ID: 1200214989

View in Genome Browser
Species Human (GRCh38)
Location X:154364257-154364279
Sequence ACCTGGACTTGGACCCGAAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 79}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200214971_1200214989 29 Left 1200214971 X:154364205-154364227 CCCAGGCCTGGGTGCCCACACCT 0: 1
1: 0
2: 5
3: 59
4: 631
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214980_1200214989 4 Left 1200214980 X:154364230-154364252 CCTGCCCCCAACACCCGTGGGTG 0: 1
1: 0
2: 1
3: 15
4: 220
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214975_1200214989 14 Left 1200214975 X:154364220-154364242 CCACACCTGCCCTGCCCCCAACA 0: 1
1: 0
2: 9
3: 139
4: 1102
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214987_1200214989 -10 Left 1200214987 X:154364244-154364266 CCGTGGGTGCTCTACCTGGACTT 0: 1
1: 0
2: 1
3: 10
4: 118
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214984_1200214989 -3 Left 1200214984 X:154364237-154364259 CCAACACCCGTGGGTGCTCTACC 0: 1
1: 0
2: 1
3: 6
4: 65
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214983_1200214989 -2 Left 1200214983 X:154364236-154364258 CCCAACACCCGTGGGTGCTCTAC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214986_1200214989 -9 Left 1200214986 X:154364243-154364265 CCCGTGGGTGCTCTACCTGGACT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214982_1200214989 -1 Left 1200214982 X:154364235-154364257 CCCCAACACCCGTGGGTGCTCTA 0: 1
1: 0
2: 1
3: 5
4: 47
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214979_1200214989 5 Left 1200214979 X:154364229-154364251 CCCTGCCCCCAACACCCGTGGGT 0: 1
1: 0
2: 0
3: 17
4: 209
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214976_1200214989 9 Left 1200214976 X:154364225-154364247 CCTGCCCTGCCCCCAACACCCGT 0: 1
1: 0
2: 4
3: 59
4: 630
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214972_1200214989 28 Left 1200214972 X:154364206-154364228 CCAGGCCTGGGTGCCCACACCTG 0: 1
1: 0
2: 24
3: 930
4: 19348
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214973_1200214989 23 Left 1200214973 X:154364211-154364233 CCTGGGTGCCCACACCTGCCCTG 0: 1
1: 0
2: 3
3: 74
4: 555
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214981_1200214989 0 Left 1200214981 X:154364234-154364256 CCCCCAACACCCGTGGGTGCTCT 0: 1
1: 0
2: 1
3: 11
4: 112
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79
1200214974_1200214989 15 Left 1200214974 X:154364219-154364241 CCCACACCTGCCCTGCCCCCAAC 0: 1
1: 0
2: 11
3: 96
4: 946
Right 1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200214989 Original CRISPR ACCTGGACTTGGACCCGAAG TGG Exonic
907318494 1:53587982-53588004 ACCTGAACTTGGGCCAGAACTGG + Intronic
915033177 1:152901599-152901621 CCCCAGACTTGGACCCTAAGCGG + Intergenic
923671930 1:236048660-236048682 ACCTGCACTTGGACCTGGAGGGG + Intronic
1064278833 10:13932404-13932426 ACCTGGAGTTTGTCCAGAAGGGG - Intronic
1070819702 10:79347694-79347716 ACCTGGACGTGGACGCCAACGGG + Exonic
1070862537 10:79684316-79684338 AGCAGGACCTGGACCCGCAGAGG + Intergenic
1070991882 10:80740215-80740237 ACCTGAAATGGGACCCGGAGGGG - Intergenic
1075401034 10:122161886-122161908 ACCTGCATATGGAGCCGAAGAGG + Intronic
1077680981 11:4239627-4239649 ACCTGGTTTTGGACCAGAAAGGG - Intergenic
1077685267 11:4285068-4285090 ACCTGGTTTTGGACCAGAAAGGG - Intergenic
1077689921 11:4332861-4332883 ACCTGGTTTTGGACCAGAAAGGG + Intergenic
1080643814 11:34173992-34174014 ACCTGGCCTGGCACACGAAGTGG - Intronic
1087524205 11:99287291-99287313 TCCTGGACATTGACCAGAAGAGG + Intronic
1092240173 12:6831331-6831353 ACCTGGCCTCGGACCCAGAGAGG + Exonic
1094152126 12:27296530-27296552 CCCTGGATGTGGACCTGAAGTGG - Intronic
1096298429 12:50404397-50404419 ACCTGGCCTTGGGCCCAATGTGG + Intronic
1103637201 12:122317381-122317403 ATCTGAACTTGAACCTGAAGAGG + Intronic
1107292948 13:38877816-38877838 AACTGGACTTGGACCACAATGGG + Intronic
1125789985 15:42357873-42357895 ACCTAGACTTTGAACCGAGGTGG + Intergenic
1128378209 15:67092243-67092265 AACTGGACTTGGACCAGCACAGG + Intronic
1129130982 15:73495348-73495370 ACCAGAACTTAGCCCCGAAGAGG - Intronic
1130792507 15:87170409-87170431 ACCTGGAATTGCCCCCTAAGTGG - Intergenic
1133201250 16:4206043-4206065 ACATGGACTTAGACCAGGAGTGG - Intronic
1133681762 16:8126550-8126572 ACCAGGACTTGAACCAGAAAAGG + Intergenic
1134747936 16:16602343-16602365 ACCTGGGCTTGGACCACCAGAGG + Intergenic
1137016872 16:35385857-35385879 AACTGGACTTGGTCCCAAACAGG + Intergenic
1137026433 16:35480233-35480255 ACATGGACTTGGTCCCAAACAGG + Intergenic
1141094276 16:81151865-81151887 ACCTGGTGATGGACCGGAAGTGG - Intergenic
1144407434 17:14965814-14965836 ACCAGGATTTGGACACTAAGGGG + Intergenic
1144442132 17:15293033-15293055 AGCTGGACTTGGTCTCGCAGTGG + Intergenic
1148497129 17:48059704-48059726 ACCTGGACCTGGACCTACAGCGG + Exonic
1152334504 17:79692849-79692871 ACGTGGAGGTGGACCCAAAGTGG + Intergenic
1161169974 19:2807790-2807812 ACCTGGACCTGTACCCGCGGTGG + Exonic
1166748617 19:45153967-45153989 AGCCGGGCTTGGACCGGAAGCGG + Intronic
1167786671 19:51643433-51643455 ACCTGGAATTAGAACTGAAGTGG - Intronic
1167982214 19:53284560-53284582 AACTGGACTTGGATCCAAAGAGG + Intergenic
1167983930 19:53299413-53299435 AACTGGACTTGGATCCAAACAGG - Intergenic
927108445 2:19847341-19847363 ACCTGGCCTTGGTTCAGAAGGGG - Intergenic
932900857 2:75698143-75698165 AACTATACTTGGACCTGAAGAGG + Intronic
934781422 2:96971970-96971992 ACCTGGACTTGGACCCGAAGAGG - Exonic
944005865 2:194904167-194904189 ACCTGGAGTTGGGCCGGAAGCGG - Intergenic
946877127 2:224140393-224140415 ACCTGGGCTTGGACCAGACCTGG + Intergenic
948024834 2:234768673-234768695 ACCTGCACTTGGAGCCCCAGAGG - Intergenic
948793264 2:240389881-240389903 ACCTGGCCTTTGACCAGATGAGG - Intergenic
1172938048 20:38634735-38634757 TCCTCGGCTTGGACCTGAAGAGG + Exonic
1177702215 21:24653877-24653899 AATTGGACTTGAACCCAAAGAGG - Intergenic
1178329476 21:31675244-31675266 ACCTGGACTTTGACCTCTAGTGG + Intronic
1178346616 21:31834063-31834085 AACTGGTCTTGGACCAGAAGTGG + Intergenic
1180874837 22:19170316-19170338 ACCTGGACAGGGACCCCAAAGGG - Intergenic
1184583253 22:45430928-45430950 ACCTGGACTGGGACCGGCGGAGG + Exonic
953783351 3:45891703-45891725 ACCTGGATTTGGTCCTGGAGTGG - Intronic
956364771 3:68488558-68488580 TCCTGGACTTGAACCCAAATAGG - Intronic
964379118 3:156079476-156079498 TTCTGGCCTTGGACCAGAAGAGG + Intronic
968406239 4:341691-341713 ACCTGGACAAGGATCAGAAGAGG - Intronic
969169213 4:5346393-5346415 ACCCAGACTTGGACCCAGAGAGG - Intronic
976019944 4:80610332-80610354 ACCTGGACTTAGTACTGAAGTGG + Intronic
978981144 4:114947131-114947153 ACCTGGCCATAGACCCCAAGGGG - Intronic
987937039 5:24479966-24479988 ACCTGGAGATGGAGCCCAAGTGG + Intergenic
989567824 5:42918432-42918454 ACATGGACATGGACACAAAGAGG - Intergenic
997471750 5:134121014-134121036 ACGTGGACTTGGGCACGGAGGGG + Intronic
999453557 5:151696565-151696587 CCCTGGACCTGGACCAGCAGCGG - Intergenic
1004276052 6:14236061-14236083 ACCTGGACTGGGACCAGAGCTGG - Intergenic
1007321619 6:41032265-41032287 GCCTGGGCTGGGACCCCAAGAGG + Intronic
1007400270 6:41599137-41599159 CCCTGGTCTTGGACCAGTAGAGG + Exonic
1007454327 6:41964712-41964734 ACCTGGACTTGTCCCCTAAAGGG + Intronic
1007713417 6:43838995-43839017 ACCTGGCCTTGGAACCAAAAGGG + Intergenic
1008488078 6:52056556-52056578 ACCTGGATTTGGACACTGAGTGG - Intronic
1009600793 6:65795185-65795207 ACCTGGCCATGGACTCAAAGAGG - Intergenic
1019599965 7:1876320-1876342 ACCTGGTGTTGGACCAGACGGGG - Intronic
1019932681 7:4234299-4234321 ACCTGGACCTGGACCCAGGGTGG - Intronic
1021641586 7:22742797-22742819 ACCTGGAGTTGAACCCTGAGTGG + Intergenic
1024250754 7:47504094-47504116 ACCTGGACTTGGATCCCAGTGGG - Intronic
1035469151 7:159098578-159098600 ATCTGGACCTGGAGCCCAAGGGG - Intronic
1047868243 8:129053377-129053399 AAGTGGAATTGGACACGAAGAGG + Intergenic
1049401565 8:142429920-142429942 ACCTGGACTTGCACCAGACCAGG + Intergenic
1053312001 9:37026232-37026254 ACCCTGGCTTGGACCCGTAGAGG - Intronic
1057452593 9:95178175-95178197 AAATGGACTTGTACCCAAAGAGG + Intronic
1061202045 9:129143587-129143609 CCCTGCACTTGGTCCTGAAGGGG + Intronic
1061632803 9:131883822-131883844 ACAGGGACTTGGCCCCAAAGGGG - Intronic
1062066980 9:134533912-134533934 ACCTGGAATTGGAGGGGAAGGGG - Intergenic
1189595830 X:42564617-42564639 TCCTGGACTTAGACCCTACGTGG + Intergenic
1195338515 X:103880288-103880310 ACCTGCAGTTGTACCCCAAGGGG - Intergenic
1197091116 X:122538829-122538851 AGCTGGACTGGGCCCAGAAGAGG + Intergenic
1200061845 X:153487300-153487322 TCCTGGGCCTGGACCCAAAGAGG + Intronic
1200214989 X:154364257-154364279 ACCTGGACTTGGACCCGAAGTGG + Exonic