ID: 1200182320

View in Genome Browser
Species Human (GRCh38)
Location X:154158254-154158276
Sequence CACTGTGGATGAGTGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 4, 1: 0, 2: 0, 3: 19, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200182313_1200182320 -5 Left 1200182313 X:154158236-154158258 CCACTGCCCCTTAGCTGTCACTG 0: 4
1: 0
2: 2
3: 25
4: 387
Right 1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG 0: 4
1: 0
2: 0
3: 19
4: 148
1200182306_1200182320 30 Left 1200182306 X:154158201-154158223 CCGAGCCGCTCACCAGACAGTCT 0: 4
1: 0
2: 1
3: 4
4: 83
Right 1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG 0: 4
1: 0
2: 0
3: 19
4: 148
1200182312_1200182320 18 Left 1200182312 X:154158213-154158235 CCAGACAGTCTGGGGACAGGTCA 0: 4
1: 0
2: 1
3: 10
4: 163
Right 1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG 0: 4
1: 0
2: 0
3: 19
4: 148
1200182310_1200182320 25 Left 1200182310 X:154158206-154158228 CCGCTCACCAGACAGTCTGGGGA 0: 4
1: 0
2: 1
3: 14
4: 163
Right 1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG 0: 4
1: 0
2: 0
3: 19
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200182320 Original CRISPR CACTGTGGATGAGTGTCATG GGG Intronic
900628764 1:3622841-3622863 CAGTATGGATGAGTTTCCTGGGG - Intergenic
901246796 1:7738149-7738171 CACTGGGGCTGAGTGTCTCGGGG - Exonic
901423943 1:9169253-9169275 CACTGAAGATGAGTCTCCTGCGG - Intergenic
901830116 1:11887094-11887116 CATTCTGGATGTGCGTCATGGGG - Intergenic
902117280 1:14131979-14132001 CTCTGTGGGTGAGTGGCAGGTGG - Intergenic
903650830 1:24921130-24921152 CACTTTGGAGGCGTGTCAGGGGG - Intronic
905121426 1:35685125-35685147 GAGTGTGGATGCGTGTAATGTGG + Intergenic
905471079 1:38192377-38192399 CACAGAGGATGAGGGTCATTAGG - Intergenic
905655705 1:39684718-39684740 CATTATGGGGGAGTGTCATGAGG - Intronic
905923409 1:41733655-41733677 CACTGTGGCTGAGTGACTTAGGG + Intronic
907244112 1:53096689-53096711 CACTGTGTGTGAGTGTATTGAGG - Intronic
907244727 1:53101382-53101404 CAGTGTGTGTGAGTGTAATGGGG - Intronic
911789991 1:102002298-102002320 CACTGGAGATTAGTGTCAAGTGG + Intergenic
912623914 1:111192329-111192351 CACAGAGGATGAGAGTCAGGGGG + Intronic
916927383 1:169537062-169537084 CACTGGGTATAAGTGCCATGAGG + Intronic
921763309 1:218941434-218941456 GACAGTGAATGAGTCTCATGAGG + Intergenic
922222357 1:223618407-223618429 CACAGGGCATGCGTGTCATGGGG - Intronic
923154188 1:231262130-231262152 CAGGGTGAATGGGTGTCATGTGG - Intronic
923469393 1:234277245-234277267 CCCTGTGGATGAAGGTAATGGGG + Intronic
1065749449 10:28872260-28872282 TAGTGTGGATGAGTGTGATTAGG - Intronic
1067581378 10:47448565-47448587 CACTGTGTATGTGTATCTTGTGG + Intergenic
1068514763 10:58011913-58011935 CACTCTGAATGCATGTCATGGGG - Intergenic
1069095463 10:64254056-64254078 GACTGTGGAGGAGTGTGTTGAGG + Intergenic
1072255113 10:93613629-93613651 GACTGTGAATGAGAGGCATGGGG - Intronic
1072930294 10:99656566-99656588 GAATTTGGAGGAGTGTCATGTGG - Intergenic
1073516428 10:104079520-104079542 CAGTGTGAATGAGAGTCATGTGG - Intronic
1075149525 10:119914401-119914423 CACTGGGGCTTAGTGTCCTGGGG + Intronic
1076149100 10:128148908-128148930 CAGTGTGGTTAAGTGTCCTGGGG + Intergenic
1076427438 10:130377606-130377628 AACTGTGGATGAGCTTCCTGTGG - Intergenic
1081752412 11:45521216-45521238 CACAGTGAATAAGTCTCATGAGG - Intergenic
1083818441 11:65151259-65151281 CACTGGGCAGGAGTCTCATGAGG - Intergenic
1084224357 11:67706406-67706428 CACTGTGGATGTGGGTGATGTGG + Intergenic
1085501365 11:77028067-77028089 CATTTGGGATGAGTGTCATGAGG + Intergenic
1086872156 11:92050876-92050898 CACTGCAAATGACTGTCATGGGG - Intergenic
1089226764 11:116930716-116930738 CAGTGTGGATGATTGGGATGAGG - Intronic
1089949268 11:122510179-122510201 CACAGTGGCTGGATGTCATGAGG - Intergenic
1091349654 11:134882737-134882759 CTCTGTGGATGGGTGTCTCGGGG + Intergenic
1092835887 12:12487893-12487915 CCATTTGGATGAGGGTCATGGGG - Intronic
1094188918 12:27676939-27676961 CACCGTGGAGGAGAGGCATGCGG - Intronic
1095972265 12:47910385-47910407 CTCTGGGGAAGAGTGTCTTGTGG + Intronic
1099046453 12:77726806-77726828 CACAGTGGATGATTGTGAAGTGG + Intergenic
1099144310 12:79019933-79019955 CTCTTTGGATAAGTGTCCTGTGG - Intronic
1102670523 12:114615044-114615066 CTCTCTGGCTGAGTGTCCTGTGG - Intergenic
1104975035 12:132548483-132548505 CACTGAGGGTGACTGTGATGTGG - Intronic
1106401778 13:29438147-29438169 CACTGTGCAGGGTTGTCATGAGG - Intronic
1107031824 13:35861389-35861411 CAGGGTGGATGAGGGTCCTGGGG + Intronic
1111882164 13:93971082-93971104 CACTGAGGATCAGTTTCATGAGG + Intronic
1114718917 14:24859178-24859200 CACTGTGGAGGAATTCCATGGGG - Intronic
1114727603 14:24955329-24955351 GAATGTGGATGAGTGGCCTGTGG - Intronic
1119071729 14:71592612-71592634 CACTGTGGCTAAGTCTCAGGTGG + Intronic
1119874526 14:78046252-78046274 CACTGTTGAACAGTGTCATCAGG + Intergenic
1121350206 14:93167425-93167447 CATTTTGGATGAGTTTCAGGTGG - Intergenic
1124396078 15:29303105-29303127 CCCTGTGAAGGAGTGTCGTGTGG - Intronic
1124841928 15:33250251-33250273 GACTGTGGATAGGTGTCCTGGGG - Intergenic
1127823846 15:62685429-62685451 TACTGTGGTTGAGCTTCATGTGG + Intronic
1127910248 15:63410782-63410804 CACTGAGAGTGAGTGTCACGAGG - Intergenic
1131068017 15:89446530-89446552 CTCTATGGTAGAGTGTCATGGGG - Intergenic
1131716933 15:95121741-95121763 CACAGTGGGTGAATGTCAGGAGG + Intergenic
1133718006 16:8467784-8467806 CACAGTGGATGAATGACAAGGGG - Intergenic
1136747733 16:32606754-32606776 CAGTGTGTGTGTGTGTCATGGGG - Intergenic
1141297643 16:82784640-82784662 CACTTTGGATAAGGGTCATAGGG + Intronic
1203049868 16_KI270728v1_random:865963-865985 CAGTGTGTGTGTGTGTCATGGGG - Intergenic
1147725925 17:42566147-42566169 CACTGAGGATGTGGTTCATGGGG + Intronic
1150021179 17:61615139-61615161 CACTCTGGATAAATCTCATGGGG - Intergenic
1150779343 17:68107560-68107582 CACTGGGTATGAGTGGCAAGAGG + Intergenic
1151368689 17:73633513-73633535 CACAGTGGAAGAGTCTCATTGGG - Intronic
1152025899 17:77809089-77809111 CACCCTGTATGAGTGTCCTGTGG - Intergenic
1152033681 17:77858777-77858799 CACTGGGGGTGAGTGCCATCAGG - Intergenic
1156870339 18:41938401-41938423 CATTGTTGATGAGTGTCCTTAGG + Intergenic
1157757774 18:50233916-50233938 CACAGTGGATGATTGCCATGAGG - Intronic
1157769782 18:50335631-50335653 CACGGTGGATGACTGCCACGAGG + Intergenic
1159456535 18:68666491-68666513 CACTGGGGCTGCCTGTCATGAGG + Intergenic
1160704013 19:520989-521011 CTGTGTGGATGACTGTGATGTGG - Intergenic
1161129529 19:2579775-2579797 CTCTGTGGATGGGTGTCCTGGGG + Intronic
1161322635 19:3648449-3648471 CTCTGTGCATGGGTGTCCTGGGG + Intronic
1164435491 19:28224985-28225007 CACTCTGGCTCAGTGTCCTGGGG + Intergenic
1167116637 19:47492585-47492607 CACTGTGGATGAGGACCATCGGG + Intronic
1168132001 19:54327162-54327184 CACTGAGAATGGGTATCATGTGG + Intergenic
1168340476 19:55620569-55620591 CACTGTGGTTACGTGTTATGTGG - Intergenic
932421015 2:71601419-71601441 CATAGTCCATGAGTGTCATGAGG + Intronic
932751583 2:74374783-74374805 CTCTGCGCATGACTGTCATGAGG - Intronic
936414632 2:112293855-112293877 CCCTGCGGATGAGGGACATGAGG - Intronic
936718046 2:115213382-115213404 CACCATGGATGGGTGACATGGGG - Intronic
938907957 2:135856727-135856749 CCTTGTGGATGAATGTAATGAGG - Exonic
943082116 2:183267779-183267801 CACTATGGAATAGTGCCATGGGG - Intergenic
943473421 2:188324187-188324209 CTCTGTGCATGAGTAGCATGAGG - Intronic
945071160 2:205990381-205990403 CACTGTAGAAGAGTTTGATGAGG + Intergenic
947902122 2:233729735-233729757 CCCTTTGCATGAATGTCATGTGG - Exonic
947985954 2:234447581-234447603 CACTGTGGCTTAGTGTCCGGGGG - Intergenic
948385701 2:237579281-237579303 GACAGTGCATGAGTGTCCTGCGG + Intronic
1170391374 20:15878370-15878392 CAGTGTGCATGAGTGTCACCTGG + Intronic
1171387492 20:24780079-24780101 CAGTGTGGCTGTGTGTCATGAGG + Intergenic
1171469241 20:25356687-25356709 CACTGTGGCAGAGTGGCAGGTGG + Intronic
1173445804 20:43117024-43117046 CAAGGAGGATGAGAGTCATGTGG - Intronic
1174147805 20:48464292-48464314 CACTGTGGCCCAGGGTCATGGGG - Intergenic
1174468906 20:50740901-50740923 CAGTGTGGCTGACTGTGATGAGG - Intronic
1175496491 20:59418110-59418132 CACTGGGGAGGAGTGTCCTGTGG + Intergenic
1175619692 20:60433119-60433141 CACTATGGAGATGTGTCATGGGG + Intergenic
1175661890 20:60820569-60820591 GACAGTGAATAAGTGTCATGAGG + Intergenic
1176249306 20:64112704-64112726 CACTGGGGAAGACTGTCCTGGGG - Intergenic
1176901701 21:14450088-14450110 CACAGTGGATGAGAGTCATATGG - Intergenic
1182419294 22:30241168-30241190 CACTGAGGATGGGTCCCATGGGG + Exonic
1184477249 22:44728499-44728521 CATTGTGAAGGAGTGTCCTGGGG + Intronic
949473609 3:4421407-4421429 CCTTGTGACTGAGTGTCATGGGG - Intronic
950197473 3:11018913-11018935 CACTTTAGAGGGGTGTCATGAGG - Intronic
952335038 3:32396631-32396653 ACCTGTGGATGAGTGTGAGGGGG + Intronic
952762430 3:36926493-36926515 CACGGTGGATGATTGCCATGAGG - Intronic
957094748 3:75768286-75768308 CACTGTGGCTGAGTGTGTCGGGG + Intronic
957094762 3:75768345-75768367 CACTGTGGCTGAGTGTGGGGGGG + Intronic
957094843 3:75768761-75768783 CACTGTGGCTGAGTGTGTGGGGG + Intronic
959265849 3:104137722-104137744 CAGTGTGGAGGAGTGAGATGTGG - Intergenic
960470373 3:118057118-118057140 CACTCTATATGAGTGTCTTGGGG - Intergenic
961975569 3:131021418-131021440 CAATGTGAATGAATCTCATGTGG + Intronic
962897951 3:139732868-139732890 CCATGTGACTGAGTGTCATGTGG - Intergenic
966357237 3:179094070-179094092 TACTGAGGGAGAGTGTCATGTGG + Intergenic
968527453 4:1069438-1069460 CATAATGGATGAGTGTCTTGTGG - Intronic
969961796 4:10952140-10952162 CACTGTGAATGCATGTCTTGGGG - Intergenic
972798469 4:42446972-42446994 CAATATGGATGAGAGTCATAGGG + Intronic
976522761 4:86048685-86048707 CACTGTGGATTTGTATCCTGGGG - Intronic
980479611 4:133370602-133370624 CACTCTAGATGAGTGCCATGCGG - Intergenic
985730519 5:1544827-1544849 CACTGTGGATGAGTTGCCAGTGG + Intergenic
986227538 5:5829459-5829481 GACTGTGGCTGAGTGCCATGGGG - Intergenic
986619089 5:9651991-9652013 CACTCTGCATGAGTGTCAGAAGG + Intronic
988465197 5:31483764-31483786 CACTGAGGAGGAGTGGCAGGAGG - Intronic
988576307 5:32428752-32428774 CACAGTGCATGAGTGGCCTGAGG + Intronic
994396788 5:99232037-99232059 CACAGTGGGTGTGTGCCATGTGG + Intergenic
1001987925 5:176091487-176091509 CACTGTGTGTGTGTGTCATGGGG - Intronic
1002004237 5:176219043-176219065 CATGGTGGATGATTGCCATGAGG - Intergenic
1002222137 5:177691587-177691609 CATGGTGGATGATTGCCATGAGG + Intergenic
1002228945 5:177746654-177746676 CACTGTGTGTGTGTGTCATGGGG + Intronic
1002266401 5:178037129-178037151 CACTGTGTGTGTGTGTCATGGGG - Intronic
1003381150 6:5625620-5625642 CACTGTGGATATGTGTGGTGGGG + Intronic
1014701017 6:124688052-124688074 CCCTGAGGATGAGTGTCATTTGG + Intronic
1014715248 6:124857094-124857116 CTGTGTGGATGAGTCTCCTGAGG - Intergenic
1014836705 6:126168069-126168091 CACTGTAGCTGAGTTTCATGAGG - Intergenic
1016323119 6:142869949-142869971 CACTTTGGATCAGTGTTCTGTGG - Intronic
1019742806 7:2683157-2683179 CAATGTGGATGAGTTTCCTGCGG + Intronic
1021148499 7:17119833-17119855 CACTGTGGATGAGAGTGATCTGG + Intergenic
1021870692 7:25003115-25003137 AACTGAGGATGACTGTCCTGAGG - Intergenic
1028525159 7:91776056-91776078 CACTAAGGATGATTCTCATGGGG - Intronic
1030121879 7:106118117-106118139 CACCGTGGGTGATTGGCATGAGG + Intergenic
1032056288 7:128687125-128687147 CAATAAGGATAAGTGTCATGAGG - Intergenic
1034269086 7:149795008-149795030 CACTGTGGATGGTTGTCCTAAGG + Intergenic
1034358405 7:150472487-150472509 TACTGTGGATGAGAGACAGGAGG + Intronic
1034495931 7:151422174-151422196 CAATGTGGATGAGTGACCTCCGG + Intergenic
1034553334 7:151834764-151834786 CGCTGTGGGTGAGTCTCCTGGGG + Intronic
1036011620 8:4731649-4731671 CACTTTGCATGAGTATCATTTGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038577282 8:28716215-28716237 CACTCTGGATGAGGCTGATGAGG + Exonic
1042121816 8:65496588-65496610 ATCTGTGGATGAGTCTTATGAGG + Intergenic
1042501065 8:69509694-69509716 CACTGTCCATACGTGTCATGAGG + Intronic
1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG + Intronic
1048419472 8:134262520-134262542 GACAGTGAATGAGTCTCATGAGG + Intergenic
1053403421 9:37849191-37849213 TACTGTTCATCAGTGTCATGGGG + Intronic
1056947230 9:91008729-91008751 CACTGTGGAGGTTTGTCAGGAGG + Intergenic
1057406054 9:94771703-94771725 CAGTGTGGTTGAGTCTCCTGTGG + Intronic
1061036280 9:128115961-128115983 ATCTGTGTATGAGTGTCCTGGGG + Intergenic
1061718050 9:132533322-132533344 CCCTGTGTACGAGTGTCCTGTGG + Intronic
1186559008 X:10590418-10590440 CACTGTGGAAGAGTGGCACAGGG - Intronic
1186768363 X:12792985-12793007 CATTGTGAATGAGTGGCAGGTGG + Intronic
1188718892 X:33499492-33499514 CAGTGGGGATGAGTGTCTGGAGG - Intergenic
1189566438 X:42246410-42246432 CTCCATGGATGAGTGACATGGGG - Intergenic
1191716482 X:64197186-64197208 CAGTGTGGCTGAGTTTCAGGTGG + Intronic
1192176801 X:68891484-68891506 CCCTGTATATGACTGTCATGAGG - Intergenic
1197198119 X:123724189-123724211 CTCTGTGGATGATTGTAATCTGG - Intronic
1197392007 X:125878608-125878630 CTCTGTGGATGCGTGTCAACTGG + Intergenic
1199864379 X:151829615-151829637 CACCATGGATGAGTGACACGGGG - Intergenic
1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG + Intronic
1200187974 X:154195368-154195390 CACTGTGGATGAGTGTCATGGGG + Intergenic
1200193624 X:154232508-154232530 CACTGTGGATGAGTGTCATGGGG + Intronic
1200199379 X:154270312-154270334 CACTGTGGATGAGTGTCATGGGG + Intronic