ID: 1200214995

View in Genome Browser
Species Human (GRCh38)
Location X:154364277-154364299
Sequence TGGGGCCTTGCCACCGTGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 215}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200214987_1200214995 10 Left 1200214987 X:154364244-154364266 CCGTGGGTGCTCTACCTGGACTT 0: 1
1: 0
2: 1
3: 10
4: 118
Right 1200214995 X:154364277-154364299 TGGGGCCTTGCCACCGTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 215
1200214981_1200214995 20 Left 1200214981 X:154364234-154364256 CCCCCAACACCCGTGGGTGCTCT 0: 1
1: 0
2: 1
3: 11
4: 112
Right 1200214995 X:154364277-154364299 TGGGGCCTTGCCACCGTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 215
1200214983_1200214995 18 Left 1200214983 X:154364236-154364258 CCCAACACCCGTGGGTGCTCTAC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1200214995 X:154364277-154364299 TGGGGCCTTGCCACCGTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 215
1200214986_1200214995 11 Left 1200214986 X:154364243-154364265 CCCGTGGGTGCTCTACCTGGACT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1200214995 X:154364277-154364299 TGGGGCCTTGCCACCGTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 215
1200214976_1200214995 29 Left 1200214976 X:154364225-154364247 CCTGCCCTGCCCCCAACACCCGT 0: 1
1: 0
2: 4
3: 59
4: 630
Right 1200214995 X:154364277-154364299 TGGGGCCTTGCCACCGTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 215
1200214984_1200214995 17 Left 1200214984 X:154364237-154364259 CCAACACCCGTGGGTGCTCTACC 0: 1
1: 0
2: 1
3: 6
4: 65
Right 1200214995 X:154364277-154364299 TGGGGCCTTGCCACCGTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 215
1200214982_1200214995 19 Left 1200214982 X:154364235-154364257 CCCCAACACCCGTGGGTGCTCTA 0: 1
1: 0
2: 1
3: 5
4: 47
Right 1200214995 X:154364277-154364299 TGGGGCCTTGCCACCGTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 215
1200214990_1200214995 -4 Left 1200214990 X:154364258-154364280 CCTGGACTTGGACCCGAAGTGGG 0: 1
1: 1
2: 0
3: 7
4: 77
Right 1200214995 X:154364277-154364299 TGGGGCCTTGCCACCGTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 215
1200214980_1200214995 24 Left 1200214980 X:154364230-154364252 CCTGCCCCCAACACCCGTGGGTG 0: 1
1: 0
2: 1
3: 15
4: 220
Right 1200214995 X:154364277-154364299 TGGGGCCTTGCCACCGTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 215
1200214979_1200214995 25 Left 1200214979 X:154364229-154364251 CCCTGCCCCCAACACCCGTGGGT 0: 1
1: 0
2: 0
3: 17
4: 209
Right 1200214995 X:154364277-154364299 TGGGGCCTTGCCACCGTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200214995 Original CRISPR TGGGGCCTTGCCACCGTGCT TGG Exonic
900043416 1:489827-489849 TGGGGCCTTGACAGCCTGGTTGG + Intergenic
900064854 1:724824-724846 TGGGGCCTTGACAGCCTGGTTGG + Intergenic
900755648 1:4432830-4432852 ATGGCCCTTGCCACAGTGCTTGG + Intergenic
901331343 1:8411342-8411364 TGGGGTCTTGCTAGCTTGCTCGG + Intronic
903193031 1:21667448-21667470 TGGGACCTTCCCAGCTTGCTTGG - Intronic
903656123 1:24949805-24949827 TTGGCCCTTGGCACCCTGCTTGG + Intronic
904488086 1:30840843-30840865 TGGGGGCTTCACACGGTGCTGGG - Intergenic
904614550 1:31742887-31742909 GCAGGCCTTGCCGCCGTGCTGGG + Exonic
904916347 1:33973210-33973232 TGGGGACATGCCAGCGTGCTGGG - Intronic
905705276 1:40051716-40051738 TAGGCCCCTGCCACCGTGCCTGG + Intronic
907073987 1:51562650-51562672 TGGGTCCCTGCCACCTCGCTTGG - Intergenic
912152716 1:106879922-106879944 GGGGGCCTTGTGACTGTGCTAGG - Intergenic
912428551 1:109615647-109615669 TGGGTGCATGCCACCATGCTGGG - Exonic
913139385 1:115925572-115925594 GGGGGCCCTGCCACAGGGCTGGG - Intergenic
914790615 1:150874541-150874563 AGGTGCCTTGCCACCATGCGCGG - Intronic
917555995 1:176089156-176089178 TGGGGTCCTGCCACTGTGCCCGG - Intronic
922099759 1:222470842-222470864 TGGGGCCTTGACAGCCTGGTTGG + Intergenic
922261793 1:223950335-223950357 TGGGGCCTTGACAGCCTGGTTGG + Intergenic
922735285 1:227975407-227975429 TGGGGCCTTGACAGCCTGGTTGG - Intergenic
923775146 1:236971310-236971332 TGGGGCCTTGCTATGTTGCTCGG + Intergenic
924342959 1:243052510-243052532 TGGGGCCTTGACAGCCTGGTTGG + Intergenic
1063244335 10:4202808-4202830 TGAGGCCTTGCAACACTGCTGGG + Intergenic
1063306969 10:4911304-4911326 TGGGGACTTGCCTGCCTGCTGGG + Intergenic
1063603344 10:7501372-7501394 TGGGACAGTGCCACGGTGCTGGG - Intergenic
1065865494 10:29911398-29911420 TGGGGGCCTGCCACCATGCCTGG - Intergenic
1066066873 10:31767989-31768011 TAGGTTCTTGCCACCATGCTTGG - Intergenic
1066733521 10:38453042-38453064 TGGGGCCTTGACAGCCTGGTTGG - Intergenic
1067109997 10:43393616-43393638 TAAGGCCTAGCCACTGTGCTTGG - Intronic
1067479461 10:46585487-46585509 TGGGGCCCTGGCACCTAGCTTGG + Intronic
1067615277 10:47756311-47756333 TGGGGCCCTGGCACCTAGCTTGG - Intergenic
1069039876 10:63684481-63684503 TGGGTGCATGCCACCATGCTTGG - Intergenic
1069468397 10:68662758-68662780 CAGGTGCTTGCCACCGTGCTTGG - Intronic
1071108596 10:82127810-82127832 TGGGGCATCCCCACCCTGCTAGG + Intronic
1071452989 10:85817381-85817403 TAGGGACATGCCACCATGCTGGG - Intronic
1071596458 10:86930873-86930895 TGGGACCATGCCACCATGCCTGG + Exonic
1071630678 10:87216262-87216284 TGGGGCCCTGGCACCTAGCTTGG - Intergenic
1074301426 10:112236599-112236621 TGGGACCTTGCCACCTTGCCAGG - Intergenic
1074449584 10:113548352-113548374 TGGGGCCTTGCAGCAGAGCTGGG + Intergenic
1075129368 10:119725677-119725699 TGGGGCCTCCCCTCCGTGCAGGG - Intergenic
1075741767 10:124700349-124700371 TGGGGCCTCCACACCGTGATTGG - Intronic
1076009575 10:126976874-126976896 TAGGGGCTTACCACCATGCTTGG + Intronic
1076647781 10:131965256-131965278 TGGCGCCCAGCCTCCGTGCTGGG - Intergenic
1076969689 11:126044-126066 TGGGGCCTTGACAGCCTGGTTGG + Intergenic
1077268246 11:1662769-1662791 TGTGGCGTTGCCACTTTGCTTGG - Intergenic
1077353716 11:2105031-2105053 AGGGGCCTGGCCACAGTGCCTGG - Intergenic
1081029465 11:38060306-38060328 TGGGGCCTTGCCACCTTCCCAGG + Intergenic
1081599602 11:44484102-44484124 TGGGGCCTTGGCAGAGGGCTGGG - Intergenic
1083232356 11:61331334-61331356 TGTAGGCATGCCACCGTGCTTGG - Intronic
1084162097 11:67355515-67355537 TGGGGCCCTGCCACCGCCCAGGG + Intronic
1084696086 11:70756374-70756396 TGGGGGCTGGCCACGGTGCTGGG + Intronic
1085593700 11:77789637-77789659 TGGGGCCCTGCCACTGTGGAGGG - Intronic
1088064952 11:105706156-105706178 TGGGGCCTTGCCAACATGAAGGG + Intronic
1091401298 12:182282-182304 TGGGGCCTGGCTGCCGTCCTGGG - Intergenic
1094025005 12:25952946-25952968 TGGGGCCTTGCTATGTTGCTTGG + Intergenic
1096391838 12:51235690-51235712 TGGGTGCTTGCCACCATGCCTGG - Intergenic
1101595552 12:106161469-106161491 TGAGACCCTGGCACCGTGCTAGG + Intergenic
1104874495 12:132024597-132024619 TGGCGCCTTGTCCCCGTGGTGGG + Intronic
1104895944 12:132163649-132163671 TGTGCCCTTGCCACCCTGCGTGG + Intergenic
1104948987 12:132430310-132430332 CGGGAGCTTGCCACCGTGCCCGG + Intergenic
1105894298 13:24705400-24705422 CAGGGGCTTTCCACCGTGCTTGG - Intronic
1106033806 13:26026051-26026073 TGGGGCCTTGCCTCAGAGCAAGG - Intergenic
1106601878 13:31195260-31195282 AGGGGCTTGGGCACCGTGCTAGG - Intergenic
1106718933 13:32419386-32419408 CGGGTGCTTGCCACCATGCTTGG + Intronic
1112324419 13:98433912-98433934 TGGGTCCTTTCCTCCGGGCTCGG - Intronic
1116661136 14:47711587-47711609 TGGGAGCCTGCCACCATGCTTGG - Intergenic
1117337193 14:54765725-54765747 AGGGGCCTGGCCGCTGTGCTGGG - Intronic
1118978600 14:70698583-70698605 CTGGGCATTGCCACTGTGCTAGG + Intergenic
1119631489 14:76236178-76236200 TGGTGCCCTCCCACCGTGCAGGG + Intronic
1120499549 14:85277966-85277988 TAGGGGCTTGGCAACGTGCTAGG + Intergenic
1121321055 14:92991837-92991859 TGGGGTCCTGCCATCGTGGTGGG + Intronic
1121505743 14:94475142-94475164 TGGAGCCTTGCCACAGGGCTGGG - Intronic
1121611948 14:95287299-95287321 TGGAGCCTGGCCACGGAGCTGGG - Intronic
1122095147 14:99365102-99365124 TAGGGACATGCCACCGTGCCTGG + Intergenic
1125349488 15:38752564-38752586 TAGGTGCTTGCCACAGTGCTAGG + Intergenic
1128711946 15:69878646-69878668 TGGGGCCTTGAGACCTTGCTGGG - Intergenic
1129272869 15:74428675-74428697 TGGGGCCAGGCCACCATGCAGGG + Intronic
1129995773 15:80003855-80003877 TAGGCACTTGCCACCGTGCCCGG - Intergenic
1132463243 16:65936-65958 TGGGGCCCTGGCCCCGTGCCTGG - Intronic
1132897273 16:2235009-2235031 TGGGGCCCTGGGGCCGTGCTGGG + Intronic
1133952341 16:10406294-10406316 TGGGGTTTTGCCACGTTGCTTGG + Intronic
1134440775 16:14298557-14298579 TGGGGCCTTGGCATCGCCCTGGG + Intergenic
1134473262 16:14547512-14547534 TGGGGCCTTGCCATGTTGCTCGG - Intronic
1134568398 16:15270701-15270723 TGAGTCCTTGGCACTGTGCTTGG - Intergenic
1134734030 16:16485659-16485681 TGAGTCCTTGGCACTGTGCTTGG + Intergenic
1134933468 16:18226622-18226644 TGAGTCCTTGGCACTGTGCTTGG - Intergenic
1135191943 16:20361658-20361680 TGGAATCTTGCCACAGTGCTGGG + Intronic
1136641263 16:31567592-31567614 TGGGCCCTGGCCAAAGTGCTTGG - Intergenic
1137814765 16:51388288-51388310 TGTGTCCTTGCCACTGTGCAAGG + Intergenic
1138672757 16:58629166-58629188 GGGGGCTTTGACAACGTGCTGGG + Intronic
1140964667 16:79953537-79953559 TGGGCGCTTGCCACCATGCCTGG - Intergenic
1141923134 16:87149661-87149683 AGGGGCCTTTCCATAGTGCTGGG - Intronic
1142033534 16:87850267-87850289 TGGGGCCCTGCCTCAGGGCTGGG - Intronic
1142041529 16:87897434-87897456 TGGGGCTGTGCCTGCGTGCTGGG + Intronic
1142450988 16:90173078-90173100 TGGGGCCTTGACAGCCTGGTTGG - Intergenic
1142456575 17:60617-60639 TGGGGCCTTGACAACCTGGTTGG + Intergenic
1142882308 17:2891288-2891310 TGGGTGCTTGCCACCATGCCTGG + Intronic
1143849282 17:9797649-9797671 TGGGCGCGTGCCACCATGCTCGG + Intronic
1143972738 17:10807185-10807207 TGGGGTCTTCTCACCCTGCTTGG + Intergenic
1145782045 17:27569875-27569897 TGGGGCCTTTCCACGCTGATAGG + Intronic
1147846048 17:43404502-43404524 TGGGGCCTTGCCCTCTTGCCTGG + Intergenic
1148159852 17:45443714-45443736 TGGGGCCTTATCACCCTCCTTGG - Intronic
1148681049 17:49473660-49473682 TGGGGCCATGCCACCCTCCTCGG - Intronic
1148881355 17:50730160-50730182 TGGGGTCTTGCCACGTTGCCCGG + Intronic
1149606054 17:57925974-57925996 TGGGGCCTCCCCACCCAGCTTGG - Intronic
1150391138 17:64790588-64790610 TGGGGCCTTATCACCCTCCTTGG - Intergenic
1150409922 17:64934638-64934660 TGGGGCCTTATCACCCTCCTTGG - Intergenic
1150683324 17:67300781-67300803 TGGGCACATGCCACCATGCTTGG - Intergenic
1151502333 17:74499009-74499031 TGGGAGCTTGCCACCGCGCCTGG - Intergenic
1152702928 17:81828398-81828420 TGGGGCCCTGCCAAGGAGCTGGG + Intronic
1152824830 17:82458364-82458386 TGGGGCCGTTCCAGGGTGCTCGG - Intronic
1153807986 18:8726597-8726619 TGGGGCCTTGGCCCCATGATGGG - Intronic
1153866537 18:9274833-9274855 TGGGGTCTTGCCACTATGCCTGG + Intronic
1155136871 18:23004560-23004582 TGGGTGCCTGCCACCTTGCTTGG - Intronic
1155351700 18:24913701-24913723 TGGTGCCTTCCCACCCTGCGAGG - Intergenic
1160646493 19:195970-195992 TGGGGCCTTGACAGCCTGGTTGG + Intergenic
1160925464 19:1542877-1542899 CGGGGCCTTGCCAAGGTGCAAGG - Intergenic
1161162339 19:2768315-2768337 GGGGTCCTTGACACAGTGCTGGG - Intronic
1161279695 19:3439139-3439161 TGGGGTCTTGCCATATTGCTAGG - Intronic
1162973187 19:14193442-14193464 TAGGCACGTGCCACCGTGCTCGG - Intronic
1164828727 19:31303660-31303682 TGAGGCCTTGACACCTTGCTGGG - Intronic
1165358856 19:35321116-35321138 TGGGACCTGGCCACCTGGCTTGG + Intronic
1167497850 19:49829950-49829972 TGAGGCCTGGGCACCGTGCGCGG + Intronic
1167781792 19:51602974-51602996 TGTGGCCTTCCCACCGTTTTGGG + Intergenic
1168014626 19:53562545-53562567 TAGGCGCTTGCCACCATGCTTGG - Intronic
928987612 2:37196602-37196624 TGGGGCCTCGTCACAGTTCTGGG + Intronic
929557154 2:42932537-42932559 TGAGGGCAAGCCACCGTGCTGGG + Intergenic
931654447 2:64498206-64498228 TGGGTGTGTGCCACCGTGCTTGG + Intergenic
932002705 2:67899245-67899267 TGGGCCTTTGCCATCTTGCTGGG - Intergenic
932694149 2:73940042-73940064 TGGGTGCATGCCACCATGCTGGG + Intronic
933802914 2:85977250-85977272 TGGTGCCTGGCCACCATGCCCGG - Intergenic
934158789 2:89228387-89228409 TGGGGCCTTCACACTGTGCAGGG + Intergenic
934208486 2:89954041-89954063 TGGGGCCTTCACACTGTGCAGGG - Intergenic
934768512 2:96893964-96893986 TGTGCCCTTGCCACCCTGCCAGG - Exonic
935192961 2:100793189-100793211 TGGGGCATGGACACCTTGCTTGG + Intergenic
936154744 2:110040490-110040512 TGGGGCCTTGCCTCGGGGCAGGG + Intergenic
936189939 2:110330924-110330946 TGGGGCCTTGCCTCGGGGCAGGG - Intergenic
937153431 2:119701565-119701587 TGTGGCCTTGTCACTGCGCTGGG - Intergenic
937885014 2:126893713-126893735 TGGGACCCAGCCACCATGCTGGG - Intergenic
939963792 2:148591226-148591248 TAGGGGCCTGCCACCGTGCCTGG - Intergenic
942028275 2:171932724-171932746 TGGGTGCATGCCACCATGCTTGG - Intronic
948336184 2:237209148-237209170 TGGGGCCAGCCCACCGTCCTGGG - Intergenic
1170210352 20:13841232-13841254 TGGGTCCTTGGCAGAGTGCTTGG + Intergenic
1170697037 20:18668556-18668578 TGGGGCCTTGCCACAGGTGTGGG - Intronic
1173968074 20:47128979-47129001 TGGGCACATGCCACCATGCTCGG - Intronic
1174449542 20:50610798-50610820 TGGGGCAGTGCCAGCTTGCTGGG - Intronic
1176168468 20:63686533-63686555 TGGGGCCTTGCCTCTGGGCTTGG + Intronic
1176279014 20:64290246-64290268 TGGGGCCTTGACAGCCTGGTTGG - Intergenic
1181067861 22:20315165-20315187 ATGGGCCTGGCCTCCGTGCTGGG + Intronic
1182293884 22:29301875-29301897 TGGGGCATGGCAAGCGTGCTTGG - Intergenic
1183464291 22:37971903-37971925 TGGGGCATAGCCGCCGGGCTGGG + Intronic
1183925130 22:41200328-41200350 TGGGTACGTGCCACCATGCTGGG - Intergenic
950663749 3:14482606-14482628 TGGGGCCCTGGCTCCCTGCTGGG + Intronic
952577783 3:34795387-34795409 TATGGCCTTTCCACCATGCTAGG - Intergenic
955069382 3:55559592-55559614 TGGGGCCTGGGCACTGTGCTGGG + Intronic
956754154 3:72368787-72368809 TGGCTCCCTGCCACGGTGCTGGG + Intergenic
958880302 3:99662099-99662121 TAGGCACGTGCCACCGTGCTCGG - Intronic
962908930 3:139830095-139830117 TGGGCCCTAGCTACAGTGCTTGG - Intergenic
968371188 3:198223556-198223578 TGGGGCCTTGACAGCCTGGTTGG - Intergenic
968698324 4:2043158-2043180 TGGGGCCTTGCCGCCCACCTAGG - Intronic
969262730 4:6043847-6043869 TGGGGCCTTGCCAGTGTTGTCGG - Intronic
970587149 4:17525505-17525527 TGGGTGCATGCCACCATGCTTGG - Intronic
976175960 4:82351725-82351747 TGGGGCTTTGCCATTGTTCTGGG - Intergenic
979259872 4:118636029-118636051 TGGGGCCTTGACAGCCTGGTTGG - Intergenic
984176063 4:176418398-176418420 TGGGCACCTGCCACCATGCTTGG + Intergenic
985019339 4:185670875-185670897 TGGGGCCCTGCCTCCCTCCTGGG + Intronic
987535721 5:19184870-19184892 TGGGGCCTGGCAACTGTGCATGG + Intergenic
989041260 5:37232238-37232260 TGGGCCTGTGCCACCGTGCCTGG - Intronic
991071961 5:62493353-62493375 TGGGGCATTGCCACTGTTTTTGG + Intronic
991386191 5:66092933-66092955 TGGACCCTTCCCACCTTGCTAGG - Intergenic
991777183 5:70096580-70096602 TCAGGACTAGCCACCGTGCTTGG + Intergenic
991856469 5:70972023-70972045 TCAGGACTAGCCACCGTGCTTGG + Intronic
992555661 5:77900380-77900402 AGGTGCCTTGCCACCATGCCTGG - Intergenic
995871183 5:116745074-116745096 TTCTGCCTTGCCACCGTACTTGG - Intergenic
996086104 5:119306608-119306630 TGGGCACATGCCACCGTGCCTGG + Intronic
998404052 5:141863613-141863635 GGAGGCCTTGCCACTGGGCTTGG + Exonic
998818988 5:146041458-146041480 TGGGTCCTAGGCACCGTGCTAGG - Intronic
1001141450 5:169147409-169147431 TGGGCACGTGCCACCATGCTTGG + Intronic
1002309276 5:178304898-178304920 TGGGTCCGTGGCCCCGTGCTGGG - Intronic
1002671791 5:180873458-180873480 CGGGCACTTGCCACCATGCTTGG - Intergenic
1002730427 5:181329102-181329124 TGGGGCCTTGACAGCCTGGTTGG - Intergenic
1002754105 6:145002-145024 TGGGGCCTTGACAGCCTGGTTGG + Intergenic
1004506285 6:16249512-16249534 TGGGGTCTTGCCATGTTGCTAGG + Intronic
1006414448 6:33895214-33895236 AAGGGCCTTGCCGCCTTGCTGGG + Intergenic
1007180740 6:39927483-39927505 TGGGCCCCTGCTACCGGGCTGGG + Exonic
1010059296 6:71604126-71604148 TGTTTCCTGGCCACCGTGCTGGG - Intergenic
1014760971 6:125356310-125356332 TAGGCGCTTGCCACCATGCTTGG - Intergenic
1016057580 6:139594568-139594590 TAGGCCTGTGCCACCGTGCTGGG + Intergenic
1017828555 6:158102369-158102391 TAGGGGCTTGCCACCATGCCTGG + Intergenic
1019161182 6:170067831-170067853 TGGGGCCTAGGAACAGTGCTGGG + Intergenic
1019673704 7:2298082-2298104 TGGGCCCTGGGCACCATGCTAGG - Intronic
1022989710 7:35695256-35695278 TGCCGCCTTCCCGCCGTGCTCGG + Intronic
1025082042 7:55992281-55992303 TGGGGCCTTGCTATGTTGCTTGG - Intronic
1028600910 7:92599488-92599510 AGGGTCCATGCCACCGTGCCTGG + Intergenic
1029545043 7:101206213-101206235 GGGGGCCTGGCCCCCGTCCTGGG - Exonic
1029652435 7:101902720-101902742 TGGGGCAGTGCCATCGAGCTGGG + Intronic
1029725653 7:102402245-102402267 TGGGGTCTTGCCACGTTGCCTGG - Intronic
1029732339 7:102446735-102446757 TGGGGCTTCTCCACCGTGCTTGG + Exonic
1031469021 7:122147057-122147079 CGGGCCCTTGCCACCATGCCTGG - Intergenic
1032052097 7:128656022-128656044 TGGGGCCTTGACAGCCTGGTTGG - Intergenic
1034450003 7:151132201-151132223 TGGGGCCTTGCCAAGGTGGCTGG - Intronic
1034943311 7:155245989-155246011 TGGGTCCTTCCCACCATGCGTGG + Intergenic
1037892964 8:22633593-22633615 TGGGGATTTTCCACCTTGCTGGG + Intronic
1041824731 8:62081488-62081510 TAGTGCCTTGCCACATTGCTAGG + Intergenic
1043382871 8:79722064-79722086 TGGGTACTTGCCACTGTGCCTGG - Intergenic
1047568708 8:126074034-126074056 TTGGGCCTTGCAATCGTGCTGGG - Intergenic
1048541395 8:135345206-135345228 AGGGGCCTTGGCACAGTGCCTGG - Intergenic
1048710806 8:137208049-137208071 CGGGCGCTTGCCACCATGCTCGG - Intergenic
1048997933 8:139805531-139805553 TGTGGGCTTGGCACTGTGCTTGG + Intronic
1049678496 8:143904235-143904257 CGAGGCCCAGCCACCGTGCTGGG + Intergenic
1053255558 9:36614236-36614258 TAGGTCCTTGCCACCATGCGTGG + Intronic
1053373720 9:37586079-37586101 TGAGGCCCTGCCAACGTTCTGGG - Intronic
1056803329 9:89709124-89709146 TGGGACCTGGCCACCATGCTAGG - Intergenic
1058819901 9:108720488-108720510 TTGGGCCTTGCCACCTTCCACGG - Intergenic
1059048358 9:110895386-110895408 TGGGGCCTGGCCACTAGGCTGGG + Intronic
1059991314 9:119868955-119868977 TGGGCCCCTGCCAGAGTGCTTGG - Intergenic
1060207124 9:121688720-121688742 TGAGTCCTTGCCCCAGTGCTGGG - Intronic
1061012168 9:127962107-127962129 TGGGGCCATCCCACCCTGCTGGG - Intronic
1061212272 9:129200819-129200841 TGGGCCCCTGCCACCATGCCTGG + Intergenic
1061733770 9:132637945-132637967 TGGGGAATTTCCACCGTGCCAGG - Intronic
1061880783 9:133567892-133567914 GGGGGCATGGCCAGCGTGCTGGG - Intronic
1062427625 9:136513174-136513196 TGGGGCCCTGCCAAGGTGCCTGG - Intronic
1062754837 9:138281612-138281634 TGGGGCCTTGACAGCCTGGTTGG - Intergenic
1203578745 Un_KI270745v1:25781-25803 TGGGGCCTTGACAGCCTGGTTGG - Intergenic
1185879578 X:3729202-3729224 TGGGCACTTGCCACCATGCCTGG + Intergenic
1189240141 X:39518587-39518609 TGGGTCCTTGCCCGAGTGCTGGG - Intergenic
1191877482 X:65810949-65810971 TGGGTGCCTGCCACCATGCTCGG + Intergenic
1193809901 X:86039109-86039131 TAGGGGCTTATCACCGTGCTTGG + Intronic
1194267408 X:91771882-91771904 TGGAGCATTGGCACCCTGCTTGG - Intergenic
1200214995 X:154364277-154364299 TGGGGCCTTGCCACCGTGCTTGG + Exonic
1200584614 Y:4992819-4992841 TGGAGCATTGGCACCCTGCTTGG - Intergenic
1200759563 Y:7025553-7025575 TGGGGCCTTGCCGCAGTCCTTGG + Intronic
1201767290 Y:17583712-17583734 TGAGGCTTTGCCACTGGGCTTGG - Intergenic
1201834263 Y:18322273-18322295 TGAGGCTTTGCCACTGGGCTTGG + Intergenic