ID: 1200172937

View in Genome Browser
Species Human (GRCh38)
Location X:154091729-154091751
Sequence GGTAATGCATTTTCAGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200172937 Original CRISPR GGTAATGCATTTTCAGATAT GGG (reversed) Intronic
900839461 1:5036193-5036215 GGTAGTGCAGTTTTAGATCTTGG + Intergenic
902267431 1:15277721-15277743 GAAAATGCAGTTTCAGATAGGGG + Intronic
902825885 1:18973988-18974010 CCTAATGCAGTGTCAGATATGGG + Intergenic
903056545 1:20640115-20640137 GGTGATGGATTTTCAGTTAGTGG + Intronic
907042709 1:51277753-51277775 AGTAAGGCATTTTCAGATGATGG + Intergenic
907828321 1:58039554-58039576 GGTCAAGTATTTTCAAATATAGG - Intronic
909545558 1:76842713-76842735 GATAATGCGTTTTCTGATCTGGG - Intergenic
909744890 1:79082483-79082505 GGTCATGCATTTTCAGAGGAAGG - Intergenic
909869338 1:80719404-80719426 GGGAAAACATTTTCAGACATTGG - Intergenic
911028455 1:93460024-93460046 GGTTTTGGATTTTCAGATTTGGG - Intronic
911063346 1:93766143-93766165 GGTACTGCATTTAAAGATGTTGG - Intronic
916027288 1:160844535-160844557 TGCAATGCCTTTTCAGATCTAGG - Intronic
918903505 1:190458018-190458040 TGTTATGCATTTTAACATATGGG + Intronic
918946038 1:191066514-191066536 GGTGATGCAGTTTGAGCTATTGG + Intergenic
918980234 1:191547982-191548004 GGGAATGTATTTTCAAATAAAGG - Intergenic
919491008 1:198204747-198204769 GGTATTTCATTTACAGATATTGG + Intronic
920445954 1:206017355-206017377 GATTATGGATTTTCAGATTTGGG + Intronic
921242779 1:213203316-213203338 GATTTTGCATTTTCAGATTTGGG + Intronic
921423231 1:214973122-214973144 AGGAATGCATTTTTAGGTATAGG + Intergenic
923156990 1:231287962-231287984 GGAAATGCAATTTCAGATACAGG - Intergenic
1067317704 10:45183974-45183996 GTTAATGCTTTTGCAGAGATGGG + Intergenic
1070423364 10:76260932-76260954 AGTAATCCATTTGCTGATATTGG - Intronic
1071183264 10:83011780-83011802 GGTTATACATTTTCAGAGTTGGG - Intergenic
1072390429 10:94979520-94979542 GTTATTGCATGTTCAGATTTTGG + Intronic
1072466420 10:95666683-95666705 GGGAATGATTTTTCAGCTATGGG + Intronic
1074997262 10:118768410-118768432 GGTAATGCATTCTGAGAAAGGGG + Intergenic
1075157691 10:119992000-119992022 TGTAATGCATTTAGAGAGATTGG + Intergenic
1077166508 11:1142388-1142410 GTTAAGGCATTTTCAGATGAAGG + Intergenic
1078678238 11:13447687-13447709 AGTAATGAATGTTCAGATAAAGG + Intronic
1081270217 11:41074136-41074158 AGTAATACATTTTTAGAAATTGG - Intronic
1081344566 11:41967694-41967716 GGAAATGCAACTTCAGATGTTGG - Intergenic
1081791599 11:45791475-45791497 GGACATTCATTTTCAGACATAGG - Intergenic
1082154735 11:48793746-48793768 GATATTTCCTTTTCAGATATAGG + Intergenic
1082156162 11:48817578-48817600 GGTAATTCCTTTTCAAATGTAGG - Intergenic
1082156515 11:48824659-48824681 GATAATTCCTTTTCAGCTATAGG - Intergenic
1082156785 11:48830457-48830479 GATATTTCCTTTTCAGATATAGG - Intergenic
1082316333 11:50727720-50727742 GGTACTTCCTTTTCAGCTATAGG + Intergenic
1083060863 11:59869711-59869733 ATTAATCTATTTTCAGATATAGG + Intergenic
1088312435 11:108474312-108474334 GGTAATGCTTGTTCAAATACAGG + Exonic
1088442643 11:109888775-109888797 GGTAATGCATTTGCATACAGAGG - Intergenic
1088444990 11:109916613-109916635 GGGAAGGCATTTTCAGAAAGAGG + Intergenic
1089754531 11:120676816-120676838 GGTAATGCATTTGCAGGGACTGG + Intronic
1090301275 11:125642100-125642122 GAAAAAGCATTTTCAGACATAGG - Intronic
1095064481 12:37751784-37751806 GATAATTCCTTTTCAAATATAGG - Intergenic
1095330877 12:40961959-40961981 TTTAATCCATATTCAGATATTGG + Intronic
1096760656 12:53839313-53839335 GGTCATTCATTTTCATATTTCGG + Intergenic
1098466797 12:70796566-70796588 GGTAATTCATTTTGAGATACAGG - Intronic
1099271389 12:80514823-80514845 AGTGATGCTTTTTCAGATAATGG + Intronic
1100132040 12:91507295-91507317 GTTAATTCATTTTCAGTTCTAGG - Intergenic
1100138595 12:91587166-91587188 GTTAAGGCACTTTCAGACATAGG - Intergenic
1100721744 12:97366248-97366270 GTTAATTCATTTTATGATATGGG + Intergenic
1101254390 12:102963451-102963473 GATACAGCATTTTCAGATAGTGG - Intergenic
1101668543 12:106844274-106844296 GGTAAAGCATTTTAAGAGAGAGG + Intronic
1103886174 12:124202424-124202446 GATAATTCATTATCAGATGTTGG - Intronic
1108814656 13:54275447-54275469 GGTAATTCATTAGCAGAGATAGG + Intergenic
1109796509 13:67320631-67320653 GGTAACGCATTTACAGGTTTCGG + Intergenic
1115250270 14:31338320-31338342 GTAAATGCATTTTCAAATAAAGG + Intronic
1116591049 14:46773437-46773459 TTTATTGCATTTTCAGGTATTGG - Intergenic
1119066069 14:71528171-71528193 GATGATGCAGTATCAGATATTGG + Intronic
1119941353 14:78644665-78644687 GGTAATTTATTTTTAGTTATTGG + Intronic
1124174411 15:27408838-27408860 GGTAATGCACTTTAAGACCTTGG + Intronic
1126475115 15:49057776-49057798 GGATATGCACTTTCAAATATAGG - Intergenic
1130138210 15:81199093-81199115 GGTAATACATTTTCATATATAGG + Intronic
1130242137 15:82204117-82204139 GGAAATGCATTTTAAAATCTCGG - Intronic
1130458238 15:84136704-84136726 GGAAATGCATTTTAAAATCTCGG + Intergenic
1130959702 15:88651698-88651720 GGTAATGCATTCACAGATCCTGG + Intronic
1137045163 16:35649274-35649296 TGTAAAGCATTTTCAAAGATAGG - Intergenic
1137073022 16:35923983-35924005 TGTAAAGCATTTTCACAGATAGG + Intergenic
1137499690 16:49000904-49000926 CATAATGAATTTTCAGATTTGGG - Intergenic
1139945484 16:70638563-70638585 GGGAAAGCATATGCAGATATTGG - Intronic
1151567072 17:74904580-74904602 GGGAATGCATTTTCATATGGGGG + Intergenic
1156134480 18:34020662-34020684 AATATTGCATTTTAAGATATGGG + Intronic
1156287019 18:35706689-35706711 GGTATTCCTTTTACAGATATTGG - Intronic
1156511999 18:37644878-37644900 CTTAATTCACTTTCAGATATTGG - Intergenic
1156769539 18:40702428-40702450 GGTAATACCATTTAAGATATAGG + Intergenic
1159070913 18:63623092-63623114 GGCAATGGATTCTCAGATGTAGG - Intergenic
1159236818 18:65685564-65685586 GGTAATGAAATTTCAGATAGCGG - Intergenic
1159318808 18:66818425-66818447 GGGAATGCATCATTAGATATGGG - Intergenic
1159358711 18:67371424-67371446 GTTAATTTATTTTCAGATTTGGG + Intergenic
1164354250 19:27398965-27398987 GGTATTTCCTTTTCAGCTATAGG + Intergenic
925020516 2:564412-564434 GGGAATGCATTTCCAGACAGAGG - Intergenic
926173777 2:10571019-10571041 GGTTTTGGATTTTCAGATTTGGG - Intronic
926675988 2:15620264-15620286 GATAATGCATTTTCCTACATGGG + Exonic
927085989 2:19674558-19674580 GGTACTGCATTATCAGACAATGG + Intergenic
927285245 2:21350631-21350653 TGTAATCCAGTTTCAGATATAGG + Intergenic
927412219 2:22839715-22839737 GTTTATGCATTTTAAGATATAGG + Intergenic
927633935 2:24798037-24798059 AGTTTTGGATTTTCAGATATGGG + Intronic
928120926 2:28582944-28582966 TGTAAAGCATTCACAGATATAGG + Intronic
928328985 2:30342828-30342850 GGGAATTCATTTTCAAATATTGG - Intergenic
929195667 2:39181854-39181876 TGTATTGCTTTTTCAGGTATTGG - Intronic
929433868 2:41911999-41912021 TGGAATGCATTTTTATATATGGG + Intergenic
931185966 2:59951672-59951694 GGTGATGCTTCTTAAGATATTGG - Intergenic
931185973 2:59951708-59951730 GGTGATGCTTCTTAAGATATTGG - Intergenic
931802950 2:65776646-65776668 AGCAATGCATTTTTAGTTATAGG + Intergenic
931876923 2:66523908-66523930 GGTAATGAATTTTTAGAAATAGG - Intronic
932761893 2:74443220-74443242 TGTAATGCTTTTTAAGAGATGGG - Intergenic
932918829 2:75886232-75886254 GGGAAGGCAATTTCAGTTATTGG + Intergenic
936602981 2:113918014-113918036 TGTAAAGCCTTTTCATATATTGG - Intronic
939714132 2:145561830-145561852 GGCACTGGATTTTCAGACATGGG - Intergenic
939935481 2:148287489-148287511 GGTAATGAATATTCAGGTAATGG + Intronic
939966864 2:148618875-148618897 GGTGATGGAATTTCAGAAATGGG - Intergenic
940399052 2:153225836-153225858 GGTATTGCATGTTCACAGATAGG + Intergenic
940822593 2:158373385-158373407 GGTAATGTTTTTTCAGCAATAGG + Intronic
941644477 2:168025231-168025253 GATAATGAATTTTCAGCTCTGGG - Intronic
942794401 2:179800123-179800145 GGAGATGAATTTTCAGAAATGGG - Intronic
943579576 2:189669658-189669680 TGTATTGCATTTTGAGATGTGGG + Intronic
945988549 2:216373622-216373644 GGTAATGCCTTTACAAATATTGG + Intergenic
1171542342 20:25972411-25972433 GGCAAAGCATTTTCACAGATAGG + Intergenic
1175992371 20:62796174-62796196 GGAAGTTCATTATCAGATATAGG + Intergenic
1178768863 21:35483456-35483478 GGTAATGCATTTCCTGGAATAGG + Intronic
949866032 3:8548469-8548491 GAGAATGCATTTTCAGTTTTAGG + Intronic
951226350 3:20125684-20125706 GGTAAAGCATTTTGAGAAATTGG - Intronic
953332475 3:42065486-42065508 GGTTTTGAATTTTCAGATTTGGG + Intronic
953344333 3:42162504-42162526 GATAATGCATTTTCTAATAGGGG + Intronic
955079544 3:55645817-55645839 GATAATGAATTTTCGGATAAGGG + Intronic
955259739 3:57375164-57375186 GGAAATGCATTTTAAAAGATGGG + Intronic
955884946 3:63587967-63587989 CATAATCCATTTTCAAATATAGG + Intronic
957335527 3:78823207-78823229 GCCAATGCATTTTCAGCTCTTGG + Intronic
957708637 3:83823393-83823415 GATAATGCAGGTTCAGATCTTGG + Intergenic
958579697 3:96001989-96002011 AGTAATGCATTTTCAGGTTCTGG - Intergenic
959516949 3:107278521-107278543 GTTTATGGATTTTGAGATATTGG - Intergenic
960264995 3:115611019-115611041 GGTGATGCATTTAGGGATATGGG + Intergenic
964155168 3:153576311-153576333 AGTATTGCATATTCAGATAGTGG + Intergenic
964221697 3:154354324-154354346 GATATTGCAATTTCAGATAAGGG - Intronic
964236512 3:154536388-154536410 GGTCTTATATTTTCAGATATTGG + Intergenic
964751401 3:160057273-160057295 GGAAATGCAATTTCAGATACAGG - Intergenic
966300814 3:178477725-178477747 GTTAATGCATTTTGATATAAGGG + Intronic
966702241 3:182867444-182867466 GGTAATTTTTTTTCATATATTGG + Exonic
966758666 3:183395147-183395169 CATGATACATTTTCAGATATAGG - Intronic
967077012 3:186012545-186012567 GGTAAAAAATTTTCAAATATTGG - Intergenic
968026342 3:195445700-195445722 GGTAATTTATTTTCATATGTTGG - Intergenic
970937323 4:21588533-21588555 GGTAATTCATTTCCTGATGTAGG - Intronic
971167246 4:24196797-24196819 GGGCAGGCAGTTTCAGATATAGG - Intergenic
971465493 4:26954556-26954578 GTGTATGCATTTTCAGTTATTGG + Intronic
971932508 4:33103266-33103288 GGTAATGCATTTTCATGGACTGG - Intergenic
971993440 4:33932002-33932024 GGCAAGGCATTTTAAGAAATAGG - Intergenic
974335026 4:60531530-60531552 GGCAATACATATTCAAATATGGG - Intergenic
974504775 4:62755102-62755124 GGGACTGCATTCTCAGTTATAGG - Intergenic
975272040 4:72447203-72447225 CATAAGGGATTTTCAGATATTGG - Intronic
975556106 4:75666788-75666810 GGTAATCCATTTCTAGATCTGGG + Intronic
978648091 4:110965927-110965949 GGTAATGGCTTTTCAGAGATTGG + Intergenic
979871713 4:125831603-125831625 GTTAATGAATTTACAAATATAGG - Intergenic
980462159 4:133128263-133128285 GGTAAGACATTTTATGATATTGG + Intergenic
982494233 4:156070349-156070371 TCTAATCCATTTTCAGATACAGG - Intergenic
983259910 4:165444315-165444337 GGTACTGCATTTTCTTAAATTGG + Intronic
984537929 4:181000383-181000405 GGTAATGGATTCTGAGACATGGG - Intergenic
986499900 5:8387772-8387794 GATTATGCATTTTCAGATCCTGG - Intergenic
986883863 5:12210284-12210306 TGTAATGCATTTTGAGAACTGGG + Intergenic
989946442 5:50237077-50237099 GGTATTTCCTTTTCAGCTATAGG + Intergenic
993041518 5:82820073-82820095 GATAATCCATTTCCAGTTATTGG + Intergenic
993921190 5:93805255-93805277 GCTAATGGATTTTCAAATATAGG - Intronic
994114460 5:96046558-96046580 GGGAATGAATTATCAGAAATGGG - Intergenic
994275499 5:97832265-97832287 GAAAATGCTTTCTCAGATATGGG + Intergenic
994906701 5:105848493-105848515 AATAATGCACTTTCAGATGTTGG - Intergenic
995545101 5:113222385-113222407 TGTAATACATTTTCTGATTTTGG + Intronic
995945020 5:117634610-117634632 TGTTATTCATTTTCAGATATTGG - Intergenic
996960772 5:129246535-129246557 GGTAATGTATTTACAGATTCTGG - Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999184046 5:149692138-149692160 GGGAATACATTTTGAGACATAGG + Intergenic
999237938 5:150110859-150110881 GGTAATGGATTTTTAAATACAGG + Intronic
999336394 5:150721364-150721386 GGAAATGCATCTTTATATATTGG + Intronic
999594753 5:153190529-153190551 TGCAATGCATTTTCTGTTATGGG + Intergenic
999837445 5:155389775-155389797 GGTATTGCATTTCCAGAGAGTGG - Intergenic
999846885 5:155492166-155492188 GGAAATCTATTTTCAGGTATAGG - Intergenic
1000954457 5:167526012-167526034 TGTTATGCATATTCAGAAATGGG + Intronic
1001087476 5:168711130-168711152 GGAAATGCATTTTCAGACTTTGG + Intronic
1002847390 6:959658-959680 GGCAATGAATTTTAAAATATTGG - Intergenic
1007320598 6:41026354-41026376 GGAAACGCATTTTGAGAAATTGG + Intergenic
1009256576 6:61412306-61412328 GATAATGCATTTTCTAACATAGG - Intergenic
1009355024 6:62732807-62732829 GGCACAGAATTTTCAGATATTGG - Intergenic
1010011066 6:71049089-71049111 GGTAAGACATTTTCAATTATTGG - Intergenic
1011562880 6:88640773-88640795 TGTAATACATATTCAGAAATAGG - Intronic
1012860368 6:104551845-104551867 GGTATTACATTTTGAGACATTGG - Intergenic
1014385891 6:120801811-120801833 AGTAATGCATTTGCAGTTCTTGG + Intergenic
1016870356 6:148810038-148810060 GGCAATGCATTTTAAAATGTGGG - Intronic
1017416341 6:154225145-154225167 GGTGTTGGATTTTCAGATTTGGG - Intronic
1017465448 6:154689003-154689025 GATAATGAAATTTAAGATATTGG + Intergenic
1018791168 6:167148986-167149008 AGCAATGCATCTACAGATATGGG - Intronic
1020348542 7:7192209-7192231 GGTAATGATTTTTGAGATTTGGG + Intronic
1022296076 7:29055067-29055089 GCCAAGGCACTTTCAGATATAGG - Intronic
1024097182 7:45991600-45991622 AGTGATTCATTTCCAGATATAGG + Intergenic
1024879073 7:54065067-54065089 GTTAGTGCAATTGCAGATATAGG - Intergenic
1025082897 7:55999566-55999588 GTTAAAACATTTTCAGTTATTGG - Exonic
1025500353 7:61283690-61283712 GATATTTCATTTTCAGCTATAGG - Intergenic
1025500912 7:61295361-61295383 GATATTTCATTTTCAGCTATAGG - Intergenic
1025515773 7:61641584-61641606 GATATTTCATTTTCAGCTATAGG - Intergenic
1025540109 7:62070410-62070432 GATATTTCATTTTCAGCTATAGG - Intergenic
1027401128 7:77808868-77808890 AGTGAAACATTTTCAGATATTGG - Intronic
1030819023 7:114074055-114074077 GGTAATTTATTTTTAGATAAAGG - Intronic
1031561568 7:123244940-123244962 GGTAATGCATTATTAGAGATTGG - Intergenic
1037124479 8:15330024-15330046 CCTAATGCATTTTCAGATGTTGG - Intergenic
1039074784 8:33680256-33680278 TGTCATGCATTTTCCGAAATCGG + Intergenic
1042166816 8:65953709-65953731 GGTAATGCACTTGCAGTTCTAGG + Intergenic
1042677577 8:71339073-71339095 GGTAATGCAATTCCAGGCATGGG - Intronic
1043528350 8:81121131-81121153 GGAAATGCATTTTTAAATGTAGG - Intergenic
1046200951 8:110927021-110927043 GGAAATGCATTTGTATATATAGG + Intergenic
1048652142 8:136489926-136489948 GTTAATTCATCTTCAGTTATAGG - Intergenic
1048880476 8:138868425-138868447 GGTATTGCAGTTTCAGAGAAGGG + Intronic
1048903724 8:139066379-139066401 TCTAATGTATTTTCAGATTTTGG - Intergenic
1050494322 9:6224759-6224781 GGTGATACATTTTGATATATCGG + Intronic
1050967889 9:11831780-11831802 GGTAATGTATTTGATGATATTGG - Intergenic
1051550781 9:18326651-18326673 AGTAATGGATTTTCACACATTGG + Intergenic
1052070537 9:24076337-24076359 GCAAATGCATTTAAAGATATTGG - Intergenic
1058313090 9:103530691-103530713 GGTAAAGCAATTTAAGTTATAGG - Intergenic
1061842254 9:133365821-133365843 GGTTTTGGATTTTCAGATTTGGG - Intronic
1190441479 X:50479191-50479213 GCCAATGCATCTTCACATATTGG - Intergenic
1192328637 X:70155534-70155556 GGTTTTTCATTTTCAGATTTAGG - Intronic
1193555042 X:82943447-82943469 GTTAATGAATTTTAAGATATTGG + Intergenic
1194928060 X:99851353-99851375 GTTAATGTATTTTAAAATATCGG - Intergenic
1198945348 X:142006342-142006364 GATAATGTTTTTGCAGATATTGG - Intergenic
1199971560 X:152865580-152865602 TGTCCTGCATTTTCAGATTTTGG + Intronic
1200172937 X:154091729-154091751 GGTAATGCATTTTCAGATATGGG - Intronic