ID: 1200177207

View in Genome Browser
Species Human (GRCh38)
Location X:154125533-154125555
Sequence AGGGAGGGCACGGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200177191_1200177207 30 Left 1200177191 X:154125480-154125502 CCCCGCTCCGCAGCAGCCTCGTG No data
Right 1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG No data
1200177196_1200177207 14 Left 1200177196 X:154125496-154125518 CCTCGTGGTGCAGAGAGAGAAGC No data
Right 1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG No data
1200177194_1200177207 28 Left 1200177194 X:154125482-154125504 CCGCTCCGCAGCAGCCTCGTGGT No data
Right 1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG No data
1200177192_1200177207 29 Left 1200177192 X:154125481-154125503 CCCGCTCCGCAGCAGCCTCGTGG No data
Right 1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG No data
1200177195_1200177207 23 Left 1200177195 X:154125487-154125509 CCGCAGCAGCCTCGTGGTGCAGA No data
Right 1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200177207 Original CRISPR AGGGAGGGCACGGTGACTGT GGG Intergenic
No off target data available for this crispr