ID: 1200168842

View in Genome Browser
Species Human (GRCh38)
Location X:154057314-154057336
Sequence GCAGTGGGTACAATTATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200168842_1200168848 1 Left 1200168842 X:154057314-154057336 CCTGAGATAATTGTACCCACTGC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1200168848 X:154057338-154057360 CAGTCACAGGCATTAAGCCTAGG 0: 1
1: 0
2: 3
3: 5
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200168842 Original CRISPR GCAGTGGGTACAATTATCTC AGG (reversed) Intronic
903603723 1:24559836-24559858 GCAGAGGGTACTATCGTCTCTGG - Intronic
909966869 1:81923844-81923866 GCAGTGGGTACTGTTGTATCAGG - Intronic
915789729 1:158655159-158655181 GGAGTGGGAAGAATTATCACTGG - Intronic
921194237 1:212738437-212738459 GCAATGGATACCATTTTCTCTGG + Exonic
1066005402 10:31142149-31142171 GCAGTGAGTACATTGAGCTCAGG - Intergenic
1066099182 10:32102507-32102529 GCAGTGGGTGAAATTGTCCCTGG - Intergenic
1071424567 10:85536033-85536055 TCAGTGGGTACCTTTAGCTCAGG - Intergenic
1072274320 10:93807733-93807755 TCAGTGGCTAAAATTATCACAGG + Intergenic
1079664503 11:23087399-23087421 TCTGTGGGTTCAATTATCCCTGG + Intergenic
1079906972 11:26260684-26260706 GCAGTGGGGACATTTATATTGGG - Intergenic
1085941485 11:81210918-81210940 CAAGTGGGTATATTTATCTCAGG - Intergenic
1091451411 12:574514-574536 GCAGTGGGTCAGGTTATCTCAGG + Intronic
1092044320 12:5418438-5418460 GCAAAGGATACAAATATCTCAGG - Intergenic
1093858162 12:24130680-24130702 GCAGTGGCTGCAGTTATCTTAGG + Intergenic
1094142040 12:27191348-27191370 GCAGTGGCAACAATCACCTCAGG - Intergenic
1113718813 13:112535783-112535805 GCAGTGAGAACAAGTATATCAGG - Intronic
1119188343 14:72660941-72660963 GAAGTGGGAAGAATCATCTCAGG + Intronic
1121559046 14:94860946-94860968 GCAGGAGATACAATTAACTCTGG + Intergenic
1123927901 15:25136200-25136222 GCAGTTGGTACTATTTTCCCTGG - Intergenic
1126451956 15:48818221-48818243 GAAGTGGGTACAATTATAAAAGG - Intergenic
1128535832 15:68489560-68489582 ACAGTGTGAACAATTGTCTCTGG - Intergenic
1134321953 16:13171760-13171782 CCAGTGGTTACCATTCTCTCAGG - Intronic
1135297808 16:21298298-21298320 GAAGTGGATGCAAGTATCTCGGG - Intronic
1137980499 16:53065184-53065206 TCAGAGGGTACAAATATCTTAGG - Intronic
1140275918 16:73508685-73508707 CCAGTGTGTACTATTCTCTCTGG - Intergenic
1142929612 17:3271509-3271531 TCAGTGGGTAAAATTTTCTCTGG - Intergenic
1143794511 17:9325929-9325951 GCAGTGGCATCAATTATCTAGGG + Intronic
1154047598 18:10921560-10921582 GCAGTTAGTGCAATTATCACAGG - Intronic
1165185999 19:34021885-34021907 GCAGTGGGTGAAATGGTCTCTGG + Intergenic
925393479 2:3515661-3515683 GGAGTAGGTACAAATATCACAGG - Intronic
929700257 2:44156549-44156571 GCAGTGGGTAAAATTTTCAGAGG + Intergenic
930343561 2:50148953-50148975 ACAGTGTGTATAATCATCTCTGG + Intronic
936507557 2:113119537-113119559 CCAGTGGGTACAATGGTCCCTGG + Intronic
936720757 2:115250273-115250295 GCAGTGGGTTCACTGATCTTGGG - Intronic
939045411 2:137244442-137244464 GCAGTGGCTAAAGTAATCTCTGG - Intronic
940516265 2:154687438-154687460 ACAGTGGATAGAACTATCTCAGG - Intergenic
940681283 2:156788302-156788324 GCAGTGGGCATAATAATTTCAGG - Intergenic
1169320503 20:4629415-4629437 GCAGTGGGTAAAATGGTCCCTGG - Intergenic
1176914209 21:14605329-14605351 GCAGTGGGTACCCTTTCCTCAGG + Intronic
1177333784 21:19697406-19697428 GCATTGGTTAGAATTAGCTCTGG + Intergenic
1182230133 22:28831634-28831656 GTGGTGGGTACAGTTGTCTCTGG + Intergenic
1182743856 22:32589481-32589503 TCAGGGGGTGCAAATATCTCAGG + Intronic
1182791142 22:32954076-32954098 GGTGTGGGTACAACTCTCTCAGG - Intronic
952288400 3:31991013-31991035 GCATTTGGAACAATTATCTCAGG - Exonic
953579903 3:44144484-44144506 GCCTTGGGTACAATGCTCTCAGG - Intergenic
955086049 3:55703915-55703937 GCACTGGGTCCAATTAGCTAAGG - Intronic
956631986 3:71325536-71325558 GCAGTGGTTAGAAGTATCTTAGG - Intronic
958535642 3:95399372-95399394 GCTGTGAGTACATTTAACTCAGG - Intergenic
973133829 4:46681225-46681247 CCTGTGGGTAGAATTGTCTCAGG - Intergenic
973838961 4:54841674-54841696 GCAGTGGGTAGCATCTTCTCAGG + Intergenic
975721129 4:77249667-77249689 TCAGAAGGTAGAATTATCTCTGG + Intronic
979023144 4:115528470-115528492 GCAGTGGGTACTCTTATCATGGG + Intergenic
992104086 5:73436314-73436336 ACAGTGGCTACATTTATCCCTGG - Intergenic
992358828 5:76014772-76014794 GGAGTGTGTATAATTATATCTGG - Intergenic
1004560452 6:16744479-16744501 GCAGTGGGTAGAAACATGTCTGG - Intronic
1007543293 6:42669958-42669980 TCACTGCATACAATTATCTCTGG + Intronic
1009041706 6:58187752-58187774 GCAGTTGCTACAATTATTTAGGG - Intergenic
1017395407 6:153993110-153993132 TTAGTGTTTACAATTATCTCTGG - Intergenic
1017758794 6:157552353-157552375 ACATTGGGCACAATAATCTCTGG + Intronic
1017996006 6:159532229-159532251 GCAGAGGGGCCAATGATCTCTGG - Intergenic
1026657940 7:72273450-72273472 GCGGTGGGGAATATTATCTCAGG + Intronic
1030141347 7:106307284-106307306 GGTGTGGGTACAATTATGTTAGG + Intergenic
1035857477 8:2991868-2991890 GCAGTGGGTACAAAAGTCACAGG + Intronic
1036384036 8:8262333-8262355 GCAGTTGCTACAATGATCCCAGG - Intergenic
1045651280 8:104343682-104343704 GCAGTGGGTAAAATGATTTCTGG + Intronic
1050150608 9:2616171-2616193 GCAGTGTGTAAAATTGTCTTTGG + Intergenic
1050765302 9:9125715-9125737 GCACTAGGTACAATTATGTGTGG + Intronic
1051879986 9:21830038-21830060 GCAGTGGGTTCAAGTATGTTTGG + Intronic
1056060680 9:82882676-82882698 GTAGTGGGTACAAATTTCACAGG - Intergenic
1188199495 X:27281728-27281750 GGCGTGGGTACAATAATCTTGGG - Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1197138863 X:123094518-123094540 GCCCTGTGTACAATTAACTCAGG + Intergenic
1200168842 X:154057314-154057336 GCAGTGGGTACAATTATCTCAGG - Intronic