ID: 1200173524

View in Genome Browser
Species Human (GRCh38)
Location X:154096829-154096851
Sequence CAGCAGCACCCGAGGCTCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200173524_1200173527 0 Left 1200173524 X:154096829-154096851 CCGAAGAGCCTCGGGTGCTGCTG 0: 1
1: 0
2: 1
3: 17
4: 201
Right 1200173527 X:154096852-154096874 GACGCACAGTCCCCTACCCACGG 0: 1
1: 0
2: 0
3: 11
4: 106
1200173524_1200173529 10 Left 1200173524 X:154096829-154096851 CCGAAGAGCCTCGGGTGCTGCTG 0: 1
1: 0
2: 1
3: 17
4: 201
Right 1200173529 X:154096862-154096884 CCCCTACCCACGGCTCCTGATGG 0: 1
1: 1
2: 2
3: 11
4: 160
1200173524_1200173531 11 Left 1200173524 X:154096829-154096851 CCGAAGAGCCTCGGGTGCTGCTG 0: 1
1: 0
2: 1
3: 17
4: 201
Right 1200173531 X:154096863-154096885 CCCTACCCACGGCTCCTGATGGG 0: 1
1: 0
2: 1
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200173524 Original CRISPR CAGCAGCACCCGAGGCTCTT CGG (reversed) Intronic
900145774 1:1158138-1158160 CCGCAGCTCCAGAGGCTCCTGGG + Intergenic
900158628 1:1213241-1213263 CTGCAGCCCCCGAGGCTCCTGGG + Intronic
900745838 1:4360309-4360331 CAGCAGCACTGGAGAATCTTTGG - Intergenic
901348397 1:8568253-8568275 CAGCGGCCCCCCAGGCTCTCTGG + Intronic
902543161 1:17168501-17168523 CAGGAGACCCCGAGGCTCCTGGG + Intergenic
904034550 1:27551782-27551804 CAGCAGCTCCCGACGCTGCTGGG - Exonic
904282911 1:29433712-29433734 CAGCCTCACCCCAGTCTCTTGGG + Intergenic
906002001 1:42434596-42434618 CAGCAGCATCAGATTCTCTTAGG + Intronic
906202841 1:43971139-43971161 CAGCAGCACCACAGGCGCTTTGG - Exonic
907000459 1:50847834-50847856 CAACAGCACCCAAGGCTGTAAGG + Intronic
907300847 1:53485543-53485565 CAGCAGCCTCCAAGGTTCTTTGG + Intergenic
908027955 1:59971149-59971171 CAGCTGCCCCATAGGCTCTTGGG - Intergenic
908746954 1:67385081-67385103 CAGCAGCACCCCACTCTCTATGG + Intronic
911862726 1:102974072-102974094 CAGCAGCATCCACAGCTCTTGGG - Intronic
917228983 1:172815189-172815211 CAGCAGCACCCCACTCTCTGTGG + Intergenic
919888491 1:201952664-201952686 CATCAGCACCCCTGGCTCTCAGG + Intergenic
922316487 1:224447271-224447293 CAGCAGCCCCCTAGGTTCTTGGG - Intronic
923130221 1:231068512-231068534 CAGAAGCCCCCGATGCTCTCAGG + Intergenic
924150296 1:241123182-241123204 CAGCAACACCCTTGGCTCTGAGG + Intronic
1068476641 10:57535473-57535495 CAGCAGCTCCCCAGGTTCTCGGG + Intergenic
1069339767 10:67397066-67397088 CAGCAGCACCCCACTCTCTGTGG - Intronic
1070960804 10:80498998-80499020 CAGCAGCAGGCGATGCTCTCAGG - Intronic
1072786589 10:98287341-98287363 CAGCAGCCCCCAAGCTTCTTAGG - Intergenic
1074324240 10:112432414-112432436 CAGCTGTATTCGAGGCTCTTCGG + Exonic
1075006373 10:118833285-118833307 CAGCACCAAACTAGGCTCTTTGG + Intergenic
1076114072 10:127883095-127883117 CAGCAACACCCCAGGCTCACAGG + Intronic
1076128847 10:127997360-127997382 CAGCAGCAGCAGAGGGACTTGGG - Intronic
1076610416 10:131722704-131722726 CATCAGCACCCGAGGCTCTGCGG - Intergenic
1076871942 10:133198727-133198749 GAGCAGCCCCAGAGCCTCTTGGG + Exonic
1077104913 11:837975-837997 CAGGAGCACCTGAGGGTCATTGG + Exonic
1078341942 11:10503464-10503486 CAGAAGCACCAGAGTCTTTTAGG + Intronic
1084147695 11:67273793-67273815 AAGCAGGACCCGGGGCTCTGAGG - Intronic
1084782379 11:71418743-71418765 CTGCAGCTCCCGGGGCTCCTGGG - Intergenic
1086403352 11:86479204-86479226 CATCAGAACTCCAGGCTCTTTGG + Intronic
1088695452 11:112362356-112362378 CAGCGAGCCCCGAGGCTCTTCGG + Intergenic
1091222209 11:133936241-133936263 CAGCAGCACCCAGGCCTCCTGGG + Intronic
1091787872 12:3253854-3253876 CAGCAGCACCTGTGGATGTTTGG + Intronic
1091837747 12:3597646-3597668 CAGCAGCGGCCCAGGCTCCTGGG + Intergenic
1093160336 12:15739624-15739646 CTGCAGCTCCTCAGGCTCTTGGG + Intronic
1094589743 12:31809159-31809181 CAGCAGCACCCACAGCTCCTGGG - Intergenic
1096536284 12:52277185-52277207 CAGAAGCATCCAATGCTCTTTGG - Intronic
1100375138 12:94008100-94008122 TAGCAGCAACCAAGGCTCTGTGG + Intergenic
1101445767 12:104735924-104735946 CAGCAGCAGTCGAGGCTCAAGGG + Intronic
1103450129 12:121022855-121022877 CAGCAGAACCAGGGGCTCTGGGG - Intronic
1104074708 12:125378817-125378839 CAGCAGCACACACTGCTCTTTGG - Intronic
1105587982 13:21762227-21762249 TAGGAGCTCCAGAGGCTCTTGGG + Intergenic
1106108179 13:26752861-26752883 CAGCAGCACCAGCATCTCTTGGG - Intergenic
1107513058 13:41104159-41104181 CATCAGAACTCCAGGCTCTTTGG - Intergenic
1108934319 13:55866995-55867017 CAGCAGGACCCAGGGCTCTTGGG - Intergenic
1109846885 13:68005170-68005192 CAGGAGCACCAGAGGTTATTGGG + Intergenic
1112568423 13:100570814-100570836 TAGCAGCACCCCAGTCTCTGTGG - Intronic
1117691671 14:58313779-58313801 CATCAGAACTCCAGGCTCTTTGG - Intronic
1118556805 14:67032590-67032612 CTGCAGCACTGGAGGCTCTGTGG - Intronic
1120624137 14:86803573-86803595 CAGCAGCCCCCTGGGCTCTCAGG + Intergenic
1122910675 14:104826447-104826469 CAGCAGGACGCCAGGCTCTGGGG - Intergenic
1122951405 14:105047140-105047162 AAGCAGCACCTCAGGCTCTCCGG - Intergenic
1124175109 15:27417194-27417216 CAGCAGCACCCACAGCTCCTGGG - Intronic
1124597411 15:31102429-31102451 CCCCAGCATCTGAGGCTCTTGGG + Intronic
1128214265 15:65923437-65923459 CAGCAGCACCAGTGGCTCCTGGG - Intronic
1128830353 15:70763124-70763146 CCGCCGCACCCGAGCCTCTACGG - Intronic
1129170234 15:73803088-73803110 CAGCAGCACTTGAGGCTGGTCGG - Intergenic
1129843149 15:78756074-78756096 AGGCAGCACCCGAGGCTATCTGG - Intergenic
1130029238 15:80296577-80296599 CAGCAGCCCTCTAGGCTCTCAGG - Intergenic
1131742019 15:95403159-95403181 CAGCAGCTCCCCAGGGTCTTAGG + Intergenic
1132996330 16:2825427-2825449 CCTCAGCACCTGAGGCTGTTGGG - Intronic
1133259185 16:4537723-4537745 CAGAACCACCTGGGGCTCTTGGG - Intronic
1134220683 16:12351423-12351445 CAATAGCAACTGAGGCTCTTTGG - Intronic
1137795498 16:51214158-51214180 CAGCAGCAGCCCAGGCCTTTGGG - Intergenic
1139630302 16:68227692-68227714 CAGCAGCACCAGGGTGTCTTTGG - Exonic
1141663145 16:85452561-85452583 CAGCAGCACCCCAGGCTTCCAGG - Intergenic
1142321032 16:89383148-89383170 CAGCAGCACAGGCGGCTGTTTGG - Intronic
1143935821 17:10482907-10482929 CAGCAGCACCCGACTCTCTGTGG + Intergenic
1146308593 17:31749925-31749947 CAGCAGCACACGCACCTCTTGGG + Intergenic
1147894185 17:43739907-43739929 CAGCAGCCCCCGGGGCCCCTGGG + Intergenic
1149158860 17:53666854-53666876 CAGCAGCACCCCACTCTCTGTGG - Intergenic
1149164016 17:53727876-53727898 CAGCAGCACCCCAGTCCCTGTGG + Intergenic
1150426089 17:65078252-65078274 CAGCAGAACCCAAGGCCCTAAGG + Intergenic
1151387891 17:73766460-73766482 CTCCAGCAACCGTGGCTCTTGGG - Intergenic
1151696692 17:75721584-75721606 CAGCAGCAGCCGAGGCTGGCCGG + Exonic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1159357559 18:67357562-67357584 CAGCAGCACCCCACTCTCTGTGG - Intergenic
1159640529 18:70858681-70858703 CAGCAGCACCCCACTCTCTGTGG - Intergenic
1159767786 18:72510637-72510659 CAGCAGCACCCCACTCTCTGAGG + Intergenic
1160622476 18:80180684-80180706 CAGAGGCACCACAGGCTCTTGGG + Intronic
1162259205 19:9518758-9518780 CAGCAGCACCGGGTGCTCCTTGG - Intergenic
1163237347 19:16037399-16037421 CCCCAGCACCCAGGGCTCTTCGG - Intergenic
1165920537 19:39295081-39295103 CATCAGAACTCCAGGCTCTTTGG - Intergenic
1167089550 19:47334113-47334135 CAGCGGCACCCGAGGCTGGAAGG + Intronic
1168650187 19:58087516-58087538 CAGCAGCACCCAAGGCTCAACGG + Intronic
1168656659 19:58134175-58134197 TAGCAGCATCCGTGGCTCCTAGG - Intronic
925189551 2:1871659-1871681 CAGCTGCTCCCCAGGCTCTCAGG + Intronic
925815821 2:7747789-7747811 CAACAGCACCAGAGTCTCTCTGG - Intergenic
926055404 2:9771320-9771342 CAGCAGGACCCGAGGTCCATGGG + Intergenic
926280700 2:11443432-11443454 CAGCAGCACCCCACTCTCTGTGG + Intergenic
927645094 2:24872556-24872578 CAGCAGCAGGTGAGGCTCTCGGG - Exonic
930215948 2:48697552-48697574 CAGCTCCACCTGAGGCTTTTTGG - Intronic
930438385 2:51376263-51376285 CAGCAGCACCCCACTCTCTGTGG - Intergenic
930896753 2:56455403-56455425 CAGGAGAACCCAAGGGTCTTTGG + Intergenic
932313981 2:70767676-70767698 ATGTAGCATCCGAGGCTCTTAGG - Intronic
937115549 2:119402621-119402643 CTGCAGCATCAGAGGCTCTGGGG + Intergenic
937906340 2:127054669-127054691 CAGAACCACCCGGGGCACTTGGG + Intronic
938125128 2:128665559-128665581 CAGCTGCACCTGAAGCTCTGGGG - Intergenic
942224889 2:173806432-173806454 CAGCAGCCCCAGAAGCTCCTTGG + Intergenic
946904251 2:224401151-224401173 CTGCAGCACCGAAGACTCTTTGG + Exonic
947999237 2:234554033-234554055 CAGCAGGCCCCCAGGCTCTTGGG + Intergenic
948353703 2:237360683-237360705 CATCAGTATCCGAGGGTCTTGGG - Intronic
948655079 2:239471527-239471549 CAGCAGCACTCCTGGCTCTCAGG - Intergenic
948837596 2:240633219-240633241 CAGCAGCACCCCACTCTCTGTGG - Intergenic
1168903911 20:1389236-1389258 CAGCAGCAAGCCAGGCTCTAGGG - Intronic
1170040648 20:12035957-12035979 CAGCAGCCACAGAGCCTCTTTGG - Intergenic
1170535043 20:17332566-17332588 CAGCAGCACCAGTGTCACTTGGG + Intronic
1171419866 20:25010851-25010873 CAGCAGCACCAGAGGCTTGCTGG + Intronic
1172090681 20:32429944-32429966 CAGCAGCAGCAGCGGCTCTCTGG + Exonic
1172573859 20:35991842-35991864 CAGCAGCACCAGCAGCACTTGGG + Intronic
1172705469 20:36879207-36879229 GGGCACCACCCGAGGCTCTGGGG + Intronic
1172944612 20:38677535-38677557 CAGCTGCACCCAAGTCTTTTAGG - Intergenic
1174287042 20:49481134-49481156 CAGCAGCACCAAAGACTCTCTGG + Intronic
1175762968 20:61573600-61573622 CAGGAGGCCCCGAGGCTCCTGGG - Intronic
1175764038 20:61580914-61580936 CAGCAGGACCCGAGGACCTGAGG + Intronic
1175777709 20:61663572-61663594 CAGCAGCTCCCGACTCACTTGGG - Intronic
1176111874 20:63414570-63414592 CCCCAGCACCCGCTGCTCTTGGG - Intronic
1176448443 21:6841391-6841413 CAGAAGCACCGGAGGCTTTGGGG - Intergenic
1176826613 21:13706413-13706435 CAGAAGCACCGGAGGCTTTGGGG - Intergenic
1177677798 21:24324668-24324690 CAGCAGTAGCAGAGGCTTTTAGG - Intergenic
1179188060 21:39099929-39099951 CAGCAGCACACGATTCTCATAGG + Intergenic
1179466678 21:41580544-41580566 CTGCGGCACCCAAGGCTTTTAGG - Intergenic
1179719085 21:43305339-43305361 CAGGAGCACACGATGGTCTTGGG + Intergenic
1180622198 22:17169601-17169623 CAGCAGCCCCCCAGGTTCTCAGG + Intergenic
1183004405 22:34889192-34889214 TAGCAGCACCCGACTCTCTGTGG - Intergenic
1183184754 22:36285540-36285562 CAGCTGCTCCCCAGGCGCTTAGG - Intronic
1183486278 22:38089215-38089237 CCGCAGCCCCCGAGGCCCCTGGG - Exonic
1184138160 22:42561707-42561729 CAGCATCCCCCGAGGGTCTAAGG + Intronic
952389068 3:32864513-32864535 CACCAGCTCCCTAGGCCCTTTGG - Intronic
953404664 3:42654478-42654500 CCGCCGCGCCCGAGGCTCTGGGG + Intronic
953897225 3:46811968-46811990 CTGCATCCCCTGAGGCTCTTCGG + Intronic
953919189 3:46940243-46940265 AAGCAGCATCTGAGGCTCTGTGG + Intronic
954744151 3:52777626-52777648 CAGCAGCCCCCGAGGCCCCATGG - Exonic
958582636 3:96045919-96045941 CAGCAGCACCCCACTCTCTATGG + Intergenic
958713342 3:97745780-97745802 CACCAGGACCCGAGTCTTTTAGG - Intronic
959981100 3:112518727-112518749 CAACAGCACCAATGGCTCTTGGG + Intergenic
962215118 3:133514425-133514447 CAGCAGCTCCCCAGGTTCTCAGG + Intergenic
962324844 3:134424260-134424282 CAGCAGGACCTGAGGATCTGGGG - Intergenic
963017836 3:140842540-140842562 CAGCAGCCCCCCAGTTTCTTAGG + Intergenic
963516682 3:146317511-146317533 CAGCAGCACCCCACTCTCTGTGG + Intergenic
963720705 3:148858728-148858750 CTGCAGCACCCACAGCTCTTGGG - Intronic
967392902 3:188974512-188974534 CAGCAGCACGCTAGGCCCTATGG - Intronic
968790002 4:2653042-2653064 GGACAGCACCCCAGGCTCTTAGG - Intronic
972300049 4:37776645-37776667 CATCAGCACCCCTGGCTCTAAGG + Intergenic
975411921 4:74062837-74062859 CAGTAGCACCCCAGGTTCTTAGG - Intergenic
981846357 4:149174755-149174777 CAGCAGAACCCCAGGTTGTTGGG - Intergenic
985067255 4:186134720-186134742 CTGCAGCACACGAGGCTGCTAGG - Intronic
985085586 4:186309258-186309280 CAGCAGCAGCAGAGGCGCCTGGG - Intergenic
985578191 5:683421-683443 CAGAAGCACGCGGGGCTCCTGGG - Intronic
985593118 5:775561-775583 CAGAAGCACGCGGGGCTCCTGGG - Intergenic
985594962 5:783988-784010 GAGCAGCGCCCGAGGATCTGAGG - Intergenic
986041682 5:3999917-3999939 AAGCAGTTGCCGAGGCTCTTTGG + Intergenic
986524777 5:8662351-8662373 CAGCAGCCCCCTGGGTTCTTAGG + Intergenic
986962399 5:13231021-13231043 CAGCAGTACCCCAGGTTCTTGGG - Intergenic
989638335 5:43558737-43558759 CAGCAGTACGTGTGGCTCTTCGG + Intergenic
990889441 5:60632533-60632555 CAGATGCACCCATGGCTCTTAGG - Intronic
993955271 5:94225018-94225040 CAGGAGCACCTCAGCCTCTTAGG - Intronic
997142429 5:131397053-131397075 CAGCAGCAGCGGAGGCTCTGGGG - Intronic
997372670 5:133371869-133371891 AAGCAGCAGCCGAGGCTGTTGGG - Intronic
1003233736 6:4277490-4277512 CACCAGCACTCCAGGTTCTTTGG + Intergenic
1005692940 6:28324427-28324449 CAGCAGCATCTGAGGCACCTAGG + Intergenic
1006373236 6:33658060-33658082 CAGCACCAGCCCAGCCTCTTAGG - Intronic
1007222010 6:40286250-40286272 CAGCAGCTCAGGAGTCTCTTAGG + Intergenic
1008301376 6:49844626-49844648 CAGCATCACCCATGGCTCTGTGG - Intronic
1012494447 6:99819015-99819037 CATCAGAACTCCAGGCTCTTTGG + Intergenic
1013707136 6:112849822-112849844 CACCAGGACCTGAGGATCTTGGG + Intergenic
1018495946 6:164345915-164345937 CAGCAGCACGGGCTGCTCTTTGG + Intergenic
1018814801 6:167322607-167322629 CAGCAGCAGCCGAGACCCTGGGG + Intergenic
1019032281 6:169024015-169024037 CCGCAGCACCCGAGCTTCCTCGG + Intergenic
1019570381 7:1708694-1708716 CAACAGCCCCAGAGGCTCTGGGG + Intronic
1019879360 7:3844773-3844795 CAGCAGCACGAGAGGCTCACAGG - Intronic
1020877369 7:13714650-13714672 CAGCAGCACTGGTGGCTCTGAGG - Intergenic
1021630894 7:22646583-22646605 CAGCAGCAGCAAAGGCTGTTGGG + Intergenic
1022136949 7:27457863-27457885 CAGCAGCACACGGGGTTCCTCGG - Intergenic
1023687710 7:42753439-42753461 CACCAGCAGCCCAGGCTCTTGGG - Intergenic
1024568285 7:50702376-50702398 CAGCAGCACCCATGCCGCTTTGG + Intronic
1025082452 7:55995536-55995558 CAGCACCACACAAGGCTCTGGGG - Intronic
1026903782 7:74051278-74051300 TCCCAGCACCCGAGGCTCCTTGG + Intronic
1030384926 7:108857077-108857099 CATCAGAACCCCAGGCTCTCTGG + Intergenic
1030550202 7:110948944-110948966 CAACAGAACTCCAGGCTCTTTGG + Intronic
1031608126 7:123793811-123793833 CAGCAGCACCCCACTCTCTGTGG - Intergenic
1032193084 7:129775480-129775502 CACCAGCAGCCCAGGCTCCTAGG + Intergenic
1034294213 7:149957573-149957595 CAGTGGCACCCCAGGTTCTTAGG + Intergenic
1037408199 8:18566106-18566128 GAGTAGCACCTGAGGCTCTTGGG - Intronic
1037776037 8:21836251-21836273 TAGCAGGACCAGAGGCTCTAGGG + Intergenic
1040514536 8:48124193-48124215 CAGCAGCACCTGTGGCTCTGGGG - Intergenic
1041111343 8:54485646-54485668 GAGGAGAACCCAAGGCTCTTGGG + Intergenic
1042232297 8:66570198-66570220 CAGCAGCACTCACAGCTCTTTGG - Intronic
1045642797 8:104270424-104270446 CAACAGCTCCCCAGGTTCTTAGG - Intergenic
1049400437 8:142424386-142424408 AACGAGCACCCGTGGCTCTTAGG + Intergenic
1057179180 9:93020680-93020702 CAGCAGCACAGGAGGCTCTCTGG - Intronic
1058222909 9:102325075-102325097 TAGCAGCACCCCACTCTCTTTGG - Intergenic
1060879552 9:127108492-127108514 CAGAAGCACCTCAGGCTCCTTGG + Exonic
1061930723 9:133831793-133831815 CAGGAGCTCCCCAGGCTCTGGGG + Intronic
1062013228 9:134277933-134277955 TTGCAGCTCCCAAGGCTCTTAGG + Intergenic
1062320442 9:135988187-135988209 GAGCAGCCCCTGAGGCTCTGAGG - Intergenic
1062348806 9:136128712-136128734 CAGCAGCTCCCCAGGGCCTTCGG - Intergenic
1062708229 9:137957040-137957062 CAGCAGCACCCCAAGCCCTGGGG - Intronic
1203520748 Un_GL000213v1:43127-43149 CAGAAGCACCGGAGGCTTTGGGG + Intergenic
1187275281 X:17811340-17811362 CAGCAGCACCTGAGGGTGCTTGG - Intronic
1188774060 X:34190544-34190566 CAGCAGCACCCCACTCTCTGTGG + Intergenic
1189875044 X:45427535-45427557 CAGCAGCACCAGAATCACTTGGG - Intergenic
1192334856 X:70209981-70210003 CAGCAGCACCCCACTCTCTGTGG - Intergenic
1192737338 X:73861884-73861906 CAGCAGCTCCAGGGGCTGTTTGG + Intergenic
1195341823 X:103913962-103913984 CACGAGCACATGAGGCTCTTTGG - Intergenic
1195682034 X:107554443-107554465 CAGCAGCTCCACAGGGTCTTTGG - Exonic
1195994659 X:110719797-110719819 TAGCAGCACCCAGGGGTCTTGGG + Intronic
1197004430 X:121479793-121479815 CAGCAGCACCCCACTCTCTGTGG - Intergenic
1197451978 X:126630111-126630133 CAGCAGCACCCCACTCTCTGTGG + Intergenic
1198708622 X:139477069-139477091 CAGCAGAACTTCAGGCTCTTTGG + Intergenic
1199975594 X:152893383-152893405 CAGAAGCAGCCCAGGCTCCTAGG - Intergenic
1200173524 X:154096829-154096851 CAGCAGCACCCGAGGCTCTTCGG - Intronic
1202180988 Y:22139830-22139852 CAGCAGCTCCTGAGGCTGCTTGG + Intergenic
1202182337 Y:22150368-22150390 CAGCAGCTCCTGAGGCTGCTTGG + Intergenic
1202209023 Y:22436034-22436056 CAGCAGCTCCTGAGGCTGCTTGG - Intergenic
1202210372 Y:22446570-22446592 CAGCAGCTCCTGAGGCTGCTTGG - Intergenic