ID: 1200209700

View in Genome Browser
Species Human (GRCh38)
Location X:154341761-154341783
Sequence GCCCGCCGCTGCCGGGGCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200209700_1200209708 16 Left 1200209700 X:154341761-154341783 CCGACGCCCCGGCAGCGGCGGGC No data
Right 1200209708 X:154341800-154341822 GGACGTTTGTCGCCCCTTCTCGG No data
1200209700_1200209709 17 Left 1200209700 X:154341761-154341783 CCGACGCCCCGGCAGCGGCGGGC No data
Right 1200209709 X:154341801-154341823 GACGTTTGTCGCCCCTTCTCGGG No data
1200209700_1200209705 -5 Left 1200209700 X:154341761-154341783 CCGACGCCCCGGCAGCGGCGGGC No data
Right 1200209705 X:154341779-154341801 CGGGCAGGTGCCACGACCTCTGG No data
1200209700_1200209710 22 Left 1200209700 X:154341761-154341783 CCGACGCCCCGGCAGCGGCGGGC No data
Right 1200209710 X:154341806-154341828 TTGTCGCCCCTTCTCGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200209700 Original CRISPR GCCCGCCGCTGCCGGGGCGT CGG (reversed) Intergenic