ID: 1200214986

View in Genome Browser
Species Human (GRCh38)
Location X:154364243-154364265
Sequence AGTCCAGGTAGAGCACCCAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200214986_1200214989 -9 Left 1200214986 X:154364243-154364265 CCCGTGGGTGCTCTACCTGGACT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214986_1200214995 11 Left 1200214986 X:154364243-154364265 CCCGTGGGTGCTCTACCTGGACT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1200214995 X:154364277-154364299 TGGGGCCTTGCCACCGTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 215
1200214986_1200214991 -8 Left 1200214986 X:154364243-154364265 CCCGTGGGTGCTCTACCTGGACT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214986_1200214992 -7 Left 1200214986 X:154364243-154364265 CCCGTGGGTGCTCTACCTGGACT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1200214992 X:154364259-154364281 CTGGACTTGGACCCGAAGTGGGG 0: 1
1: 1
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200214986 Original CRISPR AGTCCAGGTAGAGCACCCAC GGG (reversed) Exonic
900753792 1:4418941-4418963 TGTCCTGGTAGAGAACCCAAGGG - Intergenic
901302716 1:8211250-8211272 AGCCCAGGTGGAGCAGCCTCGGG + Intergenic
905239987 1:36575328-36575350 AGACAAGCTAGAGAACCCACAGG - Intergenic
906200113 1:43954466-43954488 AGTCCAGATAGAACTCCCTCTGG + Intronic
911536419 1:99105963-99105985 AGTGCGGGTAGAGCACCAACTGG + Intergenic
915620990 1:157084044-157084066 AGACCAGGCAGGGCAACCACAGG - Intergenic
916890923 1:169111664-169111686 ATTGCAGGCAGAGCTCCCACGGG + Intronic
919086460 1:192926414-192926436 ATTCCAGACAGAGCACACACTGG - Intergenic
1067727073 10:48778506-48778528 AGCCCAGGTGCAGCACCTACTGG - Intronic
1069928240 10:71865873-71865895 AGTCCAGGAACAGCTCCCGCTGG - Intergenic
1074369718 10:112890178-112890200 AGGCCAGGAAGAGCAGCCAATGG - Intergenic
1075859018 10:125657737-125657759 AGTCCAGGAATGGCACCTACAGG + Intronic
1078334131 11:10450758-10450780 CGCCCAGGTAGGGCACCGACGGG + Exonic
1079437720 11:20474517-20474539 AGTCCTGGCAGAGCAGCCGCTGG - Intronic
1090396166 11:126420037-126420059 AGTCCACTTAGCCCACCCACGGG - Intronic
1096389838 12:51219439-51219461 AGTCCAGGGAGAGAAACTACAGG - Intergenic
1102182184 12:110920940-110920962 ATTCCAGGTAGAGGGCACACAGG - Intergenic
1104833500 12:131771409-131771431 ACTCCAGTGAGTGCACCCACGGG + Intronic
1105324009 13:19353796-19353818 AGTCTGTGTAGAGCACCCCCTGG + Intergenic
1112278724 13:98044411-98044433 GCTCCAGGTAGAGCACTCCCAGG - Intergenic
1114624474 14:24119843-24119865 TGTCCAGCCAGTGCACCCACAGG - Exonic
1114968936 14:28001699-28001721 AGTGCAGGTAGAGCACAAAGTGG + Intergenic
1115256979 14:31413473-31413495 AGTCCAATTAGGGCTCCCACTGG - Intronic
1119774273 14:77238874-77238896 AGTCCAGGGAGAGCCACCCCGGG - Intronic
1123150889 14:106180775-106180797 TCTCCAGATAGACCACCCACAGG - Intergenic
1123399306 15:19968632-19968654 TCTCCAGATAGACCACCCACGGG - Intergenic
1129186747 15:73911898-73911920 ACTCCAGGTAGAGCGTCCAAGGG - Intergenic
1129906006 15:79187618-79187640 ATTCCAGCTGGAGCACCCATTGG - Intergenic
1130779182 15:87016899-87016921 AGTCCCTGCAGAGCAGCCACTGG + Intronic
1131558182 15:93417374-93417396 AGGCCAGGCCGAGCTCCCACAGG + Intergenic
1132376303 15:101330349-101330371 AGTCCAGGTGCAGCCTCCACTGG + Intronic
1134043266 16:11083886-11083908 ATTCCGGGTAGAACACACACAGG - Intronic
1136046378 16:27618346-27618368 AGTGCAGGTGCAGCACACACCGG - Intronic
1138715889 16:59021629-59021651 AGTCCATGTACAGCAGCCTCTGG + Intergenic
1140950473 16:79812284-79812306 AGTCCAGAGGGAGCTCCCACAGG + Intergenic
1145999512 17:29122832-29122854 GGTCCGGGTAGAGCACCCTCTGG - Intronic
1146260082 17:31415263-31415285 TGTCCACGTAGAGCGCCCCCTGG - Intronic
1146966307 17:37033958-37033980 ACTCCAGGTAGAGCAAGCAAGGG + Intronic
1152233256 17:79125451-79125473 AGGCCGGGTAGAGAACACACTGG - Intronic
1153831855 18:8930737-8930759 AGCTCAGGTATATCACCCACAGG + Intergenic
1160818977 19:1049354-1049376 AGTCCAGGCTGAGCCCCCGCAGG - Exonic
1163258962 19:16175182-16175204 AGGCCAGGTAGAGAAAACACAGG - Intergenic
1164170242 19:22718599-22718621 AGCCCTGGTCCAGCACCCACGGG - Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1167676868 19:50892725-50892747 ACTCCAGGTACAGAACCCATGGG - Intergenic
929969688 2:46563459-46563481 AGGCCGGGAAGAGCCCCCACGGG + Intronic
933821335 2:86114997-86115019 TGGCCATGTAGACCACCCACTGG + Intronic
935898995 2:107770514-107770536 AGTCCAGCTGTAGCACCCAGTGG + Intergenic
936976923 2:118229840-118229862 AGTCCAGGCAGAGAAGCCACTGG - Intergenic
937100001 2:119261312-119261334 AGTCCATGCAGACCACCCAGAGG + Intronic
939051977 2:137318293-137318315 AGTCCAGGTTTAACAACCACAGG + Intronic
948535567 2:238643960-238643982 AATCCAGGTAGAAAATCCACTGG + Intergenic
1171348297 20:24483518-24483540 AGTACAGGAAGAGCAAACACTGG - Intronic
1173178504 20:40783696-40783718 AGACAAGGTTGGGCACCCACTGG - Intergenic
1175367158 20:58463699-58463721 AGTCCAGGCAGGACAGCCACAGG + Intronic
1180697001 22:17757904-17757926 AGACCAAGTAGAGAACCCATAGG - Intronic
1181871058 22:25899689-25899711 GGTTCAGCCAGAGCACCCACAGG - Intronic
1183684591 22:39354420-39354442 TATCCAGGCAGAGAACCCACAGG - Intronic
949508469 3:4748069-4748091 AGCCCAGATAGAGTACCTACTGG - Intronic
950223206 3:11212479-11212501 AATCCAGGTAGAGGACCCACTGG + Intronic
950488733 3:13289383-13289405 ACTCCAGGTTGAGCCCTCACGGG - Intergenic
954643401 3:52115761-52115783 AGTCCAAGCAAAGCACCAACGGG - Intronic
961819122 3:129566307-129566329 AGGCCAGGTAGAGCAGACAGAGG - Intronic
962433575 3:135344234-135344256 AGTCAAGGTAAAGAACCAACAGG + Intergenic
965133073 3:164726214-164726236 GGTCCAGGTAGAGAGGCCACTGG - Intergenic
966897435 3:184456372-184456394 AGTCCAGGTTGGGCACCGTCAGG + Intronic
973872921 4:55184752-55184774 AGCCCAGGTGTTGCACCCACAGG - Intergenic
976149092 4:82075287-82075309 AATCCAGGTTGAGTTCCCACTGG + Intergenic
979224269 4:118265976-118265998 GGTCCAGGTACAGGATCCACTGG + Intergenic
985664691 5:1175918-1175940 ACTCCAGGTACAGAACCCAGAGG - Intergenic
988744720 5:34123118-34123140 GGTCCAGGCAGAGAACCCACAGG + Intronic
990566487 5:57034758-57034780 AGGCCAGGTAGAGCAGAGACTGG - Intergenic
997843648 5:137265697-137265719 AGTCCAGATAGAGCCTCCAAAGG + Intronic
1000656530 5:163885957-163885979 AGTACAGGCAAAGTACCCACAGG - Intergenic
1004767099 6:18741805-18741827 AGTCTAGGCAGAGCACTGACTGG - Intergenic
1006258897 6:32852677-32852699 AGTTCTGGTAGAGCAACCACAGG - Intronic
1007151836 6:39701256-39701278 AGTCCTGGTCCAGCCCCCACGGG + Intronic
1015382886 6:132589566-132589588 AGGCCAGGTAGATGACCAACTGG + Exonic
1016987286 6:149904996-149905018 AGTCCATGTGCAGCACCCAGAGG - Intergenic
1017989115 6:159470927-159470949 AGTCCTTGGAGAGCATCCACAGG - Intergenic
1018656452 6:166041537-166041559 AGGCCAGTAAGAGCCCCCACCGG - Intergenic
1019144636 6:169968908-169968930 AGTCCAGGGACAGTGCCCACGGG - Intergenic
1019812879 7:3177320-3177342 ATTCCTGGTAGAGGAACCACAGG - Intergenic
1022476797 7:30716321-30716343 AGTGCAGGCTGAGCACTCACAGG + Intronic
1022772609 7:33490653-33490675 AGTACAAATTGAGCACCCACTGG - Intronic
1023226161 7:37971291-37971313 AGTCCAGGAAGACCACCCTTTGG - Intronic
1024542916 7:50493436-50493458 GGACCAGGCAGAGCATCCACAGG - Intronic
1034936383 7:155203271-155203293 AGGCCAGGAAATGCACCCACAGG - Intergenic
1036761198 8:11509581-11509603 AGACCCGGCAGAGCACCCCCAGG - Intronic
1039859831 8:41447554-41447576 AGTTCAGGTAGAGCTGCCAGGGG + Intergenic
1040543425 8:48379572-48379594 AGGCCAGACAGAGCACCTACCGG - Intergenic
1044527590 8:93269113-93269135 AGCCCAGGTAGAGGAGGCACAGG - Intergenic
1055212328 9:73811749-73811771 AATCTAGGTAGAGCACCCATAGG - Intergenic
1057310780 9:93941772-93941794 AGTCCAGTGAGAGAACACACAGG + Intergenic
1061208905 9:129179428-129179450 GGTCCAGATAGAGCGCCCCCAGG - Intergenic
1187424370 X:19163888-19163910 AGTCCGGGTAGAGCAAAAACAGG - Intergenic
1200153789 X:153964562-153964584 ACTCCAGGTAAAGCAGCCCCAGG - Exonic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic