ID: 1200208055

View in Genome Browser
Species Human (GRCh38)
Location X:154332240-154332262
Sequence AGGGCGAGGGGACTGGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200208055_1200208064 19 Left 1200208055 X:154332240-154332262 CCTCTGGCCAGTCCCCTCGCCCT No data
Right 1200208064 X:154332282-154332304 ATTGCTCTGATTACTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200208055 Original CRISPR AGGGCGAGGGGACTGGCCAG AGG (reversed) Intergenic
No off target data available for this crispr