ID: 1200206176

View in Genome Browser
Species Human (GRCh38)
Location X:154317888-154317910
Sequence GGAGCTCTGTGTGGGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 500}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200206160_1200206176 28 Left 1200206160 X:154317837-154317859 CCTCTTGAGATTGACAAGACTGG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1200206176 X:154317888-154317910 GGAGCTCTGTGTGGGCCTGGGGG 0: 1
1: 0
2: 4
3: 52
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200206176 Original CRISPR GGAGCTCTGTGTGGGCCTGG GGG Intronic
900186406 1:1335141-1335163 GAGACCCTGTGTGGGCCTGGCGG - Exonic
900368063 1:2319547-2319569 GGAGCCCCGTGAGCGCCTGGCGG - Intergenic
900401732 1:2475526-2475548 GGTGGGCTGTGTGGTCCTGGTGG + Intronic
900430315 1:2598285-2598307 GTAGTTCTGTATGGTCCTGGGGG + Exonic
900539513 1:3195884-3195906 TGGCCTCTGTATGGGCCTGGTGG + Intronic
900542388 1:3209710-3209732 GGGGCTCTGTGGGGGGCGGGAGG - Intronic
901062683 1:6479938-6479960 GGAGCTCTGTGCGAGGCTGCTGG - Intronic
901066904 1:6498564-6498586 GGAGCTCACAGGGGGCCTGGTGG + Intronic
901109759 1:6785408-6785430 GGAGCTGTGCGTGGGCCGCGGGG + Exonic
901669731 1:10849257-10849279 GGAGCTCTGCCTGGTCCGGGTGG - Intergenic
901671307 1:10857877-10857899 GGCCCTCACTGTGGGCCTGGTGG + Intergenic
901811902 1:11772145-11772167 TGTCCTCTGTGTGGCCCTGGTGG - Exonic
902217010 1:14940610-14940632 GGAGCTCTTTGTGAGGGTGGAGG + Intronic
902623225 1:17662507-17662529 AGAGCGCTCTGTGTGCCTGGAGG + Intronic
902807310 1:18869152-18869174 GGAGCTCTGGGTCAGCCTGGTGG + Intronic
903019084 1:20381095-20381117 GGACAGCTGGGTGGGCCTGGGGG - Intergenic
904055398 1:27666751-27666773 GGAGCCCTGTGTGGGTGTGGGGG + Intronic
904267114 1:29324476-29324498 GGAGCTCTGTGGGAGGCTGTGGG + Intronic
904575722 1:31503958-31503980 GGAGCCCTGCGTGGGGCTGACGG - Intergenic
904893692 1:33798479-33798501 GGAGGTGGGTCTGGGCCTGGCGG + Intronic
905630658 1:39516388-39516410 GGAGCTCTGGGAGGGCCTGACGG + Intronic
905667103 1:39769782-39769804 GGAGCTCTGGGAGGGCCTGACGG - Exonic
905973502 1:42157984-42158006 GCTGCTCTCTGTGGGCCTGGCGG + Intergenic
906073098 1:43031813-43031835 TGAGCTCTGTGAGTTCCTGGAGG + Intergenic
906109283 1:43312471-43312493 GGAGGGCAGTGCGGGCCTGGGGG - Exonic
906554729 1:46700020-46700042 GGAGGTCTGACTGGGGCTGGAGG - Intronic
907020163 1:51059431-51059453 GTGGCTCAGTGTGGGCCTGTAGG + Intergenic
910047214 1:82932257-82932279 TGAGCTCTGGGTGAGCCTGCTGG - Intergenic
911236607 1:95418976-95418998 GAAGCTCTTAGTGGGACTGGTGG + Intergenic
911240620 1:95461902-95461924 GGAGTTCTGTGTGGGGTGGGTGG + Intergenic
911497715 1:98651107-98651129 GTGGCTCAGTGTGGGCCTGAAGG - Intergenic
911546574 1:99224746-99224768 CAGGCTCTGTGTGGGCCTTGTGG + Intergenic
912044451 1:105437095-105437117 GCAGCTCTGTGCAGGCCTGCAGG + Intergenic
913336089 1:117710069-117710091 AGAGCTCAGTGTGGGATTGGAGG + Intergenic
913452322 1:119000707-119000729 GGAGCTCGGTGAGGACGTGGCGG - Intergenic
913971284 1:143420159-143420181 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
914065661 1:144245772-144245794 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
914113490 1:144720582-144720604 GCAGCTCTATGGAGGCCTGGCGG - Intergenic
914996213 1:152545610-152545632 GGCTCTCTGTGTTGGTCTGGAGG - Intronic
915589823 1:156864455-156864477 GGAGCTCAGCATGGGCCTGGGGG + Intronic
916721356 1:167486782-167486804 GCAGCTCTGGGTGGGCATGGTGG + Intronic
918392635 1:184082476-184082498 GGAGCTTTACCTGGGCCTGGAGG + Intergenic
919703055 1:200651435-200651457 GGAGCTCTGTGTGAGGATGCAGG + Intronic
919746249 1:201010793-201010815 ACAGCTCTGAGTGGGCCTTGGGG - Intronic
920382781 1:205545293-205545315 AGAGCCCTGGGTGGGCGTGGTGG - Intergenic
921404604 1:214765109-214765131 GGGGATTTCTGTGGGCCTGGGGG + Intergenic
922720302 1:227896847-227896869 GGGGCTCTGTGTGTCCCTGTGGG - Intergenic
923864674 1:237927105-237927127 TGAGCTGTGCGTGGCCCTGGAGG + Intergenic
924382073 1:243474492-243474514 GGAGGTCTGGGTGGGCAGGGAGG + Intronic
924694062 1:246381902-246381924 GGAGCCCGCGGTGGGCCTGGAGG - Intronic
1063498418 10:6531125-6531147 GCAGCTCTGGGTGGGGCTGCAGG - Intronic
1064272377 10:13877478-13877500 GGACCTCCGTGTAGGACTGGTGG - Intronic
1065069105 10:22003676-22003698 ACAGCTGTGTGTAGGCCTGGGGG - Exonic
1066568763 10:36748700-36748722 GGCGCACTGCGTGGGACTGGCGG + Intergenic
1067069843 10:43123617-43123639 AGGGCTCTGTGAGGGCCAGGTGG + Intronic
1067223156 10:44358366-44358388 GGAGGAAGGTGTGGGCCTGGTGG + Intergenic
1069740389 10:70683473-70683495 GGGGCAATGTGAGGGCCTGGAGG + Intronic
1069800089 10:71076602-71076624 AGAGCTCTGTGTGTAGCTGGAGG - Intergenic
1069883914 10:71611312-71611334 GGCCCTGTGTGTGGGCCTGAGGG + Intronic
1070681465 10:78452048-78452070 CCATCTCTGAGTGGGCCTGGGGG + Intergenic
1070793577 10:79203963-79203985 GGAGCTCTGGATGGCCCAGGGGG - Intronic
1070889388 10:79930746-79930768 GGAGCTCTGGGCAGGGCTGGAGG - Intergenic
1071166821 10:82816710-82816732 GTGGCTCAGTGTGGGCCTGCAGG - Intronic
1072482576 10:95823404-95823426 GGAGATCTGGGTGGGACAGGGGG + Intronic
1073845040 10:107544984-107545006 GCAGCTCAGCGTGGGCCTGCAGG + Intergenic
1073968664 10:109021213-109021235 GGAGTTGTGTGTGGCCCTTGGGG + Intergenic
1075173530 10:120138207-120138229 GGATCTCTTTGTGGGTGTGGAGG - Intergenic
1075395588 10:122124626-122124648 GGAGCTCCGTTTGGGTCTGGAGG - Intronic
1075551508 10:123395969-123395991 GGAGGTCTGTGTGGTCCCAGAGG - Intergenic
1076529451 10:131134867-131134889 GGAGCTGAGCGTGGGCCTGTTGG - Intronic
1076761663 10:132608851-132608873 GGCCCTCTGTGAGGGCATGGGGG + Intronic
1077030160 11:461901-461923 GGAGCCCCGTGTGTGCCTAGAGG + Intronic
1077174952 11:1184855-1184877 GGTGCTCTGAGTTGGGCTGGTGG - Intronic
1077175677 11:1189067-1189089 GGTGCTCTGAGTTGGGCTGGTGG - Intronic
1077310472 11:1886758-1886780 GCAGCTCTATGGAGGCCTGGCGG - Exonic
1077431751 11:2519073-2519095 GGTGCTGTGTGGGGGCCTGAGGG + Intronic
1077517188 11:3009032-3009054 AGAGGTCGGTGTGGGCCTGAGGG - Intronic
1078345577 11:10544910-10544932 GCAGCTCAGTGTGGGCCTGCAGG - Intergenic
1078619318 11:12892935-12892957 GCAGCTCTGTGTGGCCTGGGCGG + Intronic
1079078465 11:17397710-17397732 GGAGCTCTCTGCTGGCCTGGTGG - Exonic
1080243487 11:30154122-30154144 GGAGGTCTGTGTGGCCCAGAAGG + Intergenic
1081808206 11:45901266-45901288 GGAGCCCTGTGTGGGCATTGTGG + Intronic
1081870973 11:46382324-46382346 AGTGCGCTGAGTGGGCCTGGGGG + Exonic
1082800171 11:57408881-57408903 GAAACCCTGTGTGGGCCTAGGGG + Intronic
1083625972 11:64072152-64072174 GGAGCTGTGGCTGGGCCTGGGGG + Intronic
1084004660 11:66316622-66316644 CCAGCGCTGTGTGGCCCTGGAGG - Exonic
1084680354 11:70663047-70663069 GGGGCTGTGTGTGAGCCTCGGGG + Intronic
1084840699 11:71843955-71843977 GGGGCTGTGTGTGGCCCTTGTGG - Intergenic
1084857096 11:71996373-71996395 GGAGGTCTTTGTGGGCAGGGAGG - Exonic
1085496835 11:76978072-76978094 GCAGCTTGGTGTGGGCCTGCAGG + Intronic
1086268282 11:85028491-85028513 GCAGCTCGATGTGGGCCTGCAGG - Intronic
1087217587 11:95510853-95510875 GGAGCTCTGTGTATGCCTGTAGG + Intergenic
1089122357 11:116146281-116146303 GGAGGTCGGGGTGGACCTGGAGG - Intergenic
1089285985 11:117408483-117408505 GGGGGTCTGTGTGGACCTGATGG + Intronic
1089303395 11:117512269-117512291 GGAGAAGGGTGTGGGCCTGGGGG - Intronic
1089879708 11:121762080-121762102 GGAGCTCTGTGGGTGCAGGGAGG + Intergenic
1090390306 11:126383519-126383541 GAAGCTGTATGTGGGCATGGGGG + Intronic
1090840058 11:130479558-130479580 GGTGGTCTGTGTGGGGTTGGTGG - Intergenic
1091767735 12:3132884-3132906 GGAGCTCTGTGGCGGCCTCAGGG - Intronic
1092229900 12:6770467-6770489 GGAGGCCTCTCTGGGCCTGGAGG + Exonic
1092812869 12:12287802-12287824 GGAGAACTGTGTGAACCTGGAGG + Intergenic
1096138861 12:49225699-49225721 GGAGCACTGTGGGGCCTTGGTGG - Intronic
1096170173 12:49462356-49462378 TGAACTCTGTGTGGGCCCCGTGG + Intronic
1096547317 12:52349264-52349286 GGAGCACTGTGTTGTGCTGGAGG - Intergenic
1098463511 12:70760399-70760421 AAAGCTCTGGGTGGGCATGGTGG - Intronic
1098499174 12:71170658-71170680 GGAGCTCTATGTTGGCTGGGTGG + Intronic
1098671463 12:73235519-73235541 GCAGCTCAGTGTGAGCCTGCAGG - Intergenic
1098758008 12:74389563-74389585 GGAGGTCGGGGTGGACCTGGAGG + Intergenic
1101580925 12:106040314-106040336 GCAGCTCTGTATGGGCCTGCAGG - Intergenic
1102146494 12:110658646-110658668 GGGGCTCTGAGAGGTCCTGGGGG - Intronic
1102569072 12:113816320-113816342 CGAGCTGAGTGTGAGCCTGGTGG + Intergenic
1102594486 12:113982022-113982044 AGAGCCCTGGCTGGGCCTGGGGG + Intergenic
1103213893 12:119187108-119187130 GGAGCTCAGGGTGGGAGTGGAGG + Intronic
1103371859 12:120425272-120425294 TCACCTCTGGGTGGGCCTGGTGG - Intergenic
1104013346 12:124947316-124947338 TGAGCTCTGTGTTGACCTTGAGG - Exonic
1104686342 12:130787481-130787503 GGAGCTCTGTGACGGCCTGGGGG - Intergenic
1104718594 12:131032145-131032167 GGAGCCCTGTGTGCCCCTTGCGG - Intronic
1104913427 12:132251546-132251568 GGAGGGCGGTGTGGGCCCGGAGG - Intronic
1105926938 13:25017429-25017451 GCAGCTCTATGGAGGCCTGGCGG - Intergenic
1106178735 13:27352939-27352961 GGTGCTGTGTGTGCGTCTGGGGG + Intergenic
1106814166 13:33388460-33388482 GCAGCTCTGTGTGGATTTGGAGG + Intergenic
1107708368 13:43128924-43128946 GGAGCTCTCTGAGGGTTTGGTGG + Intergenic
1108704563 13:52973571-52973593 GCAGCCCTGTGTGTGACTGGAGG - Intergenic
1109124854 13:58505403-58505425 GGTGCACAGTGTGGGACTGGTGG - Intergenic
1109687752 13:65843675-65843697 GCAGCTTCGTGTGGGCCTGCAGG + Intergenic
1110777959 13:79432349-79432371 GCAGCTCTGCATGGGCCTGTAGG + Intergenic
1111091455 13:83452733-83452755 GCAGCTCAGTGTGGGCTTGCAGG + Intergenic
1111292502 13:86187063-86187085 GGAGGTCTGGGTGTACCTGGAGG - Intergenic
1111916361 13:94364760-94364782 GCAGCTGTGTGTGGGGGTGGGGG + Intronic
1112554148 13:100451448-100451470 GCAGCTCTGTGTGGCCCTTAAGG - Intronic
1113318944 13:109213439-109213461 GGAGCACTGGGAGGGCCTCGTGG + Intergenic
1113636465 13:111922275-111922297 CGAGCTCTCTGTGTCCCTGGGGG - Intergenic
1113741708 13:112716017-112716039 CTGGCTCTGTGGGGGCCTGGGGG + Intronic
1114139709 14:19895652-19895674 GGCTCTCTGTGTTGGTCTGGAGG + Intergenic
1114179621 14:20354787-20354809 TGATCTCTGGGTGGGCCTGCAGG + Exonic
1114664345 14:24369198-24369220 GGAGCTGGGGCTGGGCCTGGAGG - Intronic
1115203312 14:30875359-30875381 GGGGCTGTGGGTGGGCCTGGAGG - Intronic
1116019260 14:39441346-39441368 GCAGCTTGGTGTGGGCCTGTGGG + Intergenic
1116448578 14:45039499-45039521 GCAGCTTGGTGTGGGCCTGCAGG - Intronic
1116621837 14:47214164-47214186 TGAGATTTGTGTGGGCATGGGGG + Intronic
1118899200 14:69972613-69972635 GGAGCTGTGTTTGGGCCTCTGGG + Intronic
1121426098 14:93853231-93853253 GGAGCTATGTGTTAGGCTGGTGG - Intergenic
1121586336 14:95065468-95065490 GCGGCTCTGTCTGGCCCTGGGGG + Intergenic
1121685408 14:95831794-95831816 GGAGCTCTGGGACAGCCTGGGGG + Intergenic
1122127705 14:99588057-99588079 GGAGGCCTGTGCAGGCCTGGGGG - Intronic
1122307791 14:100776674-100776696 GAACCTGTGTGTGGGCCGGGGGG - Intergenic
1122788999 14:104176567-104176589 GGAGCCAAGTGTGGGGCTGGGGG - Exonic
1122791661 14:104186416-104186438 GGGGCTCTGTGTGAGCCTCAGGG - Intergenic
1122978180 14:105179566-105179588 GGTGCCCTCTGTGGCCCTGGTGG - Intronic
1123500632 15:20878121-20878143 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123594106 15:21889095-21889117 TGAGCTCTGGGTGCGCCCGGCGG + Intergenic
1123918489 15:25054469-25054491 GCTGCTCTGTGATGGCCTGGTGG + Intergenic
1124484630 15:30103707-30103729 GGAGCTATGTGGCGGCCTGCGGG - Intergenic
1124497548 15:30195807-30195829 GGAGCTGTGTGGCGGCCTGGGGG - Intergenic
1124518951 15:30393531-30393553 GGAGCTATGTGGCGGCCTGCGGG + Exonic
1124539705 15:30572715-30572737 GGAGCTATGTGGCGGCCTGCGGG - Intergenic
1124746041 15:32342884-32342906 GGAGCTGTGTGGCGGCCTGGGGG + Intergenic
1124758947 15:32434867-32434889 GGAGCTATGTGGCGGCCTGCGGG + Intergenic
1124973789 15:34514944-34514966 GGAGCTGTGTGGCGGCCTGGGGG + Intergenic
1125685170 15:41559444-41559466 GGAGCCCGGGGCGGGCCTGGCGG + Intronic
1125792122 15:42374889-42374911 GGATCACTGTTTGGGCCTGGGGG - Intronic
1127120359 15:55766525-55766547 GGAGGCCTGACTGGGCCTGGAGG + Intergenic
1129227376 15:74177933-74177955 GGTGCTGTATGTGGACCTGGAGG - Intergenic
1131650163 15:94389307-94389329 GGAGCTCAGGGTGGGCATGGAGG + Intronic
1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1132553312 16:562033-562055 AGGGCTCTGTGTGAGCCTGTGGG + Intronic
1132624957 16:887292-887314 TGTGCTCTGTGTGAGCCTTGCGG + Intronic
1132898397 16:2239575-2239597 GGAGTTCTGTGTGGGTCATGGGG + Exonic
1132939837 16:2501190-2501212 CCAGCTCTGGGTGGGGCTGGGGG - Exonic
1133303184 16:4795446-4795468 GGAGGTAGGTGGGGGCCTGGGGG + Intronic
1134042477 16:11079067-11079089 GTAGCTGTGTGTGGGGCTGCAGG - Intronic
1136340823 16:29642025-29642047 GATTCTCAGTGTGGGCCTGGAGG - Intergenic
1136480525 16:30538955-30538977 GGAGATCTGTGTGGGTTGGGGGG + Intronic
1138349165 16:56337366-56337388 GGAGCAGTGTGTGGGGCTGATGG + Intronic
1139062048 16:63264068-63264090 GGGACTCTGTGTGTGCCTGATGG + Intergenic
1139150934 16:64381258-64381280 GCAGCTCAGTGTGGGCCTGCAGG + Intergenic
1139380178 16:66525612-66525634 GGAGCACTGTGGCTGCCTGGAGG - Intronic
1139650283 16:68358937-68358959 GGAGGTGTGCGGGGGCCTGGGGG + Exonic
1141166683 16:81665509-81665531 GCAGCTGTGGGTGGTCCTGGTGG + Intronic
1141817987 16:86425924-86425946 GGAGTTCTATGTGGTCCTTGGGG - Intergenic
1142201270 16:88762200-88762222 TGAGCTCTGGGTGGGCCGGGAGG - Intronic
1142255820 16:89013448-89013470 GAAGCTCTGTGGGGACCAGGAGG + Intergenic
1142481913 17:224263-224285 GGAGCCCAGTGTGGTCCTGGGGG - Intronic
1143502337 17:7346817-7346839 GGCGCTCTGAGTCAGCCTGGAGG - Exonic
1144584183 17:16477929-16477951 GGAGCTGTGGGTGGGAGTGGCGG + Intronic
1144666205 17:17103980-17104002 GGAACTCTGTGTGTCCCTGGTGG + Intronic
1144849278 17:18235846-18235868 AGAGCCCAGCGTGGGCCTGGCGG + Intronic
1145035993 17:19541062-19541084 TGGGCTGTGTGTGAGCCTGGTGG + Intronic
1146425273 17:32732145-32732167 GCAGCTTGGTGTGGGCCTGGAGG + Intronic
1146934910 17:36807496-36807518 GGAGACCAGTGGGGGCCTGGAGG - Intergenic
1147412037 17:40260528-40260550 GCTGCTCTGTGTTTGCCTGGAGG - Exonic
1147650139 17:42057336-42057358 GATCCTCTGTGTGGGGCTGGGGG + Intronic
1147720306 17:42536041-42536063 GGCGCTCTGTGAGGGCCAGCGGG + Intergenic
1148733188 17:49850345-49850367 GGAGCTCAGTGGGAGGCTGGGGG - Intergenic
1149480159 17:56996804-56996826 AGAGCTTTGGCTGGGCCTGGTGG - Intronic
1149568391 17:57655063-57655085 GGAGGTCTGGGGGGGCCTTGAGG + Intronic
1149636019 17:58170069-58170091 TCAGCTCTGGGTGGGGCTGGTGG + Exonic
1149819902 17:59766215-59766237 TGTGCTCTGGCTGGGCCTGGTGG + Intronic
1150197544 17:63316425-63316447 GGATCTCTCTATGAGCCTGGGGG + Intronic
1150332875 17:64308543-64308565 GGAGCTCTTTGAGTGCCTGAGGG + Intergenic
1150493740 17:65592117-65592139 GGAGCACTGTGTTGCCCTGGTGG + Intronic
1151314201 17:73311822-73311844 GGTGCCCTGGGTGGGCTTGGGGG - Intronic
1151668605 17:75559257-75559279 GGTGATCTGTGTGGCACTGGGGG - Exonic
1151696384 17:75720311-75720333 GGAGCCCTGGCTGGGCATGGTGG + Intergenic
1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG + Intergenic
1152148437 17:78583579-78583601 GGAACTCTGGCTGGGCGTGGTGG + Intergenic
1152410236 17:80119402-80119424 GCAGCTGTGTGCGGGCCTGGGGG + Intergenic
1152577551 17:81149481-81149503 GGAGGCCTGTGAGGGGCTGGAGG - Intronic
1152619076 17:81352351-81352373 GGAGTTCCGCGTGGGCTTGGCGG - Intergenic
1152827991 17:82479513-82479535 GGAGTTCTGGGAGGACCTGGGGG - Intronic
1152841381 17:82570942-82570964 GGGGCTCTTCGTGGGCCAGGGGG + Intronic
1152851622 17:82639866-82639888 CGAGCTGTGTGTGGGTCGGGAGG + Intronic
1153227764 18:2910948-2910970 GGAGGTCTGTGGGGCCCAGGAGG - Intronic
1153299739 18:3582191-3582213 GTAGTTCTGGGTGGGACTGGAGG + Exonic
1155215729 18:23641582-23641604 GCAGCTAGGTGTGGGCCTGTAGG + Intronic
1155470402 18:26185952-26185974 GGAGCTCTGGATGGGCATGGTGG + Intronic
1156370152 18:36465757-36465779 GAGGCTGTGTGTGGGCGTGGTGG + Intronic
1157555358 18:48609954-48609976 GGAGCTGGGAGTGGGGCTGGAGG + Intronic
1158570988 18:58596909-58596931 GGAGAACTGGTTGGGCCTGGGGG - Intronic
1158696654 18:59709775-59709797 GGAGCTCTGTGAGGGACCGTTGG + Intergenic
1158706354 18:59795834-59795856 CGGGCACTCTGTGGGCCTGGAGG + Intergenic
1160049729 18:75421580-75421602 GGAGCTCTGTGGGGTCAGGGTGG + Intronic
1160055318 18:75473149-75473171 TGACCTCTGAGTGGACCTGGAGG - Intergenic
1160163285 18:76491428-76491450 GGGGGTCTGTGCGGGCCGGGGGG - Intronic
1160432995 18:78825076-78825098 GGAGATCTGTTTGGGAATGGGGG - Intergenic
1160658616 19:287901-287923 GGAGGTCTGTGTGGGGCCGGGGG - Intronic
1160676198 19:392635-392657 GCAGCTCTCTCTGGGCCTGCAGG + Intergenic
1160738492 19:675479-675501 CGACATCTGCGTGGGCCTGGAGG - Intergenic
1160787463 19:907668-907690 GCAGGTCCTTGTGGGCCTGGAGG - Intronic
1160810678 19:1011683-1011705 GGCGCCCGGTGAGGGCCTGGAGG + Intronic
1161030662 19:2056433-2056455 GGAGCTCAGGGTTGCCCTGGGGG + Intergenic
1161591217 19:5129945-5129967 GGCGCTCTGTGTCGGGCTGTGGG - Intronic
1161680695 19:5678373-5678395 GGAGCACAGGGTTGGCCTGGTGG - Intronic
1161798435 19:6401377-6401399 GGAGCTCTCTGAGGGCAGGGAGG + Intergenic
1162158156 19:8693996-8694018 GGGGGTGTGTGTGGGCATGGAGG + Intergenic
1162398351 19:10430770-10430792 GGCGGCCTGCGTGGGCCTGGCGG + Intronic
1162418017 19:10549810-10549832 GGAGTTCTGAGTGTGCCTGCTGG + Intronic
1162438906 19:10680740-10680762 GGAGCCATGTGGGGGCCTGCAGG - Intronic
1162529402 19:11227357-11227379 GGTGGGCTCTGTGGGCCTGGAGG - Exonic
1162754218 19:12847553-12847575 GGGGCTCTCTGCGGGCTTGGAGG + Intronic
1162818623 19:13210067-13210089 GGAGCTCTGGGTGGGGGTGGGGG + Intronic
1163034884 19:14564600-14564622 AGGGCTCTGTGAGGGCGTGGTGG - Intronic
1163323664 19:16589131-16589153 TGGGCTCTGTGTGGAGCTGGAGG + Intronic
1163424686 19:17235063-17235085 GGAGCCCAGTGGGGGCCTGAGGG + Intronic
1163570852 19:18081451-18081473 GGAGATCAGTCTGGGACTGGAGG + Intronic
1163782699 19:19258637-19258659 GGAGCCCTGCGGCGGCCTGGGGG - Exonic
1163829685 19:19541715-19541737 GGGTGTCTGTGTGGGCGTGGGGG - Intronic
1164423219 19:28116097-28116119 GGAGCTCTGAGTGCACTTGGAGG + Intergenic
1165144037 19:33720161-33720183 GAGGGACTGTGTGGGCCTGGTGG + Intronic
1165773185 19:38389919-38389941 GGAGCACTGGGTGGGGCTGTGGG + Intronic
1165804500 19:38572335-38572357 GGAGCACTGGCTGGGGCTGGGGG + Intronic
1166007028 19:39915104-39915126 GGAGTTCTGGATGGGCCTGAGGG - Intronic
1166181873 19:41114427-41114449 GCAGCTCTGGGTGTGCTTGGGGG - Exonic
1166713062 19:44949301-44949323 GGAGCTCAGTCTGAACCTGGGGG - Exonic
1166782899 19:45351616-45351638 GCAGCTCTGAGTGGGGCGGGTGG - Exonic
1167116967 19:47493982-47494004 GGAGCTCTGGGTGTGCCTGGGGG - Intronic
1167269531 19:48499340-48499362 GGACCTCGGAGGGGGCCTGGGGG + Exonic
1168199426 19:54804209-54804231 TGAGCTCTGTGTGGCCCAGGCGG + Intronic
1168206464 19:54853766-54853788 GGGGCCCTGGGTGGGCCAGGAGG - Exonic
1168296012 19:55377618-55377640 GGAGAGCTGTGGGGGCCAGGCGG + Exonic
1168412235 19:56147199-56147221 GGAGCTCTGGGTGAGCCTGGCGG + Exonic
925275076 2:2643078-2643100 CGAGTCCTGTGTCGGCCTGGTGG - Intergenic
925778239 2:7355937-7355959 CGGGCTCTGTGTGGGGCAGGTGG + Intergenic
925898113 2:8488667-8488689 GGAGCTTCGTGTGAGGCTGGAGG + Intergenic
925918936 2:8626119-8626141 GGAGCGCTGGGTGGGACCGGAGG + Intergenic
926893600 2:17660166-17660188 GGAGCCCTGTGCTGGCGTGGAGG - Intergenic
928637846 2:33266317-33266339 GTAGCTCAGTGTGGGCTTGCAGG + Intronic
928688631 2:33775734-33775756 GGCGCGCTGCGTGGGACTGGTGG + Intergenic
930024568 2:47022235-47022257 GGAGCTGTGGCTGGGCCTTGAGG - Intronic
931057007 2:58483506-58483528 GGAACGCAGTGAGGGCCTGGAGG - Intergenic
932447246 2:71788400-71788422 GGAGCTTCCTGTGGGGCTGGCGG + Intergenic
932478441 2:72023869-72023891 GCAGCTCAGTGAGGGTCTGGAGG - Intergenic
932644678 2:73488202-73488224 GCAGCTCAGAGTGGGCCTGCAGG - Intronic
932977784 2:76625112-76625134 GGAGCCCTGGGAGGGGCTGGTGG + Intergenic
933641792 2:84770035-84770057 TGGGCTCTGTGTGTGCCTTGGGG - Intronic
933900007 2:86842882-86842904 GGGGCTCTGGGTGGTCGTGGGGG - Intronic
934054570 2:88241080-88241102 GGAGACCTGTGTGGTCCTGCCGG - Intergenic
934175979 2:89581092-89581114 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
934286289 2:91655454-91655476 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
935583794 2:104783011-104783033 TGAGCTCTGTGAGGGGCTGGGGG + Intergenic
935623142 2:105145802-105145824 GGAGCCCTGGCTGGGCGTGGTGG - Intergenic
935780552 2:106506343-106506365 GGGGCTCTGGGTGGTCGTGGGGG + Intergenic
937298348 2:120823337-120823359 GGAGTTGTGTGTGGGGCTGGGGG + Intronic
937640597 2:124206548-124206570 GGAGGTCTGAGTGGGCCAGTGGG + Intronic
937799153 2:126060991-126061013 GCAGCTCTGTGTCTGCCTGAAGG + Intergenic
938086629 2:128406182-128406204 GGTGCTCTGTGTAGTCCTAGAGG + Intergenic
938124624 2:128663055-128663077 GGAGCTTCCTGAGGGCCTGGAGG - Intergenic
938262243 2:129904217-129904239 GGAGCCCTGTGGCAGCCTGGAGG - Intergenic
938779811 2:134575035-134575057 GGGGCTCTGTGGGGGGGTGGGGG + Intronic
939010766 2:136843626-136843648 TGAGCTCAGTGTGGTACTGGTGG + Intronic
940398751 2:153222621-153222643 GCAGCTCAGTGTGAGCCTGCAGG - Intergenic
941309216 2:163909543-163909565 GGGGCTGTGTGTGGGGCTTGCGG + Intergenic
941998840 2:171626727-171626749 GCAGCTCGGTGTGGGCCTGCAGG + Intergenic
942697778 2:178665105-178665127 AGAGCTCTGTGAGGTTCTGGAGG - Intronic
943226480 2:185185260-185185282 GCAGCTCAGTGTGGGCCTGCAGG + Intergenic
946235760 2:218323507-218323529 GGAGCTGGGGGTGGGCGTGGCGG + Intronic
947588848 2:231373136-231373158 GGAGTTCAGAGAGGGCCTGGTGG - Intronic
947770837 2:232668919-232668941 GGAGCACTGGCTGGGCGTGGTGG - Intronic
948434496 2:237943969-237943991 GCAGCTCAGTGAGGGCCTGCAGG + Intergenic
948504005 2:238415623-238415645 GGGGCTCTGTGTGGGGCTTGTGG + Intergenic
948768075 2:240233583-240233605 GGTGCTGTGGGTGGGGCTGGAGG - Intergenic
948886764 2:240888684-240888706 GGAGCACAGGGTGGGCCGGGTGG - Intronic
948953182 2:241268420-241268442 TGGGCTGTGTGTGGACCTGGGGG - Intronic
949035652 2:241814701-241814723 GGGGCTCTGTGTGGGTGTAGTGG + Intronic
1169122113 20:3102933-3102955 GGAGGCCTGCGTGGTCCTGGTGG - Intergenic
1169142149 20:3232785-3232807 GGAGCCCAGTGTCGGGCTGGGGG + Intronic
1169146176 20:3254003-3254025 GGAGCTCTGGGAGGTCCTAGTGG + Intronic
1169193919 20:3673481-3673503 GGAGCTCCGAGTGGTCCTGGGGG + Exonic
1170327821 20:15176192-15176214 GCAGCTTAGTGTGGGCCTGCAGG + Intronic
1170804654 20:19618976-19618998 GGAGCTCTGGGCTGCCCTGGTGG - Intronic
1170916264 20:20628955-20628977 GGAGCTCTCTGAGGAGCTGGAGG - Intronic
1171296636 20:24022782-24022804 TGACATCTGTGTGGGCCTTGGGG - Intergenic
1171767984 20:29300668-29300690 GGCGCCCCGCGTGGGCCTGGTGG - Intergenic
1171810685 20:29742894-29742916 GGCGCCCCGTATGGGCCTGGTGG - Intergenic
1172006152 20:31820185-31820207 GGAGCTTTCTTTGGGTCTGGGGG - Exonic
1172563420 20:35909307-35909329 GTAGCTCTGTGAGGGACAGGGGG + Intronic
1172592426 20:36127228-36127250 AGAGCCCTGTCTGGGTCTGGCGG + Intronic
1172933299 20:38601175-38601197 GGAGCTCTGTAGGGGCCCTGGGG - Intergenic
1173429591 20:42974510-42974532 GAAGCTCTGTGTGTGTCTGTGGG - Intronic
1174450356 20:50616289-50616311 GAAGCTACTTGTGGGCCTGGTGG - Intronic
1174693294 20:52531305-52531327 GGAATTCTGTGTTGTCCTGGGGG + Intergenic
1174906528 20:54557702-54557724 CGAGCTCTGTGGGTACCTGGGGG - Intronic
1175144478 20:56885262-56885284 GGAGCTATGGCTGGGCTTGGTGG + Intergenic
1175191187 20:57213087-57213109 CGAGCTCTGTCTGGGGCAGGAGG - Intronic
1175903808 20:62370231-62370253 GCAGCTGAGTGTGGGCGTGGGGG - Intergenic
1176104540 20:63379727-63379749 GCAGGTCAGTGTGGGCCTGCAGG + Intergenic
1176122187 20:63458876-63458898 GGGGGCCTGTGTGGGTCTGGGGG + Intronic
1179168939 21:38957873-38957895 GGAGCTCTGTGGTTACCTGGGGG + Intergenic
1179819049 21:43925778-43925800 AGAGCTCTGTGTGGGAATGTGGG - Intronic
1179886492 21:44316336-44316358 GGACGTGCGTGTGGGCCTGGGGG + Exonic
1180011611 21:45055010-45055032 GGAGCTCAGGGTGGCCCTGCGGG + Intergenic
1180089999 21:45529102-45529124 AGAGCCCAGTGTGGGCCTCGGGG + Intronic
1180099441 21:45577745-45577767 TGGGCTCTGAGTTGGCCTGGGGG + Intergenic
1180157819 21:45986595-45986617 GGAACCCTGTGGGGGGCTGGAGG + Exonic
1180194359 21:46184040-46184062 GGAGCACTGGGTGGCCCTGAGGG + Intronic
1180208643 21:46279787-46279809 GTGGGTCTGTGTGGGGCTGGTGG - Intronic
1181036579 22:20172542-20172564 GGAGCTCTGGGAAGGCGTGGGGG + Intergenic
1182062699 22:27409175-27409197 GAAGGTCTGTGCAGGCCTGGAGG - Intergenic
1182084894 22:27554767-27554789 GAAGCTCATTGTGTGCCTGGGGG + Intergenic
1182085082 22:27555887-27555909 GCAGCCCTGTGAGGACCTGGGGG + Intergenic
1182279434 22:29209293-29209315 GGAGGCCTCTGGGGGCCTGGAGG + Intronic
1182527696 22:30931706-30931728 GGAGGGCTGTGGTGGCCTGGGGG - Intronic
1182655625 22:31887533-31887555 GGGTCTCTGTGTGGGCCTTAGGG + Intronic
1183314024 22:37127492-37127514 GGAGCTCTGAGTGGCTCAGGAGG + Exonic
1183503954 22:38198626-38198648 GGAGCTCAGGCTGGGCATGGTGG - Intronic
1183733831 22:39632568-39632590 TGAGCTCTGTGTGTGTGTGGGGG + Intronic
1184042458 22:41952202-41952224 GGGGCTCTGAGTGGGCCAGGAGG - Intergenic
1184091779 22:42296665-42296687 GGAGCCCTGTTTGGGGGTGGGGG - Intronic
1184355493 22:43976891-43976913 GGTGGGCTGGGTGGGCCTGGGGG + Intronic
1184741389 22:46430752-46430774 GGAGCAGTGTGGGGGCCTGGAGG - Intronic
1185075699 22:48680928-48680950 GGAGCGCAGGTTGGGCCTGGGGG - Intronic
949361608 3:3238051-3238073 GTAGCTCTCTGTGGCCCAGGGGG - Intergenic
950520119 3:13493164-13493186 GGAGCTGTGGGTGGGGCAGGTGG - Intronic
952076369 3:29701924-29701946 GGCCCTCGGTGTGGGACTGGTGG + Intronic
953371751 3:42394351-42394373 GGAGCTCTGTGTGGGGATATAGG + Intergenic
953372880 3:42405383-42405405 GGAACTCTGTGGGAACCTGGTGG - Intronic
954420088 3:50414212-50414234 TGGGCTCTGTGTGGGCCTGTGGG - Intronic
955416846 3:58700183-58700205 GGAGATTTGTTTGGGGCTGGAGG + Intergenic
957048606 3:75395214-75395236 GCAGCTCTATGGAGGCCTGGTGG - Intergenic
957219086 3:77359273-77359295 GCATCTCTGTGTGGGCTTAGAGG + Intronic
957775920 3:84757126-84757148 GCAGCTCGATGTGGGCCTGCAGG - Intergenic
958195274 3:90235557-90235579 GCAGCTCAGTGTTGGCCTGCAGG + Intergenic
958584511 3:96069209-96069231 GCAGCTCAGTGTGGGCCTGCAGG - Intergenic
959037434 3:101383744-101383766 GCAGCTCAGTGTGGGCCTGCAGG + Intronic
959252500 3:103966050-103966072 ACAGCTCAGTGTGGGCCTGCAGG + Intergenic
960046518 3:113204019-113204041 GAAGCTCTCTGTGGACCTGCAGG - Intergenic
961440809 3:126952231-126952253 GGAGTGCTCTGTGGGCATGGGGG + Intronic
961480210 3:127174670-127174692 GGCACTCTGTGTGCTCCTGGTGG - Intergenic
962343321 3:134602701-134602723 CAGGCTCTGTGAGGGCCTGGAGG + Intronic
962351329 3:134658458-134658480 GAAGCTCTTTGAGGGCCAGGGGG + Intronic
962505738 3:136045132-136045154 GGAGCCCTGGGAGGGGCTGGTGG - Intronic
965710112 3:171548556-171548578 AGAACTCTGGGTGGGCGTGGTGG - Intergenic
966686029 3:182696735-182696757 GGAACTCTGTGGATGCCTGGTGG - Intergenic
967566859 3:190983280-190983302 GTGTCTTTGTGTGGGCCTGGGGG - Intergenic
967988294 3:195112632-195112654 GGAGCTGCGTGTGTGCATGGGGG - Intronic
968135170 3:196215557-196215579 GGGGCTCTGTTGGGGCATGGTGG - Intronic
968432583 4:567470-567492 GGAGTTCTTGGTGGGCCTGGAGG + Intergenic
968490210 4:886072-886094 TGAGTTCTGGTTGGGCCTGGAGG - Intronic
968705390 4:2075214-2075236 GGCGCTCTCTGAGGGGCTGGTGG + Intronic
968816388 4:2823890-2823912 GGAGCTCTGTGCCAGCATGGGGG - Intronic
969048653 4:4356861-4356883 AGAGCTCTGTGTGGGGGTGAGGG - Intronic
969174079 4:5385821-5385843 GGAGCTGTGGGTGGGACTGTGGG - Intronic
969292919 4:6252227-6252249 GGAGCTCTGCCTGGGGCAGGAGG - Intergenic
969317685 4:6391751-6391773 GAAGCCCTGGGTGGGGCTGGAGG + Intronic
969656850 4:8503637-8503659 GGAACCCTGTGTGGGCATCGGGG - Intergenic
969781796 4:9409948-9409970 GGGGCTGTGTGTGGCCCTTGTGG - Intergenic
970325561 4:14920078-14920100 AGAGCTCTGTCTGGGCCTCCAGG + Intergenic
972682088 4:41315895-41315917 GCACCTCTGGGTGGGCCTGCAGG + Intergenic
974420112 4:61662556-61662578 GTAGCTCAGCGTGGGCCTGCAGG + Intronic
976213453 4:82693753-82693775 GGACCTCTGTGTCCGTCTGGGGG - Intronic
976662505 4:87554454-87554476 GAAGCTCTGTTGGGGCGTGGTGG + Intergenic
977561757 4:98540000-98540022 GGAGCTTTGTCTGGGGCTGCAGG - Intronic
980009449 4:127579689-127579711 GGAGCCCTGGGAGGGGCTGGCGG - Intergenic
980082731 4:128361743-128361765 GGAGCTCTATGTTTTCCTGGTGG + Intergenic
980133971 4:128842801-128842823 AGAGCTCTGTGAGAGCCAGGAGG + Intronic
981889245 4:149716185-149716207 GCAGCTCGGTGTGGGACTGGAGG - Intergenic
982758404 4:159251309-159251331 GGAGTGCAGTGTGGGACTGGTGG + Intronic
982918917 4:161249886-161249908 GCGGCTCAGTGTGGGCCTGCAGG - Intergenic
983191804 4:164762083-164762105 TGAGCTCTGTGTGAGCTTTGGGG - Intergenic
983547591 4:168979500-168979522 GCAGCTCTGTGTTTGCCTGGTGG + Intronic
983835325 4:172377512-172377534 GGCGCACTGAGTGGGACTGGTGG - Intronic
984763735 4:183383966-183383988 GCAGCTCAGTGTGGACCTGCAGG + Intergenic
985337907 4:188915742-188915764 GAGGCTGTGTGTGGGCCTGCAGG - Intergenic
985534004 5:452903-452925 GGAGCTCTGTGGGGGTGAGGAGG + Intronic
985547413 5:516695-516717 AGAGCTCTGTGTGGGGCAGATGG + Intronic
986221859 5:5775535-5775557 GGCAGTCTGTGTGGGCCTGGAGG + Intergenic
987188653 5:15450963-15450985 GGAGCTGTGCATGGCCCTGGAGG + Intergenic
988263888 5:28926842-28926864 GCAGCTCTATGGAGGCCTGGCGG - Intergenic
988643351 5:33066367-33066389 GGAGCTTTAACTGGGCCTGGAGG + Intergenic
988814363 5:34818959-34818981 GCAGCTCTGTGTGGACATGCTGG - Intronic
990260555 5:54017408-54017430 GGAGCTGTATTTGGGACTGGAGG - Intronic
990682080 5:58256240-58256262 GGAGTTGTGTGTGGGACAGGAGG - Intergenic
990870808 5:60430130-60430152 GGAGCTCTTTGAGTGCCTGAGGG + Intronic
991039708 5:62162729-62162751 GCAGCTCAGTGTGGGCCTGCAGG - Intergenic
991504392 5:67308923-67308945 CCAGCTGTGTGTGGCCCTGGAGG - Intergenic
991547209 5:67795732-67795754 GGGGCTATGTGAGGCCCTGGGGG + Intergenic
992130020 5:73682753-73682775 AGAGCTCTGGCTGGGCATGGTGG + Intronic
992259640 5:74956902-74956924 AGAGCTCTGGCTGGGCCCGGTGG + Intergenic
992304538 5:75422524-75422546 GGAGGACTGCTTGGGCCTGGGGG + Intronic
992681487 5:79157770-79157792 AGTGCTCTGTGTGGGTGTGGTGG - Intronic
993395200 5:87377750-87377772 GGTGGTGTGTGTGGGCCAGGGGG - Intronic
993713208 5:91248600-91248622 GGAGCTGTTTGTGGGTTTGGAGG - Intergenic
994096412 5:95851552-95851574 GGTGCACGGTGTGGGACTGGCGG + Intergenic
994673173 5:102787264-102787286 GAAGAGCTGTGTGGGTCTGGCGG - Intronic
994891267 5:105639610-105639632 GCAGCTCTGCGTGGGTCTGCAGG + Intergenic
995386570 5:111595872-111595894 GTGGCTCTGTGTGGGCCTGCAGG + Intergenic
995518293 5:112975976-112975998 GCAGGTGTGTGTGGGCCTGTGGG + Intergenic
998390455 5:141783994-141784016 GGGGCTGTGTGTGTGTCTGGGGG - Intergenic
999192406 5:149758065-149758087 AGCGCTCTGTGTGGGTTTGGAGG - Intronic
999269764 5:150289952-150289974 GCAAGCCTGTGTGGGCCTGGGGG + Intronic
999410009 5:151342439-151342461 GGAGATGTGTGTTGGCTTGGGGG - Intronic
1000019830 5:157309637-157309659 AGGCCTCTGTGTGTGCCTGGGGG - Intronic
1001079849 5:168659714-168659736 GGTGCTCTGGCTGGGCGTGGTGG + Intergenic
1002278301 5:178116863-178116885 TAAGCCCTGTGTGGCCCTGGGGG - Intronic
1002312081 5:178320854-178320876 GGGGCCTTCTGTGGGCCTGGAGG + Intronic
1002640705 5:180629370-180629392 AGAGTTCTGTGTGGGTCTGCTGG + Exonic
1002664238 5:180810760-180810782 CGAGCTCTGTGTAGCCGTGGTGG + Intronic
1005251525 6:23951485-23951507 GGAGCACTGTCAGGGCTTGGAGG - Intergenic
1006955446 6:37866159-37866181 GGAGCTCTGTTTGTCCCAGGTGG + Intronic
1007181474 6:39932187-39932209 AGAGCCCTGTGTGGGCGTGTTGG + Intronic
1007985705 6:46205251-46205273 CGAGCTGTGCGTGGCCCTGGAGG + Intergenic
1008315148 6:50030527-50030549 GGAGCCCTGGGAGGGACTGGCGG - Intergenic
1011057621 6:83222904-83222926 TGAGCTCTGTCTGGGCCTTGAGG - Intronic
1012531688 6:100245407-100245429 GGAGCCTTGAGTGGACCTGGTGG - Intergenic
1013794836 6:113875452-113875474 GGAGATCTGTGTGTGCAGGGTGG + Intergenic
1014060732 6:117068935-117068957 GGAAATCTGGGTGGGCATGGTGG + Intergenic
1014525246 6:122494912-122494934 GGCTCTCTGTATTGGCCTGGAGG - Intronic
1016482341 6:144495451-144495473 GGAGTTCCGGGTGGGCTTGGCGG - Intronic
1017406780 6:154127876-154127898 AGAGCACTGGGTGAGCCTGGGGG - Intronic
1018103812 6:160464825-160464847 GGAGCTCTGTTAGGAACTGGGGG - Intergenic
1018272903 6:162099913-162099935 GGGGCTGTGTGTGGGCGGGGAGG - Intronic
1018468900 6:164079516-164079538 GGGGTTCTGTGTGGCCATGGAGG - Intergenic
1018735866 6:166686815-166686837 GGAGCTCTGTGCATACCTGGTGG + Intronic
1019192652 6:170262197-170262219 GGCGCTCTGGGAAGGCCTGGAGG - Intergenic
1020187585 7:5970718-5970740 AGAGCACAGGGTGGGCCTGGCGG - Intergenic
1020295332 7:6754052-6754074 AGAGCACAGGGTGGGCCTGGCGG + Intergenic
1020989024 7:15172400-15172422 GGCCCTCTCTGTGGGACTGGAGG - Intergenic
1021928312 7:25554262-25554284 AGACCTCTGTGAGGGCCAGGAGG - Intergenic
1022339821 7:29457388-29457410 GGAGCTCTGAGACGGCCTGGGGG - Intronic
1023526229 7:41106674-41106696 GGAGCTATGGCTGGGCATGGTGG - Intergenic
1024053700 7:45646191-45646213 AGAGCTGACTGTGGGCCTGGAGG + Intronic
1024527994 7:50365122-50365144 GGAGCTCTGTGGATGCCAGGTGG - Intronic
1026804551 7:73421882-73421904 GGGCCTGGGTGTGGGCCTGGGGG - Intergenic
1027270325 7:76515281-76515303 GGAGCCCTGAGGGGGCCTGTGGG - Exonic
1027995756 7:85423785-85423807 GCAGCTCAGGGTGGGCCTGCAGG + Intergenic
1028936377 7:96468914-96468936 GCAGCTCTTGCTGGGCCTGGTGG - Intergenic
1029379782 7:100205389-100205411 GGTGCTGTGTGTGGGTATGGGGG + Intronic
1029456521 7:100674863-100674885 GAGGCTTTGTGCGGGCCTGGGGG + Intronic
1029559328 7:101292011-101292033 GGGGCTTTGTGTGGGGTTGGAGG + Intergenic
1029707321 7:102282800-102282822 GGAGCTCGCTGTGGGGCTGAGGG - Intronic
1030107066 7:105996286-105996308 GGAGCTCTGTGGAGGCTTTGAGG - Exonic
1030243762 7:107359400-107359422 GCAGCTCAGTGAGGGCCTGCAGG + Intronic
1030386878 7:108876267-108876289 GGAGGTCAGGGTGGACCTGGAGG - Intergenic
1031859061 7:126957721-126957743 GTGGCTCAGTGTGGGCCTGCAGG + Intronic
1032225929 7:130031843-130031865 GGAGCTCTGTGTGTGGTGGGGGG - Intronic
1032385515 7:131520258-131520280 GGATCTCTGTGAGTGCCTGAGGG - Intronic
1032599982 7:133283360-133283382 GGAAATCTGTTTGGGCATGGTGG - Intronic
1033100366 7:138464432-138464454 GGAGAACTGTGTGAGCCTTGGGG + Intronic
1033602227 7:142896709-142896731 GGAGGTGTGTGTGTGCCCGGTGG + Intergenic
1033681582 7:143600748-143600770 GGAGCTCTGGGTGCCCCTGAGGG + Intergenic
1033703310 7:143861065-143861087 GGAGCTCTGGGTGCCCCTGAGGG - Intronic
1034465181 7:151223808-151223830 GGAGCTCTACGAGCGCCTGGAGG - Exonic
1034900916 7:154907286-154907308 GGCGCCCTGCGTGGGACTGGCGG + Intergenic
1035575943 8:705238-705260 GGCGCTCTGTGAGGGACAGGAGG - Intronic
1037877240 8:22554201-22554223 GGAGCTCCGGGTGGGAGTGGGGG - Intronic
1038219607 8:25594787-25594809 GGAGCAGTGTGTGGGGGTGGTGG + Intergenic
1038428518 8:27481237-27481259 GCTGCTCTGTGTGGCCCTGCGGG - Intergenic
1038540602 8:28386699-28386721 GGAGCTCGGCTGGGGCCTGGGGG + Intronic
1039076440 8:33694144-33694166 CGAACTCTGTGTGGGCCCTGCGG - Intergenic
1039914390 8:41849019-41849041 GGTGCCCTGTCTGGCCCTGGAGG - Intronic
1040523611 8:48198735-48198757 GCAGCCCTGTGTGGGGCTTGGGG + Intergenic
1040806769 8:51404798-51404820 GGCGCACTGCGTGGGACTGGTGG - Intronic
1043615055 8:82114979-82115001 GGAGCTGTATCTGGGCCTGCTGG + Intergenic
1044423319 8:92023844-92023866 GGTGCTATGTCTGGGCCTGTTGG - Intronic
1044717209 8:95111626-95111648 GCAGGTGTGTGTGTGCCTGGAGG - Intronic
1045063194 8:98425735-98425757 GGTGCTCTGTGTAGCTCTGGAGG - Intronic
1047066195 8:121286354-121286376 TGAGCCCTGTGTGGGCAGGGAGG - Intergenic
1047897760 8:129385436-129385458 AGAGCTATGTGTGGAGCTGGAGG - Intergenic
1047977079 8:130141372-130141394 GGAGCTCTCCGAGGGCCTGCAGG - Intronic
1048286724 8:133147379-133147401 GGAGCCATGCCTGGGCCTGGAGG - Intergenic
1048327083 8:133448237-133448259 GGAGCTGGGTGTGCTCCTGGTGG - Intergenic
1048485555 8:134844348-134844370 GGAGCTGTGTGAGGGGGTGGTGG - Intergenic
1048974437 8:139663012-139663034 GGGGCACTTTGTGGGGCTGGAGG - Intronic
1049140455 8:140949686-140949708 GTGGCTCAGTGTGGGCCTGCAGG + Intronic
1049318264 8:141981194-141981216 AGAGCTCAGTGCGGGGCTGGAGG + Intergenic
1049425729 8:142537142-142537164 GGGGCACGGTGAGGGCCTGGAGG - Intronic
1049816174 8:144603215-144603237 GTACCTGTGTGTGTGCCTGGAGG + Intronic
1051398462 9:16653552-16653574 GGAGCACTCTGGGGGCCTGGCGG + Intronic
1052840745 9:33289466-33289488 GGGACTGTGTGTGGGTCTGGGGG + Intergenic
1053715380 9:40883646-40883668 GCAGCTCTATGGAGGCCTGGTGG - Intergenic
1054077167 9:60547088-60547110 GCAGCTCTATGGAGGCCTGGTGG + Intergenic
1055706973 9:79016174-79016196 GGAGCTTTGTGTGGTGCTGCAGG + Intergenic
1057091108 9:92258760-92258782 GGAGCTCTGTGTGAGACTTTAGG - Intronic
1057795835 9:98157428-98157450 AGAGAGCTGTTTGGGCCTGGGGG + Intronic
1058106418 9:100976694-100976716 GGAGATCTTTCTGGGGCTGGTGG - Intergenic
1059342007 9:113602553-113602575 GGTGCTCTGTGGGGGTGTGGGGG + Intergenic
1059992366 9:119877274-119877296 GGAGCTCTCTGAAGGCCTTGTGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060822490 9:126669515-126669537 GGGCATCCGTGTGGGCCTGGGGG + Intronic
1060865176 9:126989588-126989610 GGTGGTCTGGGTGGGCCTGCTGG + Intronic
1061059991 9:128245378-128245400 GGTCGTCTGTGTGGGCCTCGGGG - Intronic
1062030433 9:134359713-134359735 GGAGCCACGTGTGGCCCTGGCGG + Intronic
1062104617 9:134746846-134746868 TGACCTGTGTGTGGGCCTGCTGG + Intronic
1062129870 9:134886437-134886459 CGAGCTCCGTGTAGACCTGGTGG + Exonic
1062133180 9:134911238-134911260 CGAGCTCCGTGTAGACCTGGTGG - Exonic
1062479652 9:136745407-136745429 GGGGCTCTGGGTGTGCTTGGAGG - Intronic
1062578913 9:137221251-137221273 GGGGCGTTGTGTGGGGCTGGGGG + Exonic
1203768053 EBV:36672-36694 GGGGCTGTTTGTGGGCCTTGTGG - Intergenic
1185763678 X:2707641-2707663 GGAGCTTTGAGAGGGCCGGGTGG + Intronic
1186223693 X:7375501-7375523 GCAGCTCTGTGTGGGCCTGCAGG - Intergenic
1186853768 X:13606205-13606227 AGAGCTGTGTGTGTGCCTGGGGG + Intronic
1187697046 X:21933294-21933316 GCAGCTCTGCCTGGGCCAGGGGG + Intergenic
1188440306 X:30209521-30209543 GGATCTCCTTGTAGGCCTGGAGG - Intergenic
1188811304 X:34656921-34656943 GGCGCTGTGTCTGGACCTGGGGG - Exonic
1190713964 X:53088597-53088619 GCGGCTACGTGTGGGCCTGGGGG - Intergenic
1191881770 X:65849615-65849637 GTAGCCCTGAGTGGTCCTGGAGG + Intergenic
1192459071 X:71301897-71301919 GGGGCTCTGTGTGGGTGTTGGGG + Intronic
1193258706 X:79380080-79380102 AAAACTCTGTGTGTGCCTGGGGG - Intergenic
1193888800 X:87017381-87017403 GGAGCCCTGGGAGGGACTGGTGG - Intergenic
1193960100 X:87914631-87914653 GGTGCTATATGGGGGCCTGGGGG - Intergenic
1194615866 X:96103105-96103127 CGAACTCTGTGTGGGCCCCGCGG + Intergenic
1195108704 X:101624215-101624237 AGAGGTCGGTGTGGGCGTGGGGG + Exonic
1195150223 X:102060286-102060308 GTAGCTCTGTTAGGGGCTGGTGG + Intergenic
1195752766 X:108174570-108174592 GGAGCTCCAGGTAGGCCTGGTGG + Exonic
1196098477 X:111824552-111824574 AGAGCTCAGTTTGGGCCTAGAGG + Intronic
1198245550 X:134827834-134827856 AGAACTCTGTGTGGGTCTTGAGG - Intronic
1198341195 X:135714410-135714432 GGAGCTCTGTGTCAGCCATGAGG + Intronic
1198344047 X:135741841-135741863 GGAGCTCTGTGTCAGCCATGAGG + Intergenic
1199353428 X:146832056-146832078 TGGGCTCTGTGTGGGGCTTGTGG - Intergenic
1199600574 X:149539339-149539361 GGAGCTGTGGGTGGAGCTGGGGG - Intergenic
1200206176 X:154317888-154317910 GGAGCTCTGTGTGGGCCTGGGGG + Intronic
1200397207 X:155998281-155998303 GGAGCTGTGTGTGGGGCAGCAGG + Intronic
1200972139 Y:9163977-9163999 GCAGCTTGGTATGGGCCTGGAGG + Intergenic
1201077126 Y:10196722-10196744 GGCGCCCCGCGTGGGCCTGGTGG + Intergenic
1202380295 Y:24271040-24271062 GGAGCCCTGTGTTGGACTGCTGG + Intergenic
1202490488 Y:25399085-25399107 GGAGCCCTGTGTTGGACTGCTGG - Intergenic