ID: 1200210549

View in Genome Browser
Species Human (GRCh38)
Location X:154345045-154345067
Sequence GCTGTTCTTCCCGCGGGATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200210549_1200210569 25 Left 1200210549 X:154345045-154345067 CCCGATCCCGCGGGAAGAACAGC No data
Right 1200210569 X:154345093-154345115 GGGGGCCTCGGGGGCCTGGACGG No data
1200210549_1200210558 5 Left 1200210549 X:154345045-154345067 CCCGATCCCGCGGGAAGAACAGC No data
Right 1200210558 X:154345073-154345095 GGGCCGGCTCTCCCTGCTATGGG No data
1200210549_1200210559 6 Left 1200210549 X:154345045-154345067 CCCGATCCCGCGGGAAGAACAGC No data
Right 1200210559 X:154345074-154345096 GGCCGGCTCTCCCTGCTATGGGG No data
1200210549_1200210568 21 Left 1200210549 X:154345045-154345067 CCCGATCCCGCGGGAAGAACAGC No data
Right 1200210568 X:154345089-154345111 CTATGGGGGCCTCGGGGGCCTGG No data
1200210549_1200210560 7 Left 1200210549 X:154345045-154345067 CCCGATCCCGCGGGAAGAACAGC No data
Right 1200210560 X:154345075-154345097 GCCGGCTCTCCCTGCTATGGGGG No data
1200210549_1200210563 14 Left 1200210549 X:154345045-154345067 CCCGATCCCGCGGGAAGAACAGC No data
Right 1200210563 X:154345082-154345104 CTCCCTGCTATGGGGGCCTCGGG No data
1200210549_1200210557 4 Left 1200210549 X:154345045-154345067 CCCGATCCCGCGGGAAGAACAGC No data
Right 1200210557 X:154345072-154345094 AGGGCCGGCTCTCCCTGCTATGG No data
1200210549_1200210570 26 Left 1200210549 X:154345045-154345067 CCCGATCCCGCGGGAAGAACAGC No data
Right 1200210570 X:154345094-154345116 GGGGCCTCGGGGGCCTGGACGGG No data
1200210549_1200210571 27 Left 1200210549 X:154345045-154345067 CCCGATCCCGCGGGAAGAACAGC No data
Right 1200210571 X:154345095-154345117 GGGCCTCGGGGGCCTGGACGGGG No data
1200210549_1200210566 16 Left 1200210549 X:154345045-154345067 CCCGATCCCGCGGGAAGAACAGC No data
Right 1200210566 X:154345084-154345106 CCCTGCTATGGGGGCCTCGGGGG No data
1200210549_1200210564 15 Left 1200210549 X:154345045-154345067 CCCGATCCCGCGGGAAGAACAGC No data
Right 1200210564 X:154345083-154345105 TCCCTGCTATGGGGGCCTCGGGG No data
1200210549_1200210562 13 Left 1200210549 X:154345045-154345067 CCCGATCCCGCGGGAAGAACAGC No data
Right 1200210562 X:154345081-154345103 TCTCCCTGCTATGGGGGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200210549 Original CRISPR GCTGTTCTTCCCGCGGGATC GGG (reversed) Intergenic
No off target data available for this crispr