ID: 1200214991

View in Genome Browser
Species Human (GRCh38)
Location X:154364258-154364280
Sequence CCTGGACTTGGACCCGAAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 102}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200214983_1200214991 -1 Left 1200214983 X:154364236-154364258 CCCAACACCCGTGGGTGCTCTAC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214972_1200214991 29 Left 1200214972 X:154364206-154364228 CCAGGCCTGGGTGCCCACACCTG 0: 1
1: 0
2: 24
3: 930
4: 19348
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214986_1200214991 -8 Left 1200214986 X:154364243-154364265 CCCGTGGGTGCTCTACCTGGACT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214981_1200214991 1 Left 1200214981 X:154364234-154364256 CCCCCAACACCCGTGGGTGCTCT 0: 1
1: 0
2: 1
3: 11
4: 112
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214975_1200214991 15 Left 1200214975 X:154364220-154364242 CCACACCTGCCCTGCCCCCAACA 0: 1
1: 0
2: 9
3: 139
4: 1102
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214987_1200214991 -9 Left 1200214987 X:154364244-154364266 CCGTGGGTGCTCTACCTGGACTT 0: 1
1: 0
2: 1
3: 10
4: 118
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214979_1200214991 6 Left 1200214979 X:154364229-154364251 CCCTGCCCCCAACACCCGTGGGT 0: 1
1: 0
2: 0
3: 17
4: 209
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214980_1200214991 5 Left 1200214980 X:154364230-154364252 CCTGCCCCCAACACCCGTGGGTG 0: 1
1: 0
2: 1
3: 15
4: 220
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214971_1200214991 30 Left 1200214971 X:154364205-154364227 CCCAGGCCTGGGTGCCCACACCT 0: 1
1: 0
2: 5
3: 59
4: 631
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214976_1200214991 10 Left 1200214976 X:154364225-154364247 CCTGCCCTGCCCCCAACACCCGT 0: 1
1: 0
2: 4
3: 59
4: 630
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214984_1200214991 -2 Left 1200214984 X:154364237-154364259 CCAACACCCGTGGGTGCTCTACC 0: 1
1: 0
2: 1
3: 6
4: 65
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214973_1200214991 24 Left 1200214973 X:154364211-154364233 CCTGGGTGCCCACACCTGCCCTG 0: 1
1: 0
2: 3
3: 74
4: 555
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214974_1200214991 16 Left 1200214974 X:154364219-154364241 CCCACACCTGCCCTGCCCCCAAC 0: 1
1: 0
2: 11
3: 96
4: 946
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102
1200214982_1200214991 0 Left 1200214982 X:154364235-154364257 CCCCAACACCCGTGGGTGCTCTA 0: 1
1: 0
2: 1
3: 5
4: 47
Right 1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200214991 Original CRISPR CCTGGACTTGGACCCGAAGT GGG Exonic
901128399 1:6945593-6945615 CCTGCACTTGGAGGCGAAGCAGG - Intronic
903341626 1:22658570-22658592 CCTGGACTTGTGCCCCTAGTGGG - Intronic
904706234 1:32393122-32393144 CCTGGAGTTGGCCCTGAAGCAGG + Intronic
906723563 1:48027048-48027070 TCTGGAATTGGAACCCAAGTTGG - Intergenic
909631579 1:77774320-77774342 CCTGGACTTGGATCAGGAGATGG - Intergenic
914001683 1:143699783-143699805 CCTGGACTTGCTCCCAAAGCAGG + Intergenic
915033179 1:152901600-152901622 CCCAGACTTGGACCCTAAGCGGG + Intergenic
916926015 1:169521438-169521460 CCTGGACTTTGACCCCCACTTGG + Intronic
921383874 1:214551144-214551166 CCGGGAGTTGGGCCCGAGGTTGG - Intronic
923147911 1:231210534-231210556 CCTGGACTTGGCCCCTCTGTGGG - Intronic
1063665665 10:8058797-8058819 CCTGGACTTGCATCCGAAGCCGG - Exonic
1065563779 10:26989155-26989177 CTTTGACTTGGACCATAAGTGGG + Intergenic
1065962367 10:30743996-30744018 CCTGGCCTTGGAGCTGGAGTTGG - Intergenic
1069588974 10:69630362-69630384 CCGGGACTTGGAGCCGGTGTCGG + Intronic
1071178529 10:82955917-82955939 CATGGTCTTGCACCTGAAGTTGG - Intronic
1073815242 10:107199197-107199219 CCTGGACTGGGACCAGGACTGGG - Intergenic
1080536875 11:33230489-33230511 CCAGAAGTTGGACCAGAAGTTGG + Intergenic
1083934456 11:65863086-65863108 CCTGGAGCTGGCCCAGAAGTTGG + Exonic
1085087974 11:73685107-73685129 CCTGGGCTTGGGCCCTAGGTAGG + Intronic
1095664476 12:44780259-44780281 CCTGGACTTGGAGCTAAAGAAGG + Intronic
1113751270 13:112777952-112777974 CCTGGGCCTGGCCCCGAAGAAGG + Intronic
1118596696 14:67441188-67441210 CACGAACTTGGACCCCAAGTTGG - Intergenic
1202840176 14_GL000009v2_random:114295-114317 CCTCAACTTGGATCCGAATTTGG - Intergenic
1202909558 14_GL000194v1_random:104492-104514 CCTCAACTTGGATCCGAATTTGG - Intergenic
1202883717 14_KI270722v1_random:84783-84805 CCTTAACTTGGATCCGAAGTTGG + Intergenic
1124645754 15:31436638-31436660 CCTGGTCTGGGACCCCAACTGGG - Intergenic
1128551765 15:68602183-68602205 CACGGACTTGGTCCTGAAGTGGG + Intronic
1130063704 15:80587869-80587891 GCTGGAATTAGACACGAAGTGGG + Intronic
1132234918 15:100212373-100212395 CCTGGACTTTGAATCGTAGTTGG - Intronic
1132565055 16:618229-618251 CCTGGAGTAGGACCTGAAGATGG - Exonic
1132577308 16:669997-670019 CCGGGACTTGGGCCCTCAGTGGG + Intronic
1133201249 16:4206042-4206064 CATGGACTTAGACCAGGAGTGGG - Intronic
1134067089 16:11235566-11235588 CCTGGACTGGGACACTGAGTGGG - Intergenic
1135352255 16:21738915-21738937 CTTGGATTTGTACCCAAAGTTGG + Intronic
1135450745 16:22555037-22555059 CTTGGATTTGTACCCAAAGTTGG + Intergenic
1141878151 16:86840529-86840551 CCTGCACTTGGATCCAAAATGGG - Intergenic
1142819740 17:2456289-2456311 CTTTGACTGGGACCCAAAGTAGG - Intronic
1144681450 17:17198436-17198458 CCTCCACTTGGACCCAAAGTAGG + Intronic
1147671299 17:42178351-42178373 CCAGGACTTGGCCCCCAAGGAGG - Exonic
1149388450 17:56165902-56165924 CATGGACTAGGACCTGAATTGGG - Intronic
1151748256 17:76022988-76023010 CCTGGGCTTCGACGGGAAGTGGG - Intronic
1152334505 17:79692850-79692872 CGTGGAGGTGGACCCAAAGTGGG + Intergenic
1157782377 18:50451057-50451079 CCTGGAATTTGACCTTAAGTTGG + Intergenic
1159193625 18:65082829-65082851 CCTGGACTTTGTCTCTAAGTAGG - Intergenic
1161169976 19:2807791-2807813 CCTGGACCTGTACCCGCGGTGGG + Exonic
1162182536 19:8879934-8879956 CCTGGGCTTGGGCCCCTAGTGGG + Intronic
1162373317 19:10291432-10291454 CCGGGACTTGGAACAGAAGGTGG - Intronic
1163361998 19:16852620-16852642 GCTGGACTTGGACCTGAACTTGG - Intronic
1164444836 19:28308154-28308176 CCTGGACTTGGTCCTGCAGCTGG - Intergenic
1167092376 19:47353450-47353472 CCTGGACTTTGGCCAGAAGCAGG + Exonic
1167485836 19:49762508-49762530 CTTGAACTGGGACCCGCAGTCGG - Intronic
1202632866 1_KI270706v1_random:16262-16284 CCTCAACTTGGATCCGAAGTTGG + Intergenic
1202653010 1_KI270707v1_random:23787-23809 CCTCAACTTGGATCCGAAGTTGG - Intergenic
1202659144 1_KI270708v1_random:51957-51979 CCTTAACTTGGATCTGAAGTTGG + Intergenic
934781420 2:96971969-96971991 CCTGGACTTGGACCCGAAGAGGG - Exonic
935058745 2:99590245-99590267 CCTGGACTAAGACAGGAAGTGGG + Intronic
946354804 2:219178065-219178087 CCTGGACCTAGACCCGGACTCGG + Exonic
946428216 2:219611183-219611205 CCTGGAATTGGACCGAAATTTGG + Intronic
947811580 2:233007745-233007767 CCTTGACTTGGAACCCAAGGTGG + Intronic
1168849211 20:965230-965252 CCTGGACTGGGTCTTGAAGTGGG + Intronic
1169090662 20:2859737-2859759 CATGGACTGGGACCTGAAGGAGG + Exonic
1175335569 20:58193712-58193734 TCTGGACTTGTCCCCGAGGTGGG - Intergenic
1176599141 21:8775864-8775886 CCTCAACTTGGATCCGAAGTTGG + Intergenic
1176645085 21:9342142-9342164 CCTCAATTTGGATCCGAAGTTGG + Intergenic
1178346617 21:31834064-31834086 ACTGGTCTTGGACCAGAAGTGGG + Intergenic
1180326603 22:11435482-11435504 CCTTAACTTGGATCCGAAGTTGG + Intergenic
1180367868 22:11957092-11957114 CCTCAACTTGGATCCGAAGTTGG - Intergenic
1180378222 22:12114244-12114266 CCTCAACTTGGATCTGAAGTTGG + Intergenic
1180419286 22:12799037-12799059 CCTCAACTTGGATCCGAAGTTGG - Intergenic
1180831924 22:18910941-18910963 CCTGGAGCTGGACCGGAAGGTGG + Exonic
1181067921 22:20315401-20315423 CCTGGAGCTGGACCGGAAGGTGG - Exonic
1183028870 22:35086979-35087001 CCAGGAGTTGGACCGGGAGTTGG + Exonic
1183489697 22:38109756-38109778 CCTGGACTTGGGCCTGGACTTGG + Intronic
1184169742 22:42751937-42751959 AGTGGACTGGGACCCGAAGAAGG + Intergenic
1184878364 22:47289600-47289622 GCTGGGCTTGGAGCTGAAGTGGG + Intergenic
1184974426 22:48051052-48051074 TCTGCACTTGGACCCCAAATTGG + Intergenic
1203282002 22_KI270734v1_random:136212-136234 CCTGGAGCTGGACCGGAAGGTGG + Intergenic
953783349 3:45891702-45891724 CCTGGATTTGGTCCTGGAGTGGG - Intronic
966079095 3:175977935-175977957 CCTGGACTTGGATCAGGAGATGG - Intergenic
1202741806 3_GL000221v1_random:62926-62948 CCTCAATTTGGATCCGAAGTTGG - Intergenic
973362500 4:49178236-49178258 CCTCAACTTGTATCCGAAGTTGG + Intergenic
973398600 4:49618625-49618647 CCTCAACTTGGATCCGAAGTTGG - Intergenic
983081189 4:163387387-163387409 TCAGGACTTGGATCAGAAGTGGG + Intergenic
1202759841 4_GL000008v2_random:99709-99731 CCTCAACTTGGATCCGAAGTTGG + Intergenic
989503985 5:42203943-42203965 CATGGTCTTGGAACCGAAATAGG - Intergenic
993732474 5:91439040-91439062 CCTGGACTTAGACAGGAAGCAGG - Intergenic
997697229 5:135871461-135871483 CCTGGACTTCAAACCGAGGTTGG - Intronic
998791029 5:145766420-145766442 CCTGGGCTTAGATCCCAAGTAGG - Intronic
1004276050 6:14236060-14236082 CCTGGACTGGGACCAGAGCTGGG - Intergenic
1004382303 6:15143098-15143120 CCTGGATTTGAACCCAAACTTGG - Intergenic
1005709490 6:28489899-28489921 CCTGGACGCGGAGCCGAAATCGG - Intergenic
1007321621 6:41032266-41032288 CCTGGGCTGGGACCCCAAGAGGG + Intronic
1008448879 6:51625965-51625987 CCTGGACCTGCACCAGAAGGTGG - Intronic
1012703086 6:102487868-102487890 CCTGGACTTTGACACTAATTGGG + Intergenic
1014116017 6:117669804-117669826 CCTGGACCTGGACCAGGACTAGG - Intergenic
1018616115 6:165688473-165688495 CCTGGACTTGAAGCCAGAGTAGG + Intronic
1023859989 7:44212804-44212826 CCAGGCCTTGGGCCTGAAGTGGG - Exonic
1024258787 7:47558807-47558829 CTTGGACTTGGACCCTGAGCAGG - Intronic
1032357085 7:131221245-131221267 CCAGGGCTTGGACCAGAAATGGG - Intronic
1034791659 7:153976085-153976107 CTTGGACTTGGACATGAACTGGG + Intronic
1035232141 7:157471610-157471632 CCAGGACTTGGATCCAGAGTGGG + Intergenic
1036688896 8:10928869-10928891 CCCGGACTTGCTCCCAAAGTCGG + Intronic
1039438620 8:37578967-37578989 CCTGGCCTTGGACTTGAACTTGG - Intergenic
1042655947 8:71096724-71096746 CCTGAACTTGGAGACGGAGTTGG + Intergenic
1044946441 8:97394153-97394175 CCTGACCTTGGACTTGAAGTAGG - Intergenic
1050337276 9:4601731-4601753 CCGGGACTGGGACACGTAGTGGG + Intronic
1056488753 9:87084687-87084709 CCTGGACTTGGACGGGCGGTGGG + Intergenic
1061796948 9:133091096-133091118 CCTGGGCTTGGACCCGGAAGAGG - Intergenic
1203770118 EBV:45581-45603 CATGGACTTGAAGCAGAAGTTGG + Intergenic
1203710436 Un_KI270742v1:92850-92872 CCTCAATTTGGATCCGAAGTTGG - Intergenic
1203540617 Un_KI270743v1:84604-84626 CCTCAACTTGGATCCGAAGTTGG + Intergenic
1186292039 X:8110854-8110876 CCTGGACTTGAACTTGAACTGGG + Intergenic
1197183461 X:123561990-123562012 CCTGGACGTGGTCCAGAAGGAGG + Intergenic
1199205742 X:145146453-145146475 TCTGGGCTGGGACCCCAAGTGGG - Intergenic
1199851320 X:151726523-151726545 CCTGGACTTGGCCTCCAAGAAGG - Intergenic
1200020771 X:153204667-153204689 ACTGGAGTTGGATCCCAAGTTGG - Intergenic
1200214991 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG + Exonic
1201165409 Y:11204501-11204523 CCTCAACTTGGATCCGAATTTGG - Intergenic