCTGGGTGGGTGCTGG + Intergenic
1160555048 18:79719319-79719341 GGCAGGTGCAGGGTGGCTGCGGG + Intronic
1161219870 19:3113591-3113613 GCCGGGGGCAGGGATGCGGTGGG + Intronic
1161395760 19:4044134-4044156 GGCGGCTGCAGGGAAGGTGGGGG - Intergenic
1161423828 19:4191147-4191169 GGCTGTTGCTGGGAAGCTGCAGG + Intronic
1161521006 19:4723539-4723561 GACGGGTGCATGGAGGCTCCGGG + Intronic
1161521035 19:4723621-4723643 GGCGGGTTCAGGGTCGCGGCCGG + Intronic
1161793267 19:6373256-6373278 GTCGGGCGCAGGGATGGGGCGGG + Intronic
1162496722 19:11027459-11027481 GGCTGGAACAGGGATGCTCCGGG - Intronic
1163019008 19:14472871-14472893 GGGGGGCGCAGGGATGGTGGGGG + Intronic
1163163009 19:15476593-15476615 AGCAGGGGCAGGGAGGCTGCAGG + Exonic
1164941143 19:32253011-32253033 GGCGGGGGGTGGGGTGCTGCAGG - Intergenic
1165092613 19:33394871-33394893 GGCAGGTGCAGGGGTGCTTCGGG - Intronic
1165117822 19:33539514-33539536 GGTGGGTGCAGGGGTGCTGGTGG - Intergenic
1165888956 19:39099181-39099203 GGCGCGCGCAGGGATGGTGGGGG + Intronic
1165891302 19:39113820-39113842 GAAGGGTGCTGGGAGGCTGCAGG + Intergenic
1166337535 19:42117311-42117333 TGAGGGGGCAGGGGTGCTGCTGG + Exonic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166729225 19:45049175-45049197 GGCAGGTACAGGGAAGCTACTGG - Intronic
1166811623 19:45517876-45517898 GGCGGGCGCAGGGGTGGGGCGGG - Intronic
1168316284 19:55486102-55486124 GGAGGCTGGAGGGAGGCTGCTGG - Intronic
1168322627 19:55518928-55518950 GGTTGGTGCAGGCATGCTGGTGG - Exonic
925176592 2:1788788-1788810 GGTGGCTGCAGGGCTGCTGGTGG + Intergenic
925232332 2:2244781-2244803 GGCTGGAGCAGGCAGGCTGCAGG - Intronic
926083693 2:10008232-10008254 GGCTAGGGCAGAGATGCTGCTGG - Intergenic
927089643 2:19700721-19700743 GGCAGGTGCAGGGGTGAGGCAGG - Intergenic
927210403 2:20635725-20635747 TGCGGTTGCATGGATGCTGCTGG + Intronic
927414612 2:22865832-22865854 TGGGGGTGCAGGGATGGTGCAGG + Intergenic
927557629 2:24047263-24047285 GGCGGGTGTGGGGAGGCTGTAGG - Intronic
927845095 2:26467294-26467316 GGGGGGCGCAGTGATCCTGCAGG - Intronic
928247225 2:29641035-29641057 GGCGGGGGCAGTGATGGTGAGGG + Intronic
931174847 2:59843587-59843609 GGCGGGGGCGGGGGTGCTACTGG - Intergenic
931668698 2:64627765-64627787 GGCATGTCCAGGGATGCTGGCGG + Intergenic
931695254 2:64866038-64866060 TGCAGGTGAAGGGATGATGCTGG - Intergenic
936350993 2:111712518-111712540 GGAGCGAGCAGGGATTCTGCAGG - Intergenic
937225918 2:120368584-120368606 GGAGGGTGGAGGGAGGCTGGAGG + Intergenic
937263627 2:120602016-120602038 GGAGCCTGCAGGGAGGCTGCTGG - Intergenic
937415072 2:121708009-121708031 GGCGGGAGCAGGGGTGGCGCTGG + Intergenic
938127000 2:128681658-128681680 TGGAGGTGCAGGGATGCTGAGGG + Intergenic
938135020 2:128749787-128749809 AGCGGGTGCAGGGCTCCAGCTGG - Intergenic
938246087 2:129779105-129779127 GACGCGTGCAGGGGTGCTGCTGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
943041530 2:182811054-182811076 GGAGGGGGCATGGATGCTGGTGG - Intergenic
943955682 2:194186413-194186435 GGCGGGTGCATGGATGGAACTGG - Intergenic
944906201 2:204264506-204264528 GGCGGGAGCAGAGCTGCAGCCGG - Intergenic
945599689 2:211845149-211845171 GTCGGGAGCTGGCATGCTGCAGG - Intronic
948207097 2:236168138-236168160 GGCGGGTGCAGGGGGTGTGCGGG + Exonic
948262597 2:236615167-236615189 GGCAGCTGCAGGGAAGCAGCAGG - Intergenic
948756494 2:240162580-240162602 GGCGGGTGGAGGGAGGCGGGCGG + Intergenic
948995473 2:241576148-241576170 GGAGGGTGGAGGGCTGCAGCGGG - Intergenic
1168893151 20:1307319-1307341 GCTGGGAGCAGGGAGGCTGCAGG - Exonic
1169327306 20:4686540-4686562 GGCGGGGGCAGGGGAGCCGCGGG + Intronic
1170604833 20:17867961-17867983 GGGTGCTGGAGGGATGCTGCTGG - Intergenic
1171177342 20:23062437-23062459 ACCAGGTGCAGTGATGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172096458 20:32462982-32463004 GGCCCGGGCAGGGATGGTGCTGG + Intronic
1172705451 20:36879135-36879157 GGCGGATGGAGGGCTGCAGCGGG + Exonic
1173147294 20:40535674-40535696 GGCAGGTGCAGGGATCCAGCAGG + Intergenic
1174181299 20:48676614-48676636 GGCTAGGGCAGGGGTGCTGCTGG + Intronic
1175372155 20:58499374-58499396 GGGAGGTGTGGGGATGCTGCAGG - Intronic
1175437687 20:58965787-58965809 AGGTGGTGCAGGGATGCAGCTGG + Intergenic
1175545609 20:59775926-59775948 GGAGAGGCCAGGGATGCTGCAGG - Intronic
1175783804 20:61699731-61699753 AGCGGGAGCAGGCCTGCTGCTGG + Intronic
1176119755 20:63448949-63448971 TGGGGGTGCAGGGATGCTCATGG + Intronic
1176348966 21:5774711-5774733 GGCGGGTGCAGACATGTTGAGGG - Intergenic
1176355780 21:5895295-5895317 GGCGGGTGCAGACATGTTGAGGG - Intergenic
1176386786 21:6142005-6142027 GGCGGGTGCAGGAAGGCAGAGGG - Intergenic
1176543287 21:8172781-8172803 GGCGGGTGCAGACATGTTGAGGG - Intergenic
1176562238 21:8355826-8355848 GGCGGGTGCAGACATGTTGAGGG - Intergenic
1176841627 21:13847533-13847555 TGAGGGTGCAGGGCTGCTCCAGG + Intergenic
1177348127 21:19900109-19900131 GGAGGGTGCAGGGAGGCCGGCGG - Intergenic
1177833808 21:26169630-26169652 GGAGGGGGCAGAGACGCTGCCGG - Intronic
1178303376 21:31470903-31470925 GGCGGCTGGAGGGGTGGTGCTGG - Intronic
1178610208 21:34073414-34073436 GGCGGGTGCGGGGCTGCGGAGGG + Intronic
1178662948 21:34522139-34522161 GGGAGGTGCAGAGCTGCTGCTGG - Intronic
1178778543 21:35576286-35576308 GGCGCCTGCACGGATACTGCTGG + Intronic
1179597459 21:42452402-42452424 GGGAGGGCCAGGGATGCTGCTGG - Intergenic
1179736687 21:43396247-43396269 GGCGGGTGCAGGAAGGCAGAGGG + Intergenic
1179783648 21:43718273-43718295 GGGTGGTGCAGGGAAGCCGCAGG + Intergenic
1179786272 21:43731963-43731985 GGCGGGTGCTGGGAGTCTGTGGG + Intronic
1179908073 21:44434410-44434432 GACGGTGGCAGGGATGCTGTCGG + Intronic
1180090804 21:45533095-45533117 GGAGGGTGCAGGGCGGCTACAGG - Intronic
1180616532 22:17131913-17131935 GGCAGGTGCAGGGAGCCTGCTGG - Exonic
1181022439 22:20110547-20110569 GGCGCCTGCAGGGCTGCTACAGG + Exonic
1181306812 22:21921676-21921698 GGAGGCAGCAGGGATGCTGCTGG - Exonic
1181441162 22:22935829-22935851 GGCAGTTTCAGGGCTGCTGCTGG + Intergenic
1182083017 22:27542693-27542715 GGCGGCTGCTGGGATGCAGTGGG - Intergenic
1182487202 22:30646674-30646696 GGCGGGTGCAGCCCTGGTGCTGG + Exonic
1183020040 22:35019485-35019507 GGTGGGGGCGGGGATGCTCCAGG + Intergenic
1183367851 22:37416760-37416782 GGTGGGGGAAGGGCTGCTGCAGG - Intronic
1183720128 22:39557762-39557784 GGCGGGGGCGCGGGTGCTGCGGG - Intergenic
1183953663 22:41366964-41366986 GGCAGATGCAGGGATGCGGTCGG - Intergenic
1184210979 22:43035439-43035461 AGGGGCTGCAGGGCTGCTGCGGG + Intergenic
1184857440 22:47154092-47154114 GGCGGGAGCAGGGGAGCTCCGGG + Intronic
1203248156 22_KI270733v1_random:89000-89022 GGCGGGTGCAGACATGTTGAGGG - Intergenic
950530229 3:13548913-13548935 GCCGGGCGCAGGGAGGGTGCGGG + Intergenic
950656400 3:14439685-14439707 GGCGGGTGCAGGGACGCCTGTGG + Intronic
951189230 3:19749417-19749439 GGCGCGGGCAGGGTTGCTGCGGG + Intergenic
951457003 3:22904102-22904124 GACGGGTGCAGAGTTGCTTCTGG + Intergenic
953989801 3:47475581-47475603 GGCCGGTGCAGGGACACGGCCGG + Intronic
954717453 3:52533713-52533735 GGCGGGTGCGGGGCTGCGGGCGG - Exonic
955322072 3:57981670-57981692 TGGGGGTGCAGGGTGGCTGCGGG + Intergenic
956033625 3:65066712-65066734 GGAGGGTACAGGGGTGCTGGGGG - Intergenic
958661729 3:97077520-97077542 GGCGGGGGCAGGGATAGTACTGG - Intronic
959501632 3:107113584-107113606 GGCAAGTTCAGGGATGCTGAGGG + Intergenic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
960619887 3:119627620-119627642 GGCGGGGGCAGGGGTGGTGTGGG - Intronic
960937376 3:122912239-122912261 GGAGGGTGCGGGGCTGGTGCAGG + Exonic
960973407 3:123154912-123154934 TGCATGTGCAGGGAGGCTGCAGG - Intronic
961492469 3:127265114-127265136 GGCGGGTACAGGGATGAGGCTGG + Intergenic
961667032 3:128498928-128498950 AGCGGGTGCAGGGATGTGGAGGG - Intergenic
963010940 3:140769772-140769794 GAGGAGTGCAGGGATGGTGCAGG - Intergenic
967849504 3:194071222-194071244 GGCGGGCGCGGGGCAGCTGCTGG + Intergenic
967879218 3:194287407-194287429 AGAGGTTGCAGGGAGGCTGCAGG - Intergenic
968319200 3:197750317-197750339 GGCGGGGGCAGGGGCGCTGCGGG + Intronic
968805871 4:2772084-2772106 GGAGGGAGCAGGGTTGCTGCTGG + Intergenic
968952622 4:3702679-3702701 GGCTGGACCAAGGATGCTGCCGG - Intergenic
969185763 4:5473223-5473245 GTCAGGTACAGGGATACTGCTGG + Intronic
969520896 4:7677294-7677316 GGCCGGGGCGGGGCTGCTGCAGG - Intronic
969522061 4:7684122-7684144 GGAAGGGGCAGGGATGCTGGTGG - Intronic
971954234 4:33395582-33395604 GGATGGGGCAGGGGTGCTGCAGG - Intergenic
973993640 4:56435721-56435743 GGCGGGGTCACGGATGCTGTAGG + Intronic
977508495 4:97932661-97932683 TGCGGGTGCATGGATGGAGCTGG - Intronic
981289412 4:143056773-143056795 GGGGGGTGAGGGGATGCTGGGGG + Intergenic
981315484 4:143336500-143336522 GGCGGGCGCAGGGAGGTCGCAGG - Intergenic
982075307 4:151731875-151731897 GGCGGCTGCTGGGTGGCTGCCGG - Intronic
983989151 4:174097066-174097088 GGAGGGTGCAGGTGTGCTGTGGG + Intergenic
985570735 5:643472-643494 GGCGGGTGCATGCATGCTGAGGG + Intronic
985713825 5:1445118-1445140 GGAGGGTGCAGGGCTGCCCCTGG - Intronic
986637385 5:9836473-9836495 GGCGTATGGAGGGATGCTGCTGG - Intergenic
986731460 5:10637718-10637740 GTGGGGGGCAGGGACGCTGCGGG - Intronic
987124459 5:14798443-14798465 GGGAGGGGCAGGGAGGCTGCAGG + Intronic
987174268 5:15291471-15291493 AACGGGGGCAGGGATGCTACTGG - Intergenic
988802618 5:34710716-34710738 GGGTGGTGGAGGGATGGTGCAGG - Intronic
991489022 5:67165568-67165590 AGGGGGCGGAGGGATGCTGCTGG - Exonic
992091088 5:73317579-73317601 GGGGCGTGCAGGGATGCTTGGGG - Intergenic
992098978 5:73388267-73388289 TGGGGGTGCTGGGAAGCTGCTGG - Intergenic
997210433 5:132073861-132073883 GGCGGGTGCAGAGATGCTGCAGG - Exonic
997468624 5:134104315-134104337 AGTGGGTGCAGGGGTGCTGGCGG + Intergenic
998252133 5:140560583-140560605 GGGGTGAGCAGGGATGCTGAGGG - Intronic
998490905 5:142545496-142545518 GGCTGGGGCAGGGAAGCTTCAGG + Intergenic
998903414 5:146878637-146878659 GGCGGGGGTAGGGAAGCTGGCGG + Intronic
999231623 5:150065342-150065364 GGAGGGTCCAGGGAGGCTGCTGG - Intronic
999244186 5:150144627-150144649 GGTGGGGGCAGCGATGCGGCTGG + Intronic
1000597687 5:163234718-163234740 GGGGGGTGGAGGGGGGCTGCGGG - Intergenic
1001724238 5:173883494-173883516 AGAGGTTGCAGGGAAGCTGCAGG - Intergenic
1002311872 5:178319899-178319921 GCCGGGTGCAGGGAAGCAGTGGG - Intronic
1002453021 5:179330454-179330476 GGCAGTTGCAGGGAGGCTGCTGG - Intronic
1003869402 6:10390298-10390320 GGCGGGGGCGGGGAGGCTGGCGG - Intergenic
1003928131 6:10896422-10896444 GGAGGGTGCTGGGAGGGTGCTGG + Intronic
1006173893 6:32110285-32110307 GGCTGGTGCCTGGGTGCTGCGGG + Intronic
1006461458 6:34161650-34161672 GGTGAGGGCAGGGAGGCTGCTGG + Intergenic
1006922263 6:37634744-37634766 GGGGGATGGGGGGATGCTGCTGG - Exonic
1007626796 6:43251271-43251293 GGCGGGTTCAGAGATGCAGGAGG + Intronic
1007757023 6:44106318-44106340 GTAGAGTCCAGGGATGCTGCTGG - Intergenic
1009498024 6:64374419-64374441 GGTGGGTGCAGGGGAGCTGGGGG + Intronic
1013061525 6:106638700-106638722 GGAGGCTGCAGGACTGCTGCAGG - Intronic
1013073469 6:106750310-106750332 GAGTGGTGCAGGGAGGCTGCTGG - Intergenic
1014194083 6:118532363-118532385 GGCGGGTGGAAGGATGGTGAGGG + Intronic
1017242910 6:152190704-152190726 GGAGGGTACATGGAGGCTGCAGG - Intronic
1017760176 6:157562458-157562480 GGTGGGGCCAGGGCTGCTGCTGG + Intronic
1018246953 6:161832832-161832854 GGCAGGAGCGGGGATGCTGCTGG - Intronic
1018978198 6:168581773-168581795 GGGGGCTGCAGGGAGGCAGCGGG - Intronic
1019376452 7:695187-695209 GGCAGGTGCAGGGATGGTTTTGG + Intronic
1019406892 7:888689-888711 GGCGGCAGCAGGTATGCTCCAGG - Intronic
1019413072 7:914994-915016 CCCGGCTGCAGGGAGGCTGCTGG - Intronic
1019446726 7:1075072-1075094 GGCTGCTCCTGGGATGCTGCAGG - Intronic
1019540208 7:1547928-1547950 GGCGTCCGCAGGGCTGCTGCTGG - Exonic
1019631419 7:2051760-2051782 GGCGGGCGCAGGGCAGCTGGTGG - Intronic
1024629939 7:51238698-51238720 GGTGGGGGCTGGGAGGCTGCTGG - Intronic
1024992697 7:55248696-55248718 GGCGGGTGCAGCGATGGTGATGG - Intronic
1025980614 7:66402254-66402276 GGCAGGTGCAGAGAAACTGCTGG + Intronic
1027205503 7:76094623-76094645 GGCAGGTGCAGAGAAACTGCTGG + Intergenic
1028998651 7:97129696-97129718 GGCCTGGGCAGGGGTGCTGCCGG - Intronic
1029170672 7:98627344-98627366 GGTGGGTGCAGGGCAGGTGCAGG + Exonic
1029485201 7:100836097-100836119 AGTGGGTGCTGGGATGCTGCTGG - Intronic
1029942749 7:104497600-104497622 GGTGTGTGCAGGGATTCTGTAGG - Intronic
1032169391 7:129571938-129571960 GGTGAATGCAGTGATGCTGCGGG - Intergenic
1033537418 7:142324525-142324547 GGCTGGTGCAGAGATGTTGGAGG - Intergenic
1033599176 7:142876699-142876721 GAGGGGAGCTGGGATGCTGCAGG - Intronic
1034132716 7:148735325-148735347 GGCAGGTGCAGAGCTGCAGCAGG - Intronic
1034257629 7:149733307-149733329 GGCGGCTGCAGGGAGGAGGCTGG - Exonic
1034395369 7:150820326-150820348 GGAGGGGGCAGGGTGGCTGCAGG + Intergenic
1034420604 7:150988774-150988796 GGCGGCTTCTGGGATGCTGAGGG - Intergenic
1034544481 7:151781104-151781126 GGTGGGTGCTGGGGTGCTGGGGG - Intronic
1034618471 7:152438271-152438293 GGTTTGTGCAGGGATGCTTCTGG + Intergenic
1035728310 8:1838423-1838445 GGCGGGTGCCGGGTGGCTGTGGG - Intronic
1036024391 8:4888707-4888729 GGCCGGTGCAGGGAAAGTGCAGG + Intronic
1036613086 8:10366620-10366642 TGCGGGAGCAGGGATGGTGCTGG - Intronic
1037741052 8:21609556-21609578 TGCAGGTGTAGGGATGCTGTTGG - Intergenic
1038612520 8:29069345-29069367 GGCTGGTGCAGGGAGTGTGCTGG - Exonic
1039386248 8:37138184-37138206 GGAGGGTGCAGGGGTGAGGCAGG + Intergenic
1039885113 8:41650071-41650093 GGCGGGTGCCGGGAGGTGGCTGG + Intronic
1040295353 8:46146159-46146181 GGGAGATGCAGCGATGCTGCAGG - Intergenic
1040325440 8:46339235-46339257 GGCGGGTGCAGGGACTCAGAAGG + Intergenic
1040550710 8:48435047-48435069 GACAGCTGCAGGGATGGTGCTGG + Intergenic
1040832960 8:51697670-51697692 GGATGGTGCAGGGATGCTCTAGG - Intronic
1048165793 8:132060193-132060215 GGCTGCTGCAGGGATGATGAGGG - Intronic
1049230368 8:141478579-141478601 GGCAGGTGTTGGGATGTTGCAGG + Intergenic
1049368290 8:142251436-142251458 GGGAGGTGTCGGGATGCTGCAGG - Intronic
1049432345 8:142571222-142571244 GGAAGGTGCAGGGCTCCTGCAGG + Intergenic
1049551452 8:143261803-143261825 GGCAGGTGCAGGGGTGCGGGTGG - Intronic
1049583241 8:143422040-143422062 GACGGGAGCAAGGGTGCTGCAGG + Intronic
1049662096 8:143824117-143824139 GGAGGGTGCAGGGCTGGTGCGGG + Intronic
1049670498 8:143867415-143867437 GGCGGGTGCAGGGGTCCAGGAGG + Exonic
1050829170 9:9989870-9989892 GGAGGGTGCAGGGAGCATGCAGG - Intronic
1051744523 9:20282569-20282591 TGGGGGTGCGGGGTTGCTGCTGG - Intergenic
1053180269 9:35962398-35962420 GGCGGGGGCAGGGATGGGGCGGG - Intergenic
1054342202 9:63876554-63876576 GGCCGGCGCAGGGGTTCTGCGGG + Intergenic
1055030790 9:71769625-71769647 GGCGGCGGCAGGGCTGCTTCAGG - Intronic
1055216800 9:73873285-73873307 GAGGGGTGCAGGTGTGCTGCAGG - Intergenic
1056799537 9:89681480-89681502 GGCGGGGGCAGCGGTGCGGCGGG - Intergenic
1056827035 9:89883624-89883646 GGGCGGTGGAGGGAGGCTGCAGG - Intergenic
1057147108 9:92765418-92765440 CGCGGGTGAACGGCTGCTGCTGG + Intergenic
1057178139 9:93014142-93014164 GGCTGGGGGAGGGATGCTGAGGG - Intronic
1057225432 9:93290547-93290569 GGTGGGTGCTGGGATGTTGCAGG + Intronic
1060206160 9:121684090-121684112 GGAGGGTGCAGGGAGGCTACAGG - Intronic
1060269150 9:122128721-122128743 CGCAGGAGCAGGGAGGCTGCCGG - Intergenic
1060811080 9:126611849-126611871 GGCGGGGGCGCGGCTGCTGCAGG - Intergenic
1060847603 9:126849623-126849645 GGGGGGTGGGGGGATTCTGCCGG + Intergenic
1061092529 9:128434521-128434543 GGCGGGTGCCCGCAAGCTGCTGG + Exonic
1061145956 9:128798575-128798597 GGTGGGGGCAGGGATGCAGCAGG + Intronic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1062035612 9:134381270-134381292 GCTGGGTCCAGGGATGCAGCTGG + Intronic
1062095898 9:134703195-134703217 GGCGGGTGCTTGGATCCTGCTGG + Intronic
1062243293 9:135551033-135551055 TGTGGGTGCAGGGGTGATGCTGG + Intergenic
1062462113 9:136666357-136666379 GGGGGCTGCGGGGCTGCTGCCGG + Intronic
1062533261 9:137010873-137010895 GGTGGGGGCAGGGATGGGGCAGG - Intronic
1203464558 Un_GL000220v1:72251-72273 GGCGGGTGCAGACATGTTGAGGG - Intergenic
1185445118 X:253793-253815 GGCGTGTGCGTGGACGCTGCGGG + Intergenic
1189247027 X:39571277-39571299 AGAGTGTGCAGGGATGCTGTAGG - Intergenic
1189732913 X:44040253-44040275 GGCAGGTGGAGAGAAGCTGCTGG + Intergenic
1192737670 X:73864112-73864134 GGCAGGTGCTGGGATGATCCTGG - Intergenic
1194764867 X:97838089-97838111 GGGGGGTGCAGGGTTGTTCCAGG - Intergenic
1195741872 X:108072949-108072971 GGCGGGTGGAGGGGGGCGGCTGG + Intronic
1198675096 X:139122984-139123006 TGTGGGTGCAGGGTTGCTACAGG - Intronic
1199992061 X:152992998-152993020 GGTGGGGGCAGGGGGGCTGCTGG + Intronic
1200137822 X:153883507-153883529 TGCAGGGGCAGGGATGCTGCAGG + Intronic
1200163104 X:154019258-154019280 GGCGGGTGCAGGGATGCTGCTGG + Exonic
1200228299 X:154431493-154431515 GGAGGGAACAGGGAAGCTGCGGG - Intronic
1201176064 Y:11308686-11308708 GGTGGCAGCTGGGATGCTGCAGG - Intergenic
1201575298 Y:15456068-15456090 GGTGGGTGAAGGGCTGCGGCTGG + Intergenic