ID: 1200206095

View in Genome Browser
Species Human (GRCh38)
Location X:154317462-154317484
Sequence AGGGCCAAGTGGTAGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200206085_1200206095 23 Left 1200206085 X:154317416-154317438 CCAACTGTAGGCAGGCCCAGGCT 0: 1
1: 0
2: 2
3: 30
4: 195
Right 1200206095 X:154317462-154317484 AGGGCCAAGTGGTAGGAGCATGG 0: 1
1: 0
2: 2
3: 26
4: 294
1200206089_1200206095 7 Left 1200206089 X:154317432-154317454 CCAGGCTTGGAATGTTTGGAGAG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1200206095 X:154317462-154317484 AGGGCCAAGTGGTAGGAGCATGG 0: 1
1: 0
2: 2
3: 26
4: 294
1200206088_1200206095 8 Left 1200206088 X:154317431-154317453 CCCAGGCTTGGAATGTTTGGAGA 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1200206095 X:154317462-154317484 AGGGCCAAGTGGTAGGAGCATGG 0: 1
1: 0
2: 2
3: 26
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200206095 Original CRISPR AGGGCCAAGTGGTAGGAGCA TGG Intronic
900380050 1:2379426-2379448 AGGGCCACGAGGTAGGCGCTGGG - Intronic
900802468 1:4745856-4745878 GGGGACACGTGGTGGGAGCATGG + Intronic
900864256 1:5255918-5255940 AGGGCCCAGTGGTGACAGCAAGG + Intergenic
901234711 1:7661645-7661667 GGGGCCAAGGGGTAGGACCCAGG - Intronic
903338869 1:22642155-22642177 GGGGCCAAGTGGGCGGGGCACGG + Intergenic
903582723 1:24384230-24384252 AGGGCATAGTGGAAAGAGCAAGG - Intronic
903837766 1:26216780-26216802 AGGGCCAGGTGGTGGCACCAAGG - Intergenic
904374375 1:30070869-30070891 AGGGCCAAGGGGGCAGAGCAGGG - Intergenic
904912285 1:33944413-33944435 AGGGCCAAATGGTAGGGAAAAGG - Intronic
905902110 1:41588514-41588536 AGGGCCAGGTGGGAGGGGCAGGG + Intronic
906290905 1:44618690-44618712 AGAGACAAGTGGGAGGGGCATGG + Intronic
907928532 1:58977493-58977515 AGGGACAGGTGGAAAGAGCACGG + Intergenic
907990722 1:59579722-59579744 AGGGCCCAGTGGTAAAAACAGGG - Intronic
908403488 1:63792039-63792061 AGGGCCAAGAAGAATGAGCAGGG + Intronic
910238216 1:85058070-85058092 AGGGCCATGTGGTAGCAGAGTGG - Intronic
910252795 1:85215669-85215691 AGGGCCAAGTAGCAGAAGGATGG - Intergenic
910280956 1:85501289-85501311 AAGGCCAGGCGGTAGGAGGAGGG - Intronic
910566013 1:88643475-88643497 AGAGCAAAGTGGTATGATCAAGG - Intergenic
913451263 1:118994185-118994207 GGGGCCAAGTGGGAGCAGCAGGG + Intergenic
914004913 1:143724028-143724050 AGGGACAAGGTGTAGGGGCAGGG + Intergenic
914343559 1:146779661-146779683 AGGGGGCAGTGGAAGGAGCAAGG - Intergenic
914513218 1:148352591-148352613 AGTTCCAAGTGGAAGGATCATGG - Intergenic
915166571 1:153951394-153951416 AGGCCCCAGGGGTAGAAGCAGGG + Exonic
915936037 1:160090918-160090940 AGGGCCTAGTGGGAGGAGTCAGG + Intergenic
916501603 1:165392378-165392400 GTGGCCCAGTGGAAGGAGCAGGG - Intergenic
917024060 1:170622585-170622607 AGAGCCAAGGGCTAGAAGCAAGG - Intergenic
920386945 1:205576103-205576125 GGGGACAAGAGGTAGGAGCAGGG + Intronic
921092964 1:211860379-211860401 AGAAGCAAGTGGTAGGAACAAGG + Intergenic
921586592 1:216953565-216953587 AGGGCCAAGAGGGAGGATGAAGG - Intronic
922545226 1:226451794-226451816 TGGGCCAAGTGGATGTAGCATGG - Intergenic
923675353 1:236076046-236076068 AGAGCCAGGTGGGTGGAGCAGGG + Intergenic
1063036046 10:2288022-2288044 AGGGCCAAGTGGGAGGGACTGGG - Intergenic
1063376428 10:5557304-5557326 AGGACCAAGGGCTGGGAGCAGGG - Intergenic
1063698272 10:8358965-8358987 AGGGCCCAGTGGGAGGTGAATGG + Intergenic
1064488107 10:15818823-15818845 GGGGCTGAGTGGGAGGAGCATGG + Intronic
1065281301 10:24141369-24141391 GGGTCCAAGTGGTAGGAAAATGG - Intronic
1065746134 10:28844274-28844296 AGGGGCAAGGTATAGGAGCAGGG + Intergenic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1067155596 10:43779009-43779031 AGGGCCAAGTGAAAGAAGCCCGG + Intergenic
1067771531 10:49130121-49130143 GGGCCCATGTGGTTGGAGCATGG + Intergenic
1067817823 10:49496034-49496056 AGGAGCAAGTGGTAGGATAATGG - Intronic
1069320486 10:67165355-67165377 AGGGGCAGGTGGTAGGGGTAGGG + Intronic
1069652254 10:70057992-70058014 ATGCCCACGTGGTAAGAGCAAGG + Intronic
1070338186 10:75473318-75473340 AGGGCTGTGTGGTGGGAGCAGGG + Intronic
1070631327 10:78086816-78086838 AGGACCAGGAGGTAGGAGCTGGG - Intergenic
1071561808 10:86651303-86651325 ATGGAAAAGGGGTAGGAGCAAGG + Intergenic
1075274775 10:121083658-121083680 ACAGCCAAGTGGCATGAGCAAGG + Intergenic
1075405427 10:122192609-122192631 AGGTCCAAGAGATACGAGCAGGG + Intronic
1077066051 11:641320-641342 TGGGCCAAGGGGTGGGAGCAGGG + Intergenic
1078543477 11:12229556-12229578 AGGGCCAAGTGGCAGAAACGCGG - Intronic
1078619469 11:12893809-12893831 AGGGCCAAGTGGCCAGAACAGGG + Intronic
1083564141 11:63698745-63698767 AGGGGCCAGTGGTAGGAGCTCGG - Intronic
1084405593 11:68971049-68971071 AGAGGCAAGTGGTGAGAGCAGGG + Intergenic
1085264887 11:75231356-75231378 AGGACCAAGGGTTAGCAGCAAGG + Intergenic
1085346929 11:75774224-75774246 AGGGCCCAGGGGTAGGAGTCAGG + Intronic
1085404713 11:76254971-76254993 AGGGCAAAGTGGTAGGCTTAGGG + Intergenic
1085465165 11:76718126-76718148 AGGGGAAAGTGTTGGGAGCATGG - Intergenic
1086074857 11:82839731-82839753 AGGGCAAAGGGGAAGGAGCCTGG - Intronic
1089117966 11:116111658-116111680 AGGTCCAAGAGGCAGGTGCAAGG - Intergenic
1089311681 11:117562157-117562179 AGGGCCAGCTGCTAGGGGCATGG + Intronic
1090270287 11:125381136-125381158 TGGGCCAGGTGGATGGAGCATGG + Intronic
1090722025 11:129484347-129484369 AGGGCTAGGAGGTGGGAGCAGGG - Intergenic
1091175004 11:133549883-133549905 AGGGCCAGATGGAGGGAGCAGGG - Intergenic
1091224665 11:133950273-133950295 AGGGCAAGGTGTGAGGAGCAGGG + Intronic
1092761995 12:11818884-11818906 AGGGCCAGGAGGGAGGAGCAGGG - Intronic
1092807577 12:12239394-12239416 CGGTCCAAGTGGTAGGACAATGG + Intronic
1095798021 12:46241724-46241746 AGGGCCAAGGGGTAAGAGTGGGG - Intronic
1096240489 12:49957309-49957331 AGGGCTGGGTGGTAGGAGGAAGG - Exonic
1098299552 12:69039890-69039912 ATGGCCAACTGGTGGGAGCATGG - Intergenic
1098763962 12:74461345-74461367 AGAGGCAAGGGGCAGGAGCAAGG - Intergenic
1100706333 12:97203892-97203914 AGGGCCATCAGGTGGGAGCAGGG - Intergenic
1101730324 12:107421724-107421746 AGGCCGAAGTGGAAGGCGCAGGG - Intronic
1102021761 12:109688179-109688201 AGGGCCAAGGAGGAGGTGCAGGG + Intergenic
1102714959 12:114962347-114962369 AGGGCCAAGAGGATGGAACAGGG + Intergenic
1104971676 12:132533642-132533664 AGGGACAGGTGGTAAGTGCATGG - Intronic
1106073167 13:26433651-26433673 AGGGCCAGGGGGTGGGAGGAGGG + Intergenic
1107420124 13:40238354-40238376 AGCCCCAAGTGGAAGGAGGATGG - Intergenic
1107938392 13:45364000-45364022 AGAGCCAAGTGGAAAGATCAGGG - Intergenic
1111097865 13:83538467-83538489 AGAACCAAGTGATAGCAGCAGGG + Intergenic
1111315822 13:86557991-86558013 AGGGCCACGTGTTGGGAGGAGGG - Intergenic
1112910702 13:104480010-104480032 AGGGCCAAGTGGGAGGTGATTGG - Intergenic
1113458261 13:110464244-110464266 GGGGGCAGGTGGTCGGAGCAGGG + Intronic
1113670397 13:112171845-112171867 AGAGGCAAGGGGCAGGAGCACGG + Intergenic
1118734943 14:68694634-68694656 AGGTCCAAGTGGGAGGTGCCAGG - Intronic
1119753635 14:77098516-77098538 AGAGCCAAATGGTGGGAGCAGGG + Intronic
1120273161 14:82340114-82340136 AGGGTGGAGTGGTAGGAGGAGGG - Intergenic
1122126471 14:99581214-99581236 AGAGCCCAGTGGTTTGAGCATGG - Intronic
1122205496 14:100146038-100146060 AGGCCCAAGGGGTGGGGGCAAGG + Exonic
1122443753 14:101754053-101754075 AGGGCCAGGTGGTAGCGCCAAGG - Intergenic
1127620024 15:60724900-60724922 AGGGCCCAGTGTGAGGAGCGGGG - Intronic
1129344790 15:74910291-74910313 AGGTCTGAGTAGTAGGAGCAAGG - Intergenic
1129609290 15:77040041-77040063 AGGGGCCAGTGGGAGGAGAAAGG + Intergenic
1129692175 15:77720121-77720143 TGGGGCTGGTGGTAGGAGCAGGG - Intronic
1130383259 15:83390237-83390259 AGGGCCAAGTTGAAGGCCCAAGG - Intergenic
1131115054 15:89790376-89790398 AGGGCCACGTGGGAGAAGAATGG + Intronic
1132454561 16:15364-15386 GGGGCCAGCTGGCAGGAGCAGGG + Intronic
1132482911 16:175514-175536 AGGGCCCTGTGGTTGGAGAATGG - Intergenic
1136544040 16:30945733-30945755 AGGCCAAAGTGGGAGGATCAAGG + Intronic
1138108531 16:54305124-54305146 AGGGCGAAGGGGAAGGGGCAGGG - Intergenic
1138157126 16:54716193-54716215 AGGGACAAGAGGGAGGAGCTCGG - Intergenic
1138903184 16:61298986-61299008 AGGCCGAAGAGGTAGGAGGATGG - Intergenic
1139990432 16:70935673-70935695 AGGGGGCAGTGGAAGGAGCAAGG + Intronic
1140411904 16:74746198-74746220 AGGTCCAAGTCATAGGAGGATGG + Intronic
1141380861 16:83575505-83575527 AGGGACACGTGGTGTGAGCAGGG - Intronic
1141498178 16:84424664-84424686 AGGCCCAAGGGGCAGGTGCAGGG + Intronic
1143722321 17:8821760-8821782 AGGGCAGAGTGGCAGGAGAAGGG - Intronic
1144513031 17:15893865-15893887 AGGGCCACGTAATAGGATCAGGG + Intergenic
1144702980 17:17350848-17350870 AGGGCCAAGGGGGAGCAGCATGG - Intergenic
1145403683 17:22568546-22568568 GGGACCAGGTGGTAGGAGCCTGG - Intergenic
1147158473 17:38557459-38557481 AGGGCCCAAAGGAAGGAGCAGGG + Intronic
1148133029 17:45273808-45273830 AGGGCAAAGGGACAGGAGCAGGG + Intronic
1148890901 17:50806333-50806355 AGGGCCACGTGGTTGGAATAGGG + Intergenic
1149443965 17:56699414-56699436 AGAGCCGGGTGGCAGGAGCAAGG - Intergenic
1151212895 17:72558106-72558128 AGGGCCTAGAGACAGGAGCAGGG + Intergenic
1151542211 17:74770340-74770362 GGGGCCAAAGGGTAGAAGCAAGG - Intergenic
1152931121 17:83110337-83110359 AAGGCCAAGTGGGACGGGCAGGG + Intergenic
1153467639 18:5406783-5406805 AGGGACAAGTGGTTCGATCATGG + Exonic
1153472429 18:5461994-5462016 AGGGCCAGAAGGTAAGAGCAGGG + Intronic
1154210826 18:12377322-12377344 AGGACCAAATGGGAGGAGCATGG + Intergenic
1154254495 18:12770701-12770723 ATGGCCACGTGGTAGGAGAAAGG - Intergenic
1154979378 18:21489953-21489975 AGGGCCAGCTGGGAGCAGCAAGG - Intronic
1157328478 18:46686129-46686151 AGGGCCATGGGGTAGTGGCAAGG + Intronic
1157400398 18:47382286-47382308 AGAGCCCCGGGGTAGGAGCAGGG - Intergenic
1160710491 19:548977-548999 AGCGCCAGGTGGTGGCAGCAGGG + Exonic
1161839685 19:6671994-6672016 AGGGCCAAGAGGTAAAATCAAGG - Intergenic
1161932273 19:7348954-7348976 AGGGCTGAGGGGTGGGAGCAGGG + Exonic
1162032751 19:7924593-7924615 AGGGGCAAGTGGCAGGAGGGCGG + Exonic
1162181195 19:8870197-8870219 AGGGTGAGGGGGTAGGAGCAAGG + Intronic
1162305303 19:9869357-9869379 AGGGCCAACTGGTAAGAGCAGGG + Intronic
1163126272 19:15245896-15245918 AGATCCAAGTGGAAGGAGCCTGG - Intronic
1163528241 19:17834503-17834525 TGGGCCCAGTGGAAGGAGCGTGG - Intronic
1164709454 19:30344852-30344874 AGGGCCAAGAACTAGGAGCCTGG - Intronic
1165354704 19:35296247-35296269 GGGGCCAGGGGGTAGGGGCAAGG + Intronic
1165763058 19:38333790-38333812 GGGGCCAAGAGGTAGGATGAGGG + Intergenic
1165778406 19:38418169-38418191 AGGGCCAAGGGGTGGGGCCACGG + Intronic
1167291609 19:48628084-48628106 AGGGCCCAGGGCTAGGGGCAGGG - Intronic
1167942196 19:52956850-52956872 GGGGCCAGGTGGTAGCACCAAGG - Intronic
1168084316 19:54034299-54034321 AGGTCAAAGTGGGAGGATCATGG - Intergenic
1168100107 19:54137137-54137159 AGGGCCAAGTGGGAGGAGCTGGG - Intergenic
1168279330 19:55296005-55296027 AAGGCCCTGTGGTAGGAGCAGGG - Intronic
1168396181 19:56050646-56050668 AAGGTCAAGAGATAGGAGCAGGG + Intronic
925932485 2:8720444-8720466 AGAGCCAAGAGGAAGGAGCCGGG + Intergenic
926444839 2:12929383-12929405 AGGACCAAGGGGTAGGAGCCAGG + Intergenic
926733077 2:16051858-16051880 AGGGGACAGTGGAAGGAGCATGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927420278 2:22923876-22923898 AGGGCCAAGAGGAGGGTGCATGG - Intergenic
927715622 2:25350273-25350295 AGGGCCTAGTGGGAGGTGCTTGG + Intergenic
927941248 2:27104245-27104267 AGGGCCAAGGGCTGGGAGGAGGG - Intronic
927972189 2:27312752-27312774 AGGGCCCTGTGGTAGGAGGCTGG - Exonic
932129957 2:69178510-69178532 AGGGACAAGAGGGAGGAGCCAGG + Intronic
932870163 2:75390563-75390585 AGGCTCAAGTGGTAGGACTAAGG - Intergenic
933331930 2:80903339-80903361 AAGGCTAAGTCCTAGGAGCAGGG + Intergenic
933624463 2:84582991-84583013 TGGGCCAAGTAGTACGAACATGG + Intronic
934124923 2:88879101-88879123 AGGTCCCAGTCATAGGAGCAGGG - Intergenic
934759119 2:96843849-96843871 AGGGTCAAGTCTTAGGTGCAGGG - Intronic
935599197 2:104905058-104905080 AGGTCCAACTGGGATGAGCACGG + Intergenic
936241559 2:110792367-110792389 AGGGCCGTTTGGAAGGAGCAGGG - Intronic
938053177 2:128193639-128193661 AGGGCCAAGAGCTAGGGACAGGG + Exonic
939816826 2:146906687-146906709 AAATCTAAGTGGTAGGAGCATGG - Intergenic
940179273 2:150914105-150914127 AGTGCGGAGTGGTAGAAGCAAGG - Intergenic
941333284 2:164207493-164207515 AGGGCCAAGTGGTGGGAGAGAGG - Intergenic
942141377 2:172980521-172980543 GGAGCCAAGGGGGAGGAGCATGG + Intronic
942821728 2:180122882-180122904 AGGGACAATTGGGAGGAGAAAGG + Intergenic
942854187 2:180526159-180526181 AAGGCCCAGAGGCAGGAGCAAGG + Intergenic
942891273 2:180991815-180991837 AAGCCCAAGTGGATGGAGCAGGG + Intronic
943950639 2:194129475-194129497 AAGGCCATGTGGGAGGAGAAAGG - Intergenic
943965711 2:194328819-194328841 CAGGCCAAGTGGGAGGAACAAGG + Intergenic
944532492 2:200681038-200681060 AGGGGCAAGTGGGAGCAGAATGG + Intergenic
944628472 2:201597169-201597191 AAGGCCAAGTTTTAAGAGCAAGG - Intronic
945140653 2:206683157-206683179 AGAGCCAAGAGTTAGAAGCAAGG - Intronic
946067201 2:216998115-216998137 AGGGCCAAATGGTCAAAGCATGG - Intergenic
947341810 2:229148466-229148488 AGGGTGAAGAGGGAGGAGCAAGG + Intronic
947463265 2:230321341-230321363 AGGGCCAAGCGGTGGGAGCTTGG - Intergenic
948145352 2:235704123-235704145 AGGGCCAGGTGGGAGAAGCAGGG + Intronic
1169069189 20:2712010-2712032 AGGCCCAGGTGGCTGGAGCAAGG + Intronic
1171266785 20:23777514-23777536 GGGGCCCAGTGGGAGGTGCAGGG + Intergenic
1171284087 20:23923535-23923557 GGGGCCAAGTGGAAGGTGCAGGG + Intergenic
1171561823 20:26134027-26134049 GGGGCCAGGTGGTAGGAGCCTGG - Intergenic
1172430145 20:34883746-34883768 ATGGCCTAGTGGTACAAGCAAGG - Intronic
1172435846 20:34928494-34928516 AGGACTGAGTGGTAGGAGGAGGG - Exonic
1172502426 20:35436862-35436884 AGGGCAAAGTTGCAGAAGCATGG + Intronic
1172839977 20:37897057-37897079 TGGGCCAAGGGCTAGGAGCCAGG - Intergenic
1172897796 20:38312674-38312696 AGGGGCCAGGAGTAGGAGCAAGG + Intronic
1173817270 20:45997824-45997846 GGGGCCCAGAGGGAGGAGCAGGG + Intergenic
1174918505 20:54677689-54677711 AGAGCCAAGTGCCAGGATCAGGG - Intergenic
1176411866 21:6453550-6453572 AGGGGCACGGGGTAGGAGGAAGG + Intergenic
1176524788 21:7857918-7857940 TGGGCCAACTGGATGGAGCAAGG - Intergenic
1178658808 21:34487931-34487953 TGGGCCAACTGGATGGAGCAAGG - Intergenic
1179237531 21:39560697-39560719 AGGTCCCAGTGATAGGACCATGG + Intronic
1179312026 21:40205023-40205045 AGGGGGAAATGGAAGGAGCAAGG + Intronic
1179687360 21:43061872-43061894 AGGGGCACGGGGTAGGAGGAAGG + Intronic
1180711741 22:17843818-17843840 AGTGCCATGTGGTAGCAGCCTGG + Intronic
1181850072 22:25743583-25743605 AAGGCCAAGTGGGTGGAGGAGGG + Intronic
1182047268 22:27285031-27285053 AGGGAGATGTGGCAGGAGCATGG - Intergenic
1182439373 22:30353477-30353499 AGGGCCAGGTGGTGGCACCAAGG - Intronic
1182540292 22:31036451-31036473 AGGCCACTGTGGTAGGAGCATGG - Intergenic
1182557365 22:31136586-31136608 TGGGCCAAGGGGTAGGGGAAGGG - Intronic
1182745979 22:32605812-32605834 AGGGCAAGGTGGCAGCAGCATGG + Intronic
1182762286 22:32732500-32732522 AGAGTGAAGTGGTAGGACCATGG + Intronic
1182869354 22:33632619-33632641 GGGGCCAAGAGGTATGGGCAGGG - Intronic
1183325220 22:37187862-37187884 AGGTCCCAGTGGAAGCAGCAAGG - Intronic
1183618058 22:38956899-38956921 AGGGCCCAGAGGTGGGAGAAAGG + Intronic
1184254764 22:43280636-43280658 AGGGGAAGTTGGTAGGAGCATGG - Intronic
1184484044 22:44765535-44765557 AGGTCCAAGTGGTGGGAGTGAGG + Intronic
1185165977 22:49262441-49262463 ATGGCCCAGTGTGAGGAGCAAGG - Intergenic
1185250869 22:49801009-49801031 TGGGCCCAGTGGCAGGAGCTGGG - Intronic
949509153 3:4753419-4753441 ATGGCCAAGCGGTTAGAGCAGGG - Intronic
949512014 3:4774743-4774765 AGTGCCATGTGGCAGGAGCCTGG - Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
952543543 3:34395060-34395082 AGGCCCCAGTGGTGGAAGCATGG + Intergenic
954241594 3:49298120-49298142 AGGCCCAAGGGGGAGCAGCATGG + Intronic
954570961 3:51640580-51640602 AGAGCCAAGTGGCAGGAGCCTGG + Intronic
955521501 3:59779803-59779825 AGTGCTAAGTGCTGGGAGCATGG - Intronic
956209960 3:66792339-66792361 AGCACCATGTGCTAGGAGCATGG + Intergenic
960986707 3:123285747-123285769 TGGGCCTAGAGATAGGAGCAAGG - Intronic
961088922 3:124093150-124093172 ACGTCCAGGGGGTAGGAGCAAGG - Intronic
961658145 3:128454405-128454427 AGGCCCATGTGGCAGGAGCTTGG - Intergenic
961770911 3:129249456-129249478 AGGGGCAAGGGCTAGGTGCAGGG - Intergenic
962853117 3:139322668-139322690 AGGGCCAAGGGCTATTAGCAGGG + Intronic
964322482 3:155512613-155512635 AAAGCCATGTGGTAAGAGCACGG + Intronic
966549124 3:181184370-181184392 AGGGTCACGTGGTGGGAGGATGG + Intergenic
966743907 3:183257937-183257959 AGGGTGAAGTGGAGGGAGCAAGG - Intronic
967378062 3:188827680-188827702 AGAGCCAAATGGTGGGGGCAGGG + Intronic
967421482 3:189278118-189278140 AAGGGCATGTGGAAGGAGCATGG - Intronic
968103616 3:195985515-195985537 GAGGCCAAGTGGCTGGAGCACGG + Intergenic
968903847 4:3442955-3442977 AGGGCTGGGTGGGAGGAGCATGG + Intronic
971121144 4:23706304-23706326 AGGGGCAAGTAGTAGGAGTAAGG + Intergenic
972106824 4:35498081-35498103 AGGGCCAACAGGTAGGAAAAAGG - Intergenic
972599841 4:40562438-40562460 AGGGAGAAGTGGGAGGAGAAGGG - Intronic
973631454 4:52824562-52824584 AGGGCCAGGGGGAAGGAGCATGG - Intergenic
974385186 4:61195208-61195230 AGGGCCAAATAGTATGAACAAGG + Intergenic
975745923 4:77473681-77473703 AGAGCCAACAGGTAGGAGCAGGG - Intergenic
982825007 4:159993231-159993253 AGGGCCAGTTGGGAGTAGCAGGG - Intergenic
983077354 4:163343278-163343300 GTGGGCAAGTGGCAGGAGCAGGG - Intronic
984527545 4:180875390-180875412 AGGTCCAGGAGGTTGGAGCAGGG + Intergenic
984750041 4:183263399-183263421 AGACCCAAGTGTCAGGAGCAAGG - Intronic
985530177 5:429482-429504 AGGGCCAGGGGGCAGGGGCAGGG - Intronic
985976087 5:3420137-3420159 ATGGCCAGGTGGTGGGATCATGG + Intergenic
986287852 5:6373222-6373244 CTGGCCGAGTGGGAGGAGCAAGG - Intronic
988491403 5:31708374-31708396 GGGGCCACGTGGCAGGAGCCTGG + Intronic
992384828 5:76274642-76274664 AAGGCCAAGTAGTAGGTGGAGGG - Intronic
995374083 5:111453869-111453891 AGGGCCAAGAGCCAGGAGCCAGG - Intronic
996553026 5:124749400-124749422 AGGGCAAAGTGGTGGGGGGAGGG - Intergenic
996873256 5:128215429-128215451 AGGGCCAAGGGGTAGGAGGCAGG - Intergenic
997041497 5:130261128-130261150 AGGGACAAGTGGAAGCAGCTTGG - Intergenic
997898272 5:137739778-137739800 AGGGCCTAGTGGGAGGTGCTTGG + Intergenic
998098728 5:139414002-139414024 TGGGCAGAGTGGCAGGAGCATGG - Exonic
999182143 5:149677255-149677277 AGGACCCAGTGGGAGGATCAGGG - Intergenic
999470489 5:151850449-151850471 AAGGCCATGTGGGAGGAGAATGG + Intronic
999747127 5:154600889-154600911 AGGGAGAAGGGGCAGGAGCAGGG - Intergenic
1000065518 5:157690473-157690495 AAGGCCAAGAAGTAGGAGCTAGG - Intergenic
1001298807 5:170518739-170518761 AGGGCAAAGTGGTGGGTACAAGG - Intronic
1001927483 5:175649141-175649163 AGGGCCTAGTGGGAGGTGTATGG - Intergenic
1001993025 5:176133373-176133395 AGAGCAGAGCGGTAGGAGCAGGG + Intergenic
1002793511 6:452074-452096 ATGGCCAAGCTGTAGGCGCAAGG + Intergenic
1003243741 6:4367121-4367143 AGGGACAATGGGTAGCAGCAAGG + Intergenic
1005922982 6:30417343-30417365 AGGGCCATGTGGTGGGAACCTGG - Intergenic
1005960362 6:30689156-30689178 AGGGCCACGAGGGAGAAGCAGGG + Intronic
1007277502 6:40685970-40685992 AGGGCAAGGAGGTAGGAGGAAGG - Intergenic
1010764720 6:79765625-79765647 TGGGCCAAGTGGGCAGAGCAAGG + Intergenic
1011044050 6:83062457-83062479 AGGGCCTAGTGGGAGGTGCGTGG - Intronic
1016848747 6:148595054-148595076 AGGGCCAGCTGGCAGGAGGAGGG - Intergenic
1016973158 6:149784029-149784051 AGAGCAAAGTGGTAGGTGGAGGG + Intronic
1017439323 6:154448646-154448668 ATGGCCAAGTAGTCTGAGCACGG - Intronic
1018537240 6:164834153-164834175 GGAGCCAAGTGGTAAGTGCAGGG - Intergenic
1019706487 7:2499440-2499462 AGGGCCCTGTGGAAGGAGCCAGG + Intergenic
1019968623 7:4522352-4522374 ATGGAAAAGTGGTAGCAGCAGGG - Intergenic
1020552475 7:9624395-9624417 AGTGACAAGTGGTAGGATTAAGG + Intergenic
1021196679 7:17681637-17681659 AGGTCCAGGAGGTAGAAGCAAGG - Intergenic
1022720942 7:32941931-32941953 AGGGCCAGGGAATAGGAGCATGG - Intergenic
1024513197 7:50219191-50219213 AGGCCCAAGTGGTAAAATCAAGG - Intergenic
1024531854 7:50400142-50400164 TGGGCCGAGTGGTTGGAGCGCGG - Exonic
1025276051 7:57581666-57581688 GGGGCCTGGTGGTAGGAGCCTGG + Intergenic
1025950254 7:66139889-66139911 TGGGCCAGAGGGTAGGAGCAGGG - Intronic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1029248336 7:99218597-99218619 AGGAGGAAGTGGTAGGTGCAGGG - Intergenic
1029601486 7:101566015-101566037 AAGGCCCAGTGGTATGAGAAGGG + Intergenic
1030008008 7:105137455-105137477 AAGCTCAAGTGATAGGAGCACGG + Intronic
1030304854 7:108007059-108007081 AGGGCAATGAGGTTGGAGCAAGG - Intergenic
1030708087 7:112715820-112715842 AGGGGAATGTGGTAGCAGCAGGG + Intergenic
1032086443 7:128886418-128886440 AGGGCCAAGGGGCTGAAGCAAGG + Intronic
1032243589 7:130187510-130187532 AGGGACTAGGGGTAGGAGAAAGG - Intronic
1034350056 7:150409646-150409668 GGGGCCATGTGATAGGAGCTGGG + Intronic
1034398569 7:150846458-150846480 AGGGGCATGTGGTGGGGGCAGGG - Intronic
1036242671 8:7092697-7092719 AGGGGCATGTGGTGGGGGCAGGG + Intergenic
1036633425 8:10531252-10531274 AGGGGCAAGTGGAAGGGGAAGGG - Intronic
1039159037 8:34596087-34596109 AGAGCCAAGTGCTAGTAGCCAGG - Intergenic
1039244906 8:35598001-35598023 AAGGCCCTGGGGTAGGAGCATGG - Intronic
1039832025 8:41223069-41223091 AGAGCCAGGAGGCAGGAGCAGGG + Intergenic
1040985902 8:53294341-53294363 ATGGTCAAGGGGTAGGAGAAGGG - Intergenic
1041517821 8:58721195-58721217 ATGGCTTAGTGGAAGGAGCAAGG + Intergenic
1042324635 8:67515947-67515969 GGGGCCAAGTGGAAGAATCAGGG - Intronic
1043851407 8:85220510-85220532 AGAGCCAAGTCTAAGGAGCAAGG + Intergenic
1044651898 8:94504620-94504642 AGAGCCAAATGGTGGAAGCAAGG + Intronic
1049221156 8:141429527-141429549 AGGACCAGGTGGCGGGAGCAGGG + Intronic
1049371691 8:142271044-142271066 AGAGCCAAAGGGCAGGAGCAGGG - Intronic
1049462235 8:142735558-142735580 GGGGCCCAGTGGGTGGAGCAGGG - Exonic
1049539839 8:143203349-143203371 AGGGCCCAGTGGTCGGGGCCAGG + Intergenic
1049883979 9:15793-15815 GGGGCCAGCTGGCAGGAGCAGGG + Intergenic
1052862146 9:33443731-33443753 AGGGCCAAGGGCTGGGGGCAGGG + Intronic
1053046023 9:34917949-34917971 AAGGCCATGTGGGAGGAGAATGG + Intergenic
1054730809 9:68701249-68701271 AGGGCAATGTGGCAGGAGGATGG + Intergenic
1055848662 9:80598200-80598222 AAGGCCCTGTGGTAGAAGCATGG - Intergenic
1056343474 9:85664157-85664179 AGGGCCAAAGGGGAGAAGCAAGG + Intronic
1056587341 9:87937470-87937492 GGGGCCAGGTGGTAGGAGCCTGG - Intergenic
1056609536 9:88115473-88115495 GGGGCCAGGTGGTAGGAGCCTGG + Intergenic
1057832876 9:98420188-98420210 AGGGCCAGGTGGGGGGAGCTAGG - Intronic
1057934043 9:99221878-99221900 AGGGCCATGGCGGAGGAGCAGGG - Exonic
1059653002 9:116333058-116333080 AGGGCCAAGGGGGAGGACAAGGG + Intronic
1061449900 9:130662293-130662315 AGGACAAAGTGCTAGGAGCGAGG - Intergenic
1185433496 X:23463-23485 AGGGCCAGGTGGTGGCACCAAGG - Intergenic
1185442701 X:235531-235553 AGGGCCAGGTGGTGGCACCAAGG - Intergenic
1187279632 X:17847939-17847961 AGAGCTAAGTGGTAGGAAAATGG + Intronic
1190753183 X:53380005-53380027 AGGGCCAGGAGGTAGGGGGAAGG + Exonic
1190792816 X:53715849-53715871 ATGGCTAAGTGGTAGGACCAAGG - Intergenic
1192204932 X:69089453-69089475 AGGGCCAGTGGGCAGGAGCATGG - Intergenic
1194399828 X:93429808-93429830 AGGGCCAGGTGGTGGCACCAAGG - Intergenic
1195294623 X:103463689-103463711 GGGGCCAGGGGGTAGGAGTAGGG + Intergenic
1196408838 X:115394790-115394812 AGGGCCACGTGTTGGGAGGAGGG + Intergenic
1197415208 X:126165736-126165758 AGGGCCGGGAGGTAGGAGCGCGG - Exonic
1199815265 X:151391939-151391961 AGCGCCAAGTGGGCGGGGCAGGG - Intergenic
1200206095 X:154317462-154317484 AGGGCCAAGTGGTAGGAGCATGG + Intronic
1200374557 X:155766543-155766565 ATGGACAAGTGGCAGGAGCTTGG - Intergenic