ID: 1200179857

View in Genome Browser
Species Human (GRCh38)
Location X:154143712-154143734
Sequence GGCTCCTCCTCCAGTGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200179857_1200179867 3 Left 1200179857 X:154143712-154143734 CCCCCTACACTGGAGGAGGAGCC No data
Right 1200179867 X:154143738-154143760 CGGCACAAATCTCGCCCGTTTGG No data
1200179857_1200179868 4 Left 1200179857 X:154143712-154143734 CCCCCTACACTGGAGGAGGAGCC No data
Right 1200179868 X:154143739-154143761 GGCACAAATCTCGCCCGTTTGGG No data
1200179857_1200179873 21 Left 1200179857 X:154143712-154143734 CCCCCTACACTGGAGGAGGAGCC No data
Right 1200179873 X:154143756-154143778 TTTGGGCCCACGGACATGGCTGG No data
1200179857_1200179871 17 Left 1200179857 X:154143712-154143734 CCCCCTACACTGGAGGAGGAGCC No data
Right 1200179871 X:154143752-154143774 CCCGTTTGGGCCCACGGACATGG No data
1200179857_1200179869 11 Left 1200179857 X:154143712-154143734 CCCCCTACACTGGAGGAGGAGCC No data
Right 1200179869 X:154143746-154143768 ATCTCGCCCGTTTGGGCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200179857 Original CRISPR GGCTCCTCCTCCAGTGTAGG GGG (reversed) Intergenic