ID: 1200199905

View in Genome Browser
Species Human (GRCh38)
Location X:154273655-154273677
Sequence GCTGTTAAAAAACCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 4, 1: 0, 2: 0, 3: 12, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200199905 Original CRISPR GCTGTTAAAAAACCACAAGC AGG Intronic
900687884 1:3960382-3960404 ACTGTTTAAAAACAACAAACAGG + Intergenic
903067141 1:20706292-20706314 GCTATTAAAAAACAACAGGCTGG + Intronic
904338837 1:29819215-29819237 GCTGTGAAACAACTTCAAGCAGG - Intergenic
905357990 1:37398233-37398255 GGTGTTAGAAAACCACCATCGGG + Intergenic
906338934 1:44961035-44961057 GCTGTTAAAAAAAAAAAATCTGG + Intronic
906393651 1:45441471-45441493 TCTATTAAAAAACAACAGGCTGG - Intronic
910285250 1:85546447-85546469 GCTGTAACACCACCACAAGCTGG - Intronic
913326751 1:117634630-117634652 GCTGTTCACAAACCAGCAGCAGG + Intergenic
913523483 1:119668462-119668484 ACAGTTAAGAAACCACAGGCCGG + Intronic
914217806 1:145649102-145649124 CCTGTTAAAAAATGACATGCTGG - Intronic
914384552 1:147155511-147155533 GCTGTCCTAAAACCACAAGCTGG + Exonic
914470361 1:147971778-147971800 CCTGTTAAAAAATGACATGCTGG - Intronic
915119407 1:153619292-153619314 GCTGCTTACAAACCACAAACAGG + Intronic
915528806 1:156491647-156491669 GCTGCTCAGTAACCACAAGCAGG - Intronic
915773456 1:158455459-158455481 GATGTTAAAAATCCACACACTGG - Intergenic
916935388 1:169622871-169622893 TCACTTAAAAGACCACAAGCAGG - Intronic
918737299 1:188081105-188081127 GCTGTAAGTAAACCACAGGCTGG + Intergenic
920293069 1:204937744-204937766 GCTGTTAAACATCCACGTGCAGG + Intronic
922585440 1:226731204-226731226 TCTGTTTAAAAACAAAAAGCAGG - Intronic
924851345 1:247834189-247834211 GCTGATAAAAAATCACAAAGAGG + Intergenic
1063154455 10:3365686-3365708 GTTGTTAAAATACCACAAAAAGG - Intergenic
1065161352 10:22926066-22926088 TCTGTAAAAAAACCACAATAGGG + Intergenic
1066002297 10:31115940-31115962 GCAGTAAAACAACAACAAGCTGG + Intergenic
1066182528 10:32977295-32977317 GCTGTTAACAATCCACAAATTGG + Intronic
1066307876 10:34164200-34164222 GTTGTTACAAAAACAGAAGCAGG - Intronic
1069586110 10:69603728-69603750 GTTGCAAATAAACCACAAGCTGG + Intergenic
1070683493 10:78465340-78465362 GCTGTAAATAACACACAAGCAGG + Intergenic
1071258461 10:83896571-83896593 GATGTTAAAAATCCACACACTGG - Intergenic
1073241071 10:102058596-102058618 GCTGTTAAAAAAATTAAAGCGGG + Intergenic
1074632238 10:115271703-115271725 ACAGATAAAAAACTACAAGCAGG - Intronic
1075932012 10:126306581-126306603 GATATTTAAAAACCAAAAGCAGG - Intronic
1079877804 11:25881646-25881668 GCTGTTAGAACACCACAGACTGG - Intergenic
1083806312 11:65076413-65076435 GTTGTTAAAAAATGACAACCAGG - Intronic
1084094022 11:66898318-66898340 GCTGTTAAAAAACAAAACCCTGG - Intronic
1084672315 11:70614612-70614634 GCTGCTAAGAAACCACAGGTTGG - Intronic
1085918816 11:80926285-80926307 GCTTTTAAACCAACACAAGCTGG - Intergenic
1087476059 11:98636904-98636926 GCTTTTAAAAATGCACAAACAGG - Intergenic
1088686896 11:112291333-112291355 GCTGTTAAACAAGGACAATCCGG + Intergenic
1089914310 11:122138012-122138034 GCTGTTAAAAAAACATAATGTGG + Intergenic
1090295459 11:125583869-125583891 GATGTTAAAAATCCACACACTGG - Exonic
1091751864 12:3027375-3027397 GCTGTTAAAAAAATACAGACAGG - Intronic
1097274088 12:57799830-57799852 TCTGTTGAAAAACCAGAATCAGG - Exonic
1097482456 12:60147111-60147133 GGTGTTCATAAAACACAAGCTGG + Intergenic
1100348519 12:93755494-93755516 GCTGTTAAACAACCAACACCTGG - Intronic
1102985103 12:117271572-117271594 GCTGTTAAAAATCCACCGGTTGG - Intronic
1103474823 12:121210476-121210498 GCTGTTTTAAAACCACAGCCTGG + Intronic
1103592810 12:122004273-122004295 GCTGATAAGAAGCCACAATCTGG - Intergenic
1103751668 12:123168255-123168277 GCTGGAAAAAAGCCACCAGCTGG + Intronic
1106362371 13:29043701-29043723 GCAGTTAAAAAAAGACAAACAGG - Intronic
1106651905 13:31700403-31700425 GCTGTTAGAACACCACACACTGG + Intergenic
1107253145 13:38390658-38390680 ACTGGTAAAAAACCACTGGCTGG + Intergenic
1108194338 13:47976652-47976674 CCTGTTAAAAAATCAGGAGCTGG - Intronic
1108793753 13:54005399-54005421 GATGTTAAAAAGGGACAAGCAGG + Intergenic
1108961352 13:56235948-56235970 GCTATAATAAAACCACAAACTGG + Intergenic
1111123567 13:83883174-83883196 GCTGTTAAAAACCCACTGGCAGG + Intergenic
1114596030 14:23912467-23912489 GCTGTTAAAAATACACAAAATGG - Intergenic
1116337990 14:43683614-43683636 GCTGTTAAAAAGCAACAAAAGGG + Intergenic
1116753785 14:48920583-48920605 ACTGTAAAACAACCTCAAGCAGG - Intergenic
1119507196 14:75183082-75183104 GCTGTTAAAAAAAAAAAAGGAGG + Intergenic
1120918186 14:89729139-89729161 GCTGTTAAACAAACAAAACCAGG + Intergenic
1121605729 14:95238423-95238445 GCTGGTGAAAAACCACATGGAGG - Intronic
1121679490 14:95780907-95780929 GTTGTTAGAAAACCACTGGCTGG - Intergenic
1121913193 14:97811191-97811213 GCTATTAAAAAACCCCAACTTGG - Intergenic
1122709307 14:103643913-103643935 GCTGTTAAGAAACCTAAAGTTGG + Intronic
1125839196 15:42783006-42783028 GCTGTTGACAAAGCACAATCTGG - Intronic
1126339429 15:47622925-47622947 GAAGTTAAAAAAACACAAGCTGG + Intronic
1127486121 15:59419575-59419597 TCTATTAAAAAACAACAGGCCGG + Intronic
1127779511 15:62298985-62299007 GCTGTTAAAATACCAACTGCTGG - Intergenic
1131209961 15:90486377-90486399 TTTTTTAAAAAAACACAAGCTGG - Intronic
1134754523 16:16655037-16655059 ACATTTAAAAAACCAAAAGCTGG - Intergenic
1134991538 16:18704005-18704027 ACATTTAAAAAACCAAAAGCTGG + Intergenic
1135665639 16:24333624-24333646 GCTTTGAAAAATCCACAACCTGG + Intronic
1140604989 16:76525015-76525037 GCTGTCAAAACACCACATGAGGG + Intronic
1142790805 17:2264166-2264188 GCTCTTCACAGACCACAAGCTGG + Intronic
1144472214 17:15554535-15554557 GCTATTAAAAAACAAGAAACAGG - Intronic
1144924260 17:18790162-18790184 GCTATTAAAAAACAAGAAACAGG + Intronic
1146591496 17:34131600-34131622 GCTGTCAGCAGACCACAAGCTGG - Intronic
1148678413 17:49458602-49458624 GCTCTTCAAAAACCTCAACCTGG + Intronic
1149322686 17:55497568-55497590 CCTCTTAAAAAAACACAACCTGG + Intergenic
1150839402 17:68594036-68594058 GCAGCTAGAAAACCACAGGCAGG - Intronic
1151975382 17:77481184-77481206 GCTGTTAAGACACCACACACGGG - Intronic
1153615646 18:6930512-6930534 GCTGTAACCAAACCATAAGCTGG - Intergenic
1154001380 18:10485097-10485119 GCTATCAAAAAATCACAAGTTGG - Intronic
1155338802 18:24793425-24793447 TCTTTTAAAAAAACAAAAGCGGG + Intergenic
1156854651 18:41767793-41767815 GCTGTCATTAAACCAAAAGCGGG + Intergenic
1157105298 18:44768977-44768999 ACTGAAGAAAAACCACAAGCAGG - Intronic
1159076375 18:63686041-63686063 CATGTGAAAAAACCACAAGGAGG - Intronic
1161490903 19:4560737-4560759 ACTGTCAAAAAACCAAAAGGTGG - Intergenic
1162595817 19:11628297-11628319 ACTGTTAAAAAAAAAAAAGCCGG - Intergenic
1165590482 19:36965237-36965259 GCTGTTATAAAAGGACAAGTTGG + Intronic
1166654697 19:44602180-44602202 GCGGTTAAAAAAAAAAAAGCAGG + Intergenic
926026508 2:9549813-9549835 AATGTAAAAAATCCACAAGCTGG - Intronic
927054317 2:19355604-19355626 GGTGTAAAAACACCACGAGCTGG + Intronic
928965044 2:36967260-36967282 GCTGTCAACAAACCACAATTTGG - Intergenic
929763261 2:44823686-44823708 GCTAATAAGAAACCACAGGCCGG + Intergenic
930111640 2:47683946-47683968 GCATTTAAAAAACCCCAAGCAGG + Intergenic
930173450 2:48275937-48275959 GCTATTCAAAAATCACAATCTGG + Intergenic
931436131 2:62248720-62248742 GCTGTTAAAAGAACAAAGGCAGG + Intergenic
936988925 2:118341534-118341556 GGTATTTAAAAACCACAATCTGG + Intergenic
937871551 2:126789658-126789680 GCTTTTAGAAACCCAAAAGCTGG + Intergenic
938319326 2:130352527-130352549 TCTGTTAAAAACCTTCAAGCTGG - Intergenic
938790339 2:134670526-134670548 GCTTCTGAAAAACCACAATCAGG + Intronic
939691763 2:145271440-145271462 ACTGATGAAAAACCACAAGTTGG - Intergenic
940936580 2:159502327-159502349 GCTGTTAAAAAAAAAAAGGCTGG + Intronic
941175585 2:162194180-162194202 GCTGTTAAAACAAAAAAAGCTGG + Intronic
941604596 2:167581738-167581760 GCTGTTAAAAAACCATAAAGGGG + Intergenic
945215018 2:207424078-207424100 AATGTTAAAAAACCACATGGAGG - Intergenic
1168784667 20:527833-527855 GCATTTTAAAAACCACAGGCCGG - Intronic
1169364192 20:4977837-4977859 GCTTTTAAAAAATCACAAATAGG - Intronic
1169901474 20:10557060-10557082 GGTGTGTAAAAGCCACAAGCTGG - Intronic
1170143467 20:13148252-13148274 GCTGTTAAAACAAAACCAGCTGG - Intronic
1170353377 20:15466416-15466438 GCTGGTAAAAGAACACAAGATGG + Intronic
1170947698 20:20906394-20906416 CCTTTTAATAAACCACAAGATGG - Intergenic
1175547179 20:59785910-59785932 GCCGTTGGAAAACCAGAAGCAGG - Intronic
1179449265 21:41457058-41457080 GCTGTCAAAAAACCCCAACAAGG - Intronic
1183348297 22:37319808-37319830 GCTGTTAAGAACCCACACACTGG - Intergenic
1184295676 22:43522987-43523009 GCAGTTAAAATGCCACAAGTCGG + Intergenic
1184556298 22:45235056-45235078 GCTGTAAAGAAGCCCCAAGCAGG - Intronic
949778787 3:7662400-7662422 TCTGTTTAAAAACCAAAGGCAGG + Intronic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953514189 3:43573705-43573727 GCTTTTAACAAACAGCAAGCAGG + Intronic
953619936 3:44524538-44524560 GGTGTTAAAAATCCACACGCTGG + Intergenic
954479991 3:50790059-50790081 GCAGTTAAAAAAACACAAAGAGG - Intronic
955810829 3:62786995-62787017 TTTTTTAAAAAACCTCAAGCCGG + Intronic
959204646 3:103290464-103290486 ACTGTGCAACAACCACAAGCAGG + Intergenic
961947877 3:130713142-130713164 GCTTTCAAAAAACCGGAAGCTGG + Intronic
962013114 3:131412756-131412778 GCAGTTAAAAAAAGACAAGGAGG + Intergenic
966420603 3:179731107-179731129 GTTGTTAAAAAACAACACACAGG + Intronic
966439030 3:179922987-179923009 TCTGTTCAAAAACCTCAAGTGGG + Intronic
967791359 3:193552270-193552292 GGAGTTAAAAAACCAAAAACAGG - Intronic
969827712 4:9771088-9771110 GGTGTTTATAAACCACAATCTGG + Intergenic
970663687 4:18313364-18313386 GCTTTTTCAAAATCACAAGCAGG - Intergenic
972024449 4:34360117-34360139 TTTGTTAAAAAAGCACAAGAAGG - Intergenic
974103032 4:57438323-57438345 GCTTTTAAAAAACTGCTAGCTGG - Intergenic
974777684 4:66507891-66507913 AATGTTACAAAAGCACAAGCAGG + Intergenic
975743124 4:77449928-77449950 GCTGTTAAGAAACCAAGATCTGG + Intergenic
976886658 4:89993088-89993110 GCTTTTAAAAAACAACATGAAGG - Intergenic
977831688 4:101601831-101601853 ACTGTAAAACAACCTCAAGCAGG + Intronic
977938187 4:102828893-102828915 AATGTTAAAAAACCTTAAGCTGG - Intronic
978739854 4:112124128-112124150 GCTGTTGACAATCCACATGCAGG + Intergenic
979780766 4:124648941-124648963 GCTGTAAAACAGCCTCAAGCAGG - Intergenic
981549079 4:145924609-145924631 GCTGTTGAAAAACCAAACTCAGG - Intronic
984535456 4:180969412-180969434 GCTATTGAAAAAAAACAAGCAGG + Intergenic
985930453 5:3052804-3052826 GCTGTTAAAAAACTATAGGCCGG - Intergenic
986447419 5:7834080-7834102 ACTGTAAAACAACCTCAAGCAGG + Intronic
988256435 5:28825467-28825489 GCTATTAAAAAACCACACCTTGG - Intergenic
990108884 5:52298173-52298195 GCTGTAAAACAGCCACAGGCAGG - Intergenic
993515483 5:88828537-88828559 ACTGTTAAATAAATACAAGCTGG + Intronic
993572332 5:89556990-89557012 GTTGTTAAGAAAGCCCAAGCAGG - Intergenic
994582679 5:101666499-101666521 ACTTTTAAAAAACAATAAGCAGG + Intergenic
996300354 5:121975330-121975352 ACTGTTAAAAAACCAAAGACGGG + Exonic
997021432 5:130007467-130007489 GCTACTAAATAACCACATGCAGG - Intronic
997522247 5:134530473-134530495 GCAGTTAAAACACCCCAACCTGG - Intronic
1000434994 5:161197204-161197226 GCAGTTCAAAAACCACTAGTTGG - Intergenic
1001614921 5:173035446-173035468 GCTGTCAAAAAGCCATGAGCTGG - Intergenic
1004081142 6:12394331-12394353 GAGGTTAAAAAAGCACAAACAGG + Intergenic
1004721414 6:18270771-18270793 GCTGTTAAAACAAAACAGGCAGG + Intergenic
1005396229 6:25384599-25384621 TTTGTTAAAAAAACACAAACTGG - Intronic
1009729564 6:67582559-67582581 GATGTTAAAAAAAAAAAAGCTGG - Intergenic
1011979605 6:93356591-93356613 GCTGTAAATAATCAACAAGCTGG + Intronic
1012470548 6:99568542-99568564 CCTGATAAAAAAGCACCAGCCGG + Exonic
1013566110 6:111365387-111365409 GTTTTTTAAAAACCAGAAGCAGG - Intronic
1014697664 6:124643922-124643944 GCTCTTCAAATACCATAAGCTGG + Intronic
1019968403 7:4520238-4520260 GCTGTTAAATAAACAAATGCAGG + Intergenic
1020909673 7:14112900-14112922 GCAGATAAAAATACACAAGCAGG + Intergenic
1021725828 7:23547292-23547314 GATGTTAAAAAATGACAAGTTGG - Intergenic
1021894759 7:25223362-25223384 GGTCTTAGCAAACCACAAGCAGG - Intergenic
1022151788 7:27615803-27615825 GCTATAAAAAAACCCCAGGCAGG + Intronic
1022212518 7:28225433-28225455 GCTGCTAAATAAAGACAAGCAGG - Intergenic
1022357821 7:29632372-29632394 GCTCTTAAAAACCCTGAAGCCGG + Intergenic
1025206808 7:56998035-56998057 GCTGTTAATAAAGCAGAAGTTGG + Intergenic
1025665132 7:63578892-63578914 GCTGTTAATAAAGCAGAAGTTGG - Intergenic
1026134783 7:67650389-67650411 GCTGTTAAAAAATTGCAGGCTGG + Intergenic
1026357220 7:69568891-69568913 GCAGTAAAAAAACCCGAAGCTGG + Intergenic
1027047595 7:75001379-75001401 GCTGTTAAAAAACTCCAGGTGGG - Intronic
1027470025 7:78561911-78561933 GCTGATAGAAAACCACAAGGAGG + Intronic
1029185622 7:98736419-98736441 GCTTTTAAAAACCCCCAGGCCGG + Intergenic
1029385395 7:100240260-100240282 GCTGTTAAAAAACTCCAGGCGGG + Intronic
1030183176 7:106732037-106732059 ACTATTATAAAACCCCAAGCAGG + Intergenic
1030332999 7:108293150-108293172 GCTGTTAATTAATCACAAGGGGG - Intronic
1033880453 7:145875709-145875731 GCTGCTATAAAACCAGAAGTTGG - Intergenic
1035925117 8:3719794-3719816 CCTGTTAAAGATCCAAAAGCTGG - Intronic
1036017468 8:4800935-4800957 GCTTTTAAAAAATAACAATCAGG - Intronic
1037077927 8:14744874-14744896 GCTGTTATAAAATGAAAAGCTGG - Intronic
1038150635 8:24940184-24940206 GCTGTGTCAAAACCACAAGAAGG - Intergenic
1038303457 8:26377514-26377536 GCTGTTAAAAAACAAGAATTAGG + Intergenic
1040994634 8:53389381-53389403 GCTGTAACAAATCCATAAGCTGG + Intergenic
1041336723 8:56793675-56793697 GCTGTTAAAAAATTTTAAGCAGG + Intergenic
1042244418 8:66696410-66696432 GCTTTTAAGAAACCAAACGCTGG + Intronic
1045903829 8:107317929-107317951 ACTATTAAAAAACCACTAGTTGG - Intronic
1047000756 8:120570149-120570171 GCTGAGAAAAAACCAAAAGAGGG + Intronic
1047766418 8:127993605-127993627 GCTGTCAAAATGCCAAAAGCTGG - Intergenic
1051332043 9:16033126-16033148 GCTAGGATAAAACCACAAGCAGG + Intronic
1055848035 9:80591290-80591312 GCTGCTAATGAAGCACAAGCAGG - Intergenic
1055927405 9:81524763-81524785 GCTGTTAGAATACCACAGACTGG - Intergenic
1056720073 9:89063907-89063929 GCTGTAACAACACCACAGGCTGG + Intronic
1058325311 9:103689105-103689127 GCAGTGCAAAAACCAGAAGCAGG - Intergenic
1059541337 9:115133316-115133338 GCTGTTAGAACACCACAGACTGG + Intergenic
1059872443 9:118592979-118593001 GCTGTTGAAATATCACAAACAGG - Intergenic
1059958435 9:119542282-119542304 GCTCTTAGCAAACCACAGGCTGG - Intergenic
1186845829 X:13529998-13530020 GCTGTTAAAAATCCACATTATGG - Intergenic
1190961956 X:55260533-55260555 CCTGTTAAAATACCAGAAGCAGG - Exonic
1194727883 X:97419513-97419535 GCTGGTAAAAAACCGCCAGTAGG + Intronic
1196960750 X:120998036-120998058 ACTGTAAAAAAGCCTCAAGCAGG - Intergenic
1198689789 X:139268312-139268334 ACTGTTAGAAAAACACAGGCTGG - Intergenic
1199342760 X:146701121-146701143 GATGTTAAAAAAATAAAAGCAGG - Intergenic
1200182846 X:154161597-154161619 GCTGTTAAAAAACCACAAGCAGG + Intergenic
1200188500 X:154198711-154198733 GCTGTTAAAAAACCACAAGCAGG + Intergenic
1200194149 X:154235852-154235874 GCTGTTAAAAAACCACAAGCAGG + Intergenic
1200199905 X:154273655-154273677 GCTGTTAAAAAACCACAAGCAGG + Intronic
1202049915 Y:20769675-20769697 GCTGTTTAAAGACCCCAAGCTGG + Intronic