ID: 1200216002

View in Genome Browser
Species Human (GRCh38)
Location X:154368550-154368572
Sequence CTGAGGAAGAGGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1610
Summary {0: 1, 1: 0, 2: 10, 3: 153, 4: 1446}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200215984_1200216002 16 Left 1200215984 X:154368511-154368533 CCCAGAATCCAGGGCCCATGACC 0: 1
1: 0
2: 1
3: 16
4: 219
Right 1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG 0: 1
1: 0
2: 10
3: 153
4: 1446
1200215991_1200216002 2 Left 1200215991 X:154368525-154368547 CCCATGACCTGGAGTGGGGCTGG 0: 1
1: 0
2: 2
3: 32
4: 266
Right 1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG 0: 1
1: 0
2: 10
3: 153
4: 1446
1200215987_1200216002 8 Left 1200215987 X:154368519-154368541 CCAGGGCCCATGACCTGGAGTGG 0: 1
1: 0
2: 2
3: 21
4: 216
Right 1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG 0: 1
1: 0
2: 10
3: 153
4: 1446
1200215983_1200216002 24 Left 1200215983 X:154368503-154368525 CCAGCTGGCCCAGAATCCAGGGC 0: 1
1: 0
2: 3
3: 32
4: 252
Right 1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG 0: 1
1: 0
2: 10
3: 153
4: 1446
1200215993_1200216002 1 Left 1200215993 X:154368526-154368548 CCATGACCTGGAGTGGGGCTGGG 0: 1
1: 0
2: 1
3: 48
4: 425
Right 1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG 0: 1
1: 0
2: 10
3: 153
4: 1446
1200215985_1200216002 15 Left 1200215985 X:154368512-154368534 CCAGAATCCAGGGCCCATGACCT 0: 1
1: 0
2: 3
3: 18
4: 215
Right 1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG 0: 1
1: 0
2: 10
3: 153
4: 1446
1200215996_1200216002 -5 Left 1200215996 X:154368532-154368554 CCTGGAGTGGGGCTGGGGCTGAG 0: 1
1: 2
2: 19
3: 156
4: 878
Right 1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG 0: 1
1: 0
2: 10
3: 153
4: 1446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200216002 Original CRISPR CTGAGGAAGAGGAAGGTGGG TGG Intronic
900124035 1:1061760-1061782 CAGAGGAGGAGGAAGGTTGAGGG - Intergenic
900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG + Intronic
900315103 1:2052418-2052440 GGGAGGAAGAGGAAGGGGTGGGG - Intronic
900471963 1:2859488-2859510 GGGAGGAAGAGGAAGGAAGGAGG + Intergenic
900471973 1:2859520-2859542 GGGAGGAAGAGGAAGGAAGGAGG + Intergenic
900471983 1:2859552-2859574 GGGAGGAAGAGGAAGGAAGGAGG + Intergenic
900479161 1:2889887-2889909 CTGGGGTGGAGGGAGGTGGGGGG + Intergenic
900479180 1:2889927-2889949 ATGAGGTGGAGGGAGGTGGGGGG + Intergenic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
900857705 1:5199287-5199309 TTGGGGATGAGGAAGATGGGTGG - Intergenic
901160607 1:7174078-7174100 CTCAGGGAGAGGGAGGTGGGAGG - Intronic
901805607 1:11736557-11736579 TGGAGGAGGAGGAAGGTGCGCGG + Intronic
901813293 1:11779715-11779737 GAGAGGAAGAGAAAGGAGGGTGG + Intronic
902534230 1:17110008-17110030 CTGGGGAATAGGAGGGTGTGGGG - Intronic
902696520 1:18144200-18144222 CTGGGGAAGGAGAAGATGGGAGG - Intronic
902814395 1:18907960-18907982 CTGAAGGAGAGAAAGGTGGAAGG - Exonic
903291674 1:22318077-22318099 CTGAGGCAGAGCCAGGTGTGTGG + Intergenic
903588007 1:24431762-24431784 TTGAGGAAGAGAAAGATGGCTGG - Intronic
903644157 1:24882227-24882249 CTGAGGAAGAACAAAGTTGGAGG - Intergenic
903660192 1:24972408-24972430 ATGAGGAAGAGCAAGATAGGAGG - Intergenic
903814965 1:26058211-26058233 ATCAGTAAGAGGAAGGTGGGGGG + Intronic
903884486 1:26532864-26532886 CTGAGGAAGAGGGAGGAGTGTGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904296439 1:29522362-29522384 CCTAGGAGGAGGAAGCTGGGTGG - Intergenic
904335960 1:29798277-29798299 CTGGGGAAGAGGAGGCAGGGTGG - Intergenic
904483733 1:30810328-30810350 CTAAGGCAGAGGATGGGGGGTGG - Intergenic
904565803 1:31427678-31427700 GTGAGGATGAGGATGGTGTGAGG - Intronic
904596398 1:31648731-31648753 CTGAGGCAGACAGAGGTGGGTGG + Intergenic
904774170 1:32896547-32896569 CAGAGGAGCAGGAAGGTGAGAGG - Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905354162 1:37369438-37369460 CTGAGGAAGAGGTATATGGATGG + Intergenic
905380762 1:37559871-37559893 CTCAGCAAGAGGAATGTGGCAGG + Intronic
905418948 1:37825686-37825708 CGGAGGAAGAGGAAGAGGAGGGG - Intronic
905489366 1:38331680-38331702 CTGAGGAGGAGGAAGGCAGGTGG - Intergenic
905633008 1:39529418-39529440 CTGAGGAAGTGGCAGGTGTGCGG + Intergenic
905893932 1:41533308-41533330 CTGTGGGAGAGGACAGTGGGTGG - Intronic
905914996 1:41678544-41678566 CTGGGGAAGAGGTGTGTGGGTGG - Intronic
906221209 1:44080956-44080978 CTGTGGCAGACCAAGGTGGGTGG - Intergenic
906444240 1:45880735-45880757 CTGTGGGAGACCAAGGTGGGAGG + Intronic
906746780 1:48227822-48227844 CGGAAGAACAGGAAGTTGGGCGG + Intronic
907105396 1:51878337-51878359 CTGAGGAAGAGGGACGGAGGGGG - Exonic
908357575 1:63337688-63337710 CTTTGGGAGAGCAAGGTGGGTGG + Intergenic
908438255 1:64128209-64128231 CTTAGGGAGATCAAGGTGGGAGG + Intronic
908771975 1:67605780-67605802 CTGAGGCAGAGGAAACTGGAGGG + Intergenic
908793003 1:67801959-67801981 GTGAGGAAGAAAAAGGAGGGAGG + Intronic
908896688 1:68909188-68909210 CTCAGGAGGCTGAAGGTGGGTGG + Intergenic
908960785 1:69694741-69694763 AGGAGGAAGAGGAAGTGGGGGGG - Intronic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909585117 1:77281288-77281310 CAGTGGAGGAGAAAGGTGGGTGG - Intergenic
909851413 1:80469406-80469428 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
910561984 1:88600626-88600648 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
910581156 1:88826572-88826594 GTGAGGAGGTGGAAGGGGGGTGG - Intronic
910665290 1:89719273-89719295 AAGAGGAAGAATAAGGTGGGGGG - Exonic
910880665 1:91919791-91919813 CTGAGGAAGGGAAAGGTGGTTGG - Intergenic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911109082 1:94164048-94164070 TTGAGGAAGAGGAATGTGGATGG - Intronic
911296240 1:96119031-96119053 TTGAGGAAGTACAAGGTGGGAGG - Intergenic
911627492 1:100141573-100141595 CTTTGGAAGGGTAAGGTGGGAGG - Intronic
911738306 1:101361275-101361297 CTGGGGAAGAGGTATGTGGCTGG - Intergenic
911883663 1:103271119-103271141 TTGAGGAAGAGGCATGTGGATGG + Intergenic
912191600 1:107347268-107347290 CTTTGGAAGATCAAGGTGGGAGG + Intronic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912411211 1:109481868-109481890 CTGAGGTAGAAGAAGGTGTCTGG + Exonic
912980582 1:114368167-114368189 TAGAGGAAGAGGAAGGAGAGAGG - Intergenic
913582738 1:120243053-120243075 AGGAGAAAGAGGCAGGTGGGAGG - Intergenic
913601101 1:120421733-120421755 CAGAGGAGGAGGAGGCTGGGAGG - Intergenic
913625435 1:120655307-120655329 AGGAGAAAGAGGCAGGTGGGAGG + Intergenic
914085944 1:144454868-144454890 CAGAGGAGGAGGAGGCTGGGAGG + Intronic
914191841 1:145418848-145418870 CAGAGGAGGAGGAGGCTGGGAGG + Intergenic
914362289 1:146945289-146945311 CAGAGGAGGAGGAGGCTGGGAGG - Intronic
914385154 1:147161842-147161864 CTGAGGAAGAGTAAGCTGTTTGG - Intronic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914489385 1:148141794-148141816 CAGAGGAGGAGGAGGCTGGGAGG + Intronic
914564668 1:148854547-148854569 AGGAGAAAGAGGCAGGTGGGAGG - Intronic
914589766 1:149096849-149096871 CAGAGGAGGAGGAGGCTGGGAGG + Intronic
914608158 1:149275695-149275717 AGGAGAAAGAGGCAGGTGGGAGG + Intergenic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914783465 1:150806873-150806895 ATGAGGAAGAGAAAGGTAGACGG + Intronic
914859469 1:151374148-151374170 CTCAGGAGGAGGAAGAGGGGAGG - Intergenic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915069046 1:153250450-153250472 TTGAGGAAGAGTAGGGTGTGAGG + Intergenic
915298788 1:154940401-154940423 GAGAGGAAGTGGAGGGTGGGGGG + Intergenic
915328314 1:155092687-155092709 CTGAGGGAGAGGGGGCTGGGGGG + Intergenic
915444501 1:155967043-155967065 TGAAGGAAGAGGGAGGTGGGAGG - Intronic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
915585979 1:156844261-156844283 CAGAGGAGGAGGATGCTGGGGGG - Exonic
916328717 1:163592287-163592309 CTAAGGGAGAAGAAGGTGGAAGG - Intergenic
916358765 1:163943585-163943607 CTGAGGAGGCTGAAGCTGGGAGG + Intergenic
916630789 1:166610230-166610252 CTCAGCAAGAGGAATGTGGCAGG + Intergenic
916653078 1:166848992-166849014 CTGAGGCTGAGGAAACTGGGAGG - Exonic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916822172 1:168410198-168410220 GGGAGGAAGGGGAAGGTAGGTGG + Intergenic
917168560 1:172143503-172143525 GAGAGGGGGAGGAAGGTGGGAGG - Intronic
917271714 1:173282698-173282720 CTTTGGAAGACCAAGGTGGGTGG - Intergenic
917352778 1:174095130-174095152 CTTTGGAAGACCAAGGTGGGAGG - Intergenic
917359523 1:174160113-174160135 CGGAGGAAGAGGAAGGGCGAGGG - Intronic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
917471388 1:175328798-175328820 CGGATGAAGAGGAGGGAGGGAGG + Intronic
917513156 1:175684903-175684925 CTGAGGAAGAGGAGTGTGTGGGG - Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
917962429 1:180155312-180155334 CTGAGAAACATGAAGGTGGTGGG - Intronic
918421260 1:184366294-184366316 CAGAGGAAGAGCAAGGAAGGAGG - Intergenic
918466605 1:184827305-184827327 CGGAGGATGAGGATGGTGGTTGG - Intronic
918594001 1:186271660-186271682 GTAGGGAAGAGGAAGATGGGTGG + Intergenic
918852285 1:189707923-189707945 CTGAGGAAAAGGAAGAGGAGTGG - Intergenic
919093549 1:193002159-193002181 CTGGAGAACAGGAAAGTGGGAGG + Intergenic
919449355 1:197751943-197751965 AGGAGGAGGAGGAAGGGGGGAGG + Intronic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
919700776 1:200628980-200629002 GTGGGGAAGAGGAAGGTGACTGG + Intronic
919757522 1:201075177-201075199 CTGAGGAACATGAAGATGGTGGG - Intronic
919842552 1:201619759-201619781 ATGAGGAAGAGGCAGGAGGCAGG + Intergenic
920034625 1:203057959-203057981 TTGAGAAGGAGGAGGGTGGGCGG + Intronic
920093180 1:203468720-203468742 CTGAGGAAGAGTCAGGTGGAGGG + Intergenic
920347966 1:205318839-205318861 CTGAGGGAAGGGCAGGTGGGCGG - Intronic
920568391 1:206995698-206995720 CTGAGGAAGAACAAGATTGGTGG + Intergenic
920569898 1:207008646-207008668 CTGAGGCAAAGGAAGGGGGCTGG + Intronic
920916593 1:210262574-210262596 ATGAGGAGAAGGAAGGAGGGAGG - Intergenic
920975276 1:210780042-210780064 TTGAGAAAGCTGAAGGTGGGTGG + Intronic
921036496 1:211383883-211383905 TTGAGGTAGAGGAAGGGGGCTGG - Intergenic
921080371 1:211734281-211734303 CTGAGGAGGAGGAAGAAGAGGGG + Intergenic
921096453 1:211890798-211890820 CTGAGGTACAGGAAGTTAGGAGG + Intergenic
921104073 1:211958961-211958983 CTGAAGGGGAGGAAGCTGGGAGG + Intronic
921137890 1:212278671-212278693 GTGAGGAAGAGGAAACAGGGAGG - Intergenic
921155948 1:212438955-212438977 CTGAGAAGGTGGAGGGTGGGTGG - Intronic
921179652 1:212621990-212622012 TAGAGGAAAGGGAAGGTGGGGGG + Intergenic
921254396 1:213325993-213326015 CTGAAGAAGAGGGAGCTGAGGGG - Intergenic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
921324795 1:213979835-213979857 CGGAGGAAGATGGAGCTGGGAGG + Intergenic
921396863 1:214677818-214677840 AGGAGGAGGAGGAAGGAGGGAGG - Intergenic
921425779 1:214999455-214999477 ATGAGGCAGAGAAAAGTGGGAGG + Intergenic
921945403 1:220882759-220882781 AGGAGGAGGAGGAAGGAGGGAGG - Intronic
921985219 1:221305499-221305521 GTGAGAAAGAGGAAGATGAGAGG + Intergenic
922362280 1:224834115-224834137 CACAGGAGGAGGAAGGAGGGAGG - Intergenic
922479740 1:225931240-225931262 CTTGGGGAGAGGGAGGTGGGAGG + Intergenic
922722736 1:227906829-227906851 ATGAGGAAGAGGGAGGGAGGAGG - Intergenic
923218601 1:231873040-231873062 CTGTGGAAGAAGATGGTGGGAGG + Intronic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923334768 1:232958612-232958634 TTGGGGAAGAAGGAGGTGGGAGG - Intronic
923514189 1:234680855-234680877 CTGAGGAAGTGAAAGATGGAGGG + Intergenic
923728603 1:236529166-236529188 ATGAGGAAGAGTGAGGTGGGAGG + Intronic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
924840684 1:247707178-247707200 CTGGGGAGGAGGCATGTGGGTGG - Intergenic
1062961322 10:1575672-1575694 CTGGGGTGGAGGAGGGTGGGAGG + Intronic
1063057036 10:2517006-2517028 AGGAGGAGGAGGAAGATGGGAGG - Intergenic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1063454070 10:6170884-6170906 CTCAGGAAGAGGAAGATGACAGG + Intronic
1063649430 10:7918449-7918471 TTGAGGAAGAGGCACATGGGAGG + Intronic
1063753324 10:8977012-8977034 CTGGGGATGTGGAAGGAGGGGGG + Intergenic
1064083860 10:12330235-12330257 CTGTGGGAGATCAAGGTGGGAGG - Intergenic
1064370800 10:14750366-14750388 CTTTGGGAGAGCAAGGTGGGTGG + Intronic
1064624747 10:17251045-17251067 CTGGGGTAGAGGCAGGTGGATGG - Intergenic
1064642657 10:17430047-17430069 CTCAGAAAGGGGAAGATGGGAGG - Intronic
1065951852 10:30659469-30659491 TTGAAGCAGAGGAAGGGGGGTGG + Intergenic
1066169522 10:32826977-32826999 TTGGGGAAGAGGTATGTGGGTGG + Intronic
1066237119 10:33496247-33496269 CTGAGGAGGAGGAAGAGGAGGGG + Intergenic
1066357114 10:34695568-34695590 ATGAGGAAGAGGAAGAGGAGGGG - Intronic
1067019869 10:42785965-42785987 CGGAGGAAGAGGACTGTGGCTGG - Intronic
1067037678 10:42932149-42932171 GTGAGGATGTGGGAGGTGGGTGG + Intergenic
1067143144 10:43673032-43673054 CAGAGGAAGAGGTAGGTGGTTGG - Intergenic
1067472774 10:46548496-46548518 CTGAGGAAGGGGAGAATGGGTGG - Intergenic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1067958193 10:50816859-50816881 CAAAGGAAGAGGAATCTGGGAGG + Intronic
1068063845 10:52103397-52103419 CTGAGGGGGAGGAAGGAGAGGGG - Intronic
1068510784 10:57963391-57963413 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1068924075 10:62516753-62516775 GGGAGGAAGAGGAAGCAGGGTGG - Intronic
1069439808 10:68417993-68418015 CTGGGGAAGAAGAAAATGGGTGG + Intronic
1069498528 10:68929188-68929210 CTGTGGGAGACGGAGGTGGGTGG - Intronic
1069498601 10:68929665-68929687 CTTTGGGAGAGCAAGGTGGGCGG - Intronic
1069802583 10:71091242-71091264 CTGAGGGTGAGGAAGGAGGGTGG + Intergenic
1069939031 10:71940812-71940834 TTGGGGAAGAGGAAGGAGAGAGG + Intergenic
1070287302 10:75093226-75093248 CTTAGGTGGAGGATGGTGGGAGG - Intergenic
1070289767 10:75106573-75106595 CAGAGGATCGGGAAGGTGGGGGG - Intronic
1070567590 10:77615424-77615446 CTGAGGCTGCAGAAGGTGGGTGG + Intronic
1070622558 10:78024492-78024514 GTGCGGAAGAGGCAGGCGGGAGG + Intronic
1070707187 10:78648241-78648263 GTTAGGAACAGGAAGGTGGAAGG - Intergenic
1071254008 10:83850482-83850504 CAGAGGAAAAGGAAGGAGCGAGG - Intergenic
1071402119 10:85283647-85283669 ATGAGGAAGTGGAAGGTACGTGG + Intergenic
1072211930 10:93254215-93254237 CTGAGGCAGAGGTTGGTGGGAGG - Intergenic
1072501669 10:96024003-96024025 CTGAGGAAGAGGCAGCTGTAGGG - Intronic
1072687193 10:97544933-97544955 CTGAGGAGGAGGAAAGGGAGGGG + Intronic
1072956737 10:99893490-99893512 CTTTGGAAGACCAAGGTGGGTGG + Intronic
1073150114 10:101305704-101305726 CTGAGGAAGGGGACGGGAGGGGG - Intergenic
1073207923 10:101778489-101778511 CTGGGGCAGAGGAAGAAGGGTGG - Intronic
1073297506 10:102450124-102450146 GTGGGGAGGAGGAAGGAGGGAGG + Exonic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073420243 10:103418654-103418676 GTGGAGCAGAGGAAGGTGGGGGG + Intronic
1073455931 10:103636765-103636787 CAGAGGGAGAGGAAGGAGTGGGG - Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1073897021 10:108173565-108173587 CTGAGGAGGAGAAGGGTGGGGGG - Intergenic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074284302 10:112083513-112083535 CTGCAGAAGAGGAAAATGGGAGG - Intergenic
1074287886 10:112115604-112115626 GAGAGGGAGAGGAAGGTGGCAGG + Intergenic
1074423257 10:113328057-113328079 AAGGGGGAGAGGAAGGTGGGAGG - Intergenic
1074567788 10:114596927-114596949 GTGAAGGAGAGGCAGGTGGGAGG + Intronic
1074644980 10:115439194-115439216 CTGAGGATGAGGAAGAGGAGGGG + Intronic
1074761971 10:116673817-116673839 CTTAGGGAGATGAAGGTGAGTGG + Exonic
1074783310 10:116817980-116818002 GAGAGGAAGAGGAAGCTGGAGGG - Intergenic
1074813600 10:117127968-117127990 CTGAGGAAGGGGAACGTGATTGG - Intergenic
1074968113 10:118511300-118511322 CTGAGGAGGAGGAAAGGGAGGGG + Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075439530 10:122468504-122468526 CTGGGGATGAGGTGGGTGGGTGG + Intronic
1075538688 10:123294342-123294364 CTGAGGAAGATGGGGGTGGGGGG - Intergenic
1075683969 10:124351124-124351146 CTGAGGAGGAGGAAGAAGAGGGG - Intergenic
1075808805 10:125209387-125209409 CTGAGCTAGAGGAATGTGGAAGG - Intergenic
1075918868 10:126193020-126193042 CTTTGGAAGACCAAGGTGGGTGG + Intronic
1075984291 10:126770275-126770297 CTGGGGAAGAGGAAGGAGCCAGG - Intergenic
1076087705 10:127649794-127649816 TTGAGGAAGAGGAAGGGGAACGG - Intergenic
1076239963 10:128897336-128897358 AAGAGGAAGAGGAGGGAGGGAGG + Intergenic
1076736727 10:132462338-132462360 CTGAGGAGGGGGCGGGTGGGGGG + Intergenic
1077103272 11:831480-831502 CTGAGGGAGCTCAAGGTGGGGGG - Intronic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077276205 11:1710266-1710288 CTCAGGAGGCTGAAGGTGGGAGG + Intergenic
1077318642 11:1930170-1930192 CTGCAGACGAGGAAGGAGGGAGG + Intronic
1077400046 11:2350646-2350668 ATGAGCAAGAGAGAGGTGGGGGG - Intergenic
1077480965 11:2814395-2814417 CTGAATAAAAGGATGGTGGGTGG + Intronic
1077498393 11:2897648-2897670 CTGAGAAGGTGTAAGGTGGGCGG + Intronic
1077542944 11:3156054-3156076 CTGAGGCAGAGTAAGGGTGGGGG + Intronic
1077600792 11:3573114-3573136 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1077703215 11:4460666-4460688 CTCAGCAAGAGGAATGTGGCAGG + Intergenic
1077707362 11:4499840-4499862 CTCAGGAGGCTGAAGGTGGGAGG - Intergenic
1077915856 11:6611181-6611203 CGGAGCAAGAGCAAGGTGTGAGG - Exonic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1078226043 11:9392409-9392431 CTTAGGGAGACCAAGGTGGGCGG - Intronic
1078434403 11:11312516-11312538 CTGAGGAGGAGGAAGAGGAGGGG + Intronic
1078997954 11:16723323-16723345 TTGCGGAGGGGGAAGGTGGGAGG + Intronic
1079175708 11:18138098-18138120 CTGAGGTGGATGAAGGTGGAGGG + Exonic
1079181455 11:18197275-18197297 CTGAGGTGGATGAAGGTGGAGGG + Intronic
1079263760 11:18910482-18910504 CTGAGGTGGATGAAGGTGGATGG - Intergenic
1079265999 11:18933867-18933889 CTGAGGTGGATGAAGGTGGAGGG - Exonic
1079320506 11:19447945-19447967 AGGAGAGAGAGGAAGGTGGGAGG - Intronic
1079365012 11:19801463-19801485 AAGAGGAAAAGGAAAGTGGGAGG - Intronic
1079431827 11:20397486-20397508 TTGAGGAAGAGGAAAGGGGAGGG - Intronic
1079619181 11:22532624-22532646 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
1079776497 11:24536959-24536981 CTGAGGAAGAGGAAGGCCCAAGG + Intronic
1079893905 11:26094403-26094425 CTGAGGAACATGAAGGTAGAAGG - Intergenic
1080108643 11:28540637-28540659 CTCAGGAAGAGTGAGCTGGGAGG - Intergenic
1080376506 11:31719013-31719035 CTTTGGGAGAGCAAGGTGGGAGG + Intronic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1080684629 11:34504851-34504873 CTGAGAAAGAGGAGGGAGGGTGG + Intronic
1080822159 11:35817841-35817863 CAGAGCAGAAGGAAGGTGGGGGG - Exonic
1080831299 11:35895645-35895667 CTTTGGAAGGGCAAGGTGGGCGG + Intergenic
1081294674 11:41370891-41370913 CTGAGGAAGAGAAAGGAGAAGGG - Intronic
1081646501 11:44793968-44793990 TTGAGGAACAGGGGGGTGGGGGG + Intronic
1081706642 11:45185906-45185928 CTTAATAAGAGGGAGGTGGGAGG + Intronic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1082054772 11:47804891-47804913 CTTTGGAAGGGTAAGGTGGGAGG + Intronic
1082716320 11:56618518-56618540 CTCAGCAAGAGGAATGTGGTAGG + Intergenic
1082724551 11:56719460-56719482 CTCAGCAAGAGGAATGTGGTAGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082772256 11:57217198-57217220 CCCAGGAGGAGGAAGGTGGTGGG - Intergenic
1082791345 11:57348431-57348453 AGGAGGAGGAGGCAGGTGGGTGG - Intronic
1082797247 11:57387225-57387247 TTGAGGAGGAGGATGGAGGGTGG - Exonic
1082819847 11:57537506-57537528 AAGAGGGAGAGGAAGGGGGGAGG + Intergenic
1082910593 11:58369490-58369512 CTAAGGCAGAGAAAGATGGGGGG + Intergenic
1083065824 11:59922964-59922986 CAGAGGAAGAGGAGGGAGAGTGG + Intergenic
1083375471 11:62216720-62216742 CTCAGCAAGAGGAATGTGGTAGG - Intergenic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083589925 11:63887798-63887820 CTTAGCAGGAGGAAGGTGTGAGG + Intronic
1083618546 11:64037831-64037853 CTGAGGCACAGGGAGGTGGAGGG - Intronic
1083639572 11:64138212-64138234 AGGAGGAAGAGGAGGCTGGGTGG + Intronic
1083864794 11:65447895-65447917 CTGAGGCAGAAGAATTTGGGAGG - Intergenic
1084177974 11:67433316-67433338 TGGAGGAGGAGGAAGGTGAGAGG - Intronic
1084192031 11:67503789-67503811 CCGCGGCAGAGGAAGGCGGGAGG - Intronic
1084256712 11:67947699-67947721 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1084417668 11:69042831-69042853 CTGAGGAAGAGGAACAGTGGTGG + Intergenic
1084690629 11:70723782-70723804 CTGAGGAAGAGGATGTAGAGAGG + Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084816078 11:71647675-71647697 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1085279614 11:75321279-75321301 CTGAGGAAGAGGTGGGGGGATGG - Intronic
1085393467 11:76194417-76194439 CTGAGGATGAGGATGGTGCGAGG + Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085501409 11:77028348-77028370 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
1085765306 11:79276909-79276931 CTGAGGCAGCAGAAGTTGGGGGG - Intronic
1086045253 11:82524820-82524842 GTGAGGAAGTGGCAGGAGGGAGG - Intergenic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086610088 11:88745303-88745325 CTGAGGCTGAGGTGGGTGGGTGG - Intronic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087079158 11:94153021-94153043 CTGAGGAAGAGAAAGCTGAAGGG - Intronic
1087134829 11:94706134-94706156 CTGGGGAAGTGGAAGCAGGGAGG - Intergenic
1087639254 11:100737891-100737913 CTGAGGAAGAGGAATGAGAGGGG - Intronic
1087651640 11:100875320-100875342 CTGATAAAGCGGATGGTGGGAGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088329835 11:108639865-108639887 AGAAGGAAGAGAAAGGTGGGTGG + Intergenic
1088544024 11:110941928-110941950 CTGAGGAGGAGGAAGGGAGGGGG + Intergenic
1088930280 11:114344340-114344362 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089271094 11:117301752-117301774 GTGAAGAAGAGGAAGGTGTTAGG - Intronic
1089291903 11:117442757-117442779 CTGAAGAAGAGGTTGGTGGTAGG + Intronic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089603595 11:119629066-119629088 CAGAGCAGGAGGGAGGTGGGTGG + Intronic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1089943221 11:122440952-122440974 CTGAGGAAGAGCCAGGAGGGGGG - Intergenic
1089968701 11:122674970-122674992 CTTTGGGAGACGAAGGTGGGTGG - Intronic
1089982152 11:122781175-122781197 CTGAGGGAGAGGAAGAGGTGGGG - Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090138230 11:124223212-124223234 CAGAGCCAGTGGAAGGTGGGAGG - Intergenic
1090331903 11:125939216-125939238 CTGAGGAGCAGGAAGGAGTGGGG - Intergenic
1090717769 11:129445252-129445274 CTGACGAGGAAGAAGGTGGGTGG - Intronic
1091198219 11:133749929-133749951 ATGAGGCAGAGGCAGGGGGGAGG - Intergenic
1091214464 11:133892162-133892184 CTGAGAAAGAGGACTGGGGGAGG - Intergenic
1091252341 11:134154423-134154445 CTGAGGAAGAGGACGCAGGAGGG - Intronic
1091300455 11:134503933-134503955 CTGGGGAGGAGGAGGCTGGGAGG + Intergenic
1091424800 12:378216-378238 CTGAGGAGTAGGAATGGGGGTGG + Intronic
1091590542 12:1840433-1840455 ATGTGGAAGAGGGGGGTGGGTGG + Intronic
1091636284 12:2199333-2199355 CTGAGGAGGAGGAAGGGGAGGGG - Intronic
1091660955 12:2383228-2383250 CTCAGGAAAAGAAGGGTGGGTGG + Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091796273 12:3299076-3299098 GAGAGGAAGAAGAAGGTGGCGGG - Intergenic
1091823569 12:3493204-3493226 CTGGGGAAGAGGAAGTGGTGAGG - Intronic
1091980665 12:4861365-4861387 CTCAGGAAGATGACGGTGGGAGG - Intergenic
1092036298 12:5338104-5338126 CTTTGGGAGAGCAAGGTGGGAGG + Intergenic
1092280299 12:7092930-7092952 CTGGGGCAGAGGAGGGTGTGTGG + Intronic
1092426926 12:8382372-8382394 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1092535907 12:9386873-9386895 CTGACAAAGAACAAGGTGGGAGG - Intergenic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092710049 12:11326416-11326438 CTTTGGAAGAGTGAGGTGGGAGG - Intergenic
1092713806 12:11366910-11366932 CTTTGGAAGAGTGAGGTGGGAGG - Intronic
1092717518 12:11406087-11406109 CTTTGGAAGAGTGAGGTGGGAGG - Intronic
1092986615 12:13851929-13851951 CAGAGGAGGAGGAGGGTGGGTGG + Intronic
1093021285 12:14206607-14206629 ATGAGGAAGATGCAGGTCGGGGG + Intergenic
1093031776 12:14295303-14295325 CTGGGGAAGAGGTATGTGGGTGG - Intergenic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093148338 12:15592546-15592568 GTGAGGAAGAGGAAGAGGGCAGG - Intronic
1093242504 12:16695550-16695572 GAGAGGAGGAGGAAGGGGGGAGG + Intergenic
1094063628 12:26340836-26340858 TTGAGGAAGAGGGAAGTGGGAGG + Intronic
1094389706 12:29935591-29935613 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1095080717 12:37996332-37996354 CTCAGCAAGAGGAATGTGGTAGG - Intergenic
1095164982 12:38961802-38961824 TTAAGGAAGAGGAAGCTGAGTGG - Intergenic
1095442907 12:42255794-42255816 CTAAGGAAGAGGTATGTGGGTGG - Intronic
1095732273 12:45519053-45519075 ATGAGGAAGAGCAATGTGGAAGG - Intergenic
1095797047 12:46231288-46231310 CCAAAGAAGGGGAAGGTGGGAGG + Intronic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1096408539 12:51360936-51360958 CTGAGAAAGAGGAAAGGAGGGGG - Intronic
1096463600 12:51836360-51836382 ATGAGGATGAGGATGGTGGGCGG - Intergenic
1096474324 12:51898924-51898946 CTGAGGAAGAGGAGAGTTAGTGG - Intergenic
1096541997 12:52313240-52313262 CTCAGGAATTGGGAGGTGGGAGG + Intergenic
1096632809 12:52939840-52939862 CTTTGGAAGACCAAGGTGGGAGG + Intronic
1096789480 12:54035910-54035932 CTGGGGAAGAGGGAGCAGGGAGG + Intronic
1096886159 12:54721350-54721372 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096886182 12:54721434-54721456 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096977794 12:55709290-55709312 CACAGGAAGAGGAAGGAGGTAGG - Intronic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097172596 12:57125937-57125959 CTTTGGGAGACGAAGGTGGGAGG - Intronic
1097258471 12:57698636-57698658 CAGATGGAGAGGATGGTGGGGGG + Intronic
1097537679 12:60894187-60894209 CTGAGGGAGAGGAGAATGGGAGG - Intergenic
1097620955 12:61938900-61938922 CTCAGAAGGAGGAGGGTGGGAGG + Intronic
1097648839 12:62269662-62269684 CTTTGGAAGACTAAGGTGGGAGG - Intronic
1098371099 12:69760443-69760465 CTGAGCAAGAGGAGAGTTGGAGG - Intronic
1098716119 12:73830074-73830096 CTGAGGGAGAGAAGGGAGGGTGG - Intergenic
1098731083 12:74037613-74037635 CTGGGGGAGAGAAGGGTGGGTGG - Intergenic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1098925215 12:76342006-76342028 CTGAGCAGGTGGGAGGTGGGTGG + Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099170087 12:79353589-79353611 CTGAAGAAGATGGATGTGGGTGG + Exonic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1099619604 12:84984469-84984491 CTCAGGAAGCTGAAGGTGGGAGG - Intergenic
1099650122 12:85415906-85415928 CTGAGGAAAATCAAGGTGGAAGG + Intergenic
1099734224 12:86547304-86547326 AGCAGGAAGAGGAAGGGGGGAGG - Intronic
1100039780 12:90301371-90301393 TTGAGAAAGTGGAGGGTGGGAGG - Intergenic
1100165717 12:91915317-91915339 TGGAGCAACAGGAAGGTGGGTGG + Intergenic
1100383002 12:94079168-94079190 CTGATGAAGAGGAATGGGGTGGG + Intergenic
1100620939 12:96272242-96272264 CTGTGGAAGAGCAAGATGGCAGG + Intergenic
1100936918 12:99680195-99680217 CTTTGGGAGACGAAGGTGGGTGG + Intronic
1101276678 12:103209736-103209758 ATGAGGAAGAGCAAGGCGGAGGG - Intergenic
1101836203 12:108297154-108297176 CTGAGGAACAGGAAGAGGAGGGG - Intronic
1101879511 12:108616854-108616876 CTGTGGAAGGCCAAGGTGGGCGG - Intergenic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102290409 12:111694655-111694677 CAGAGGCAGAGGAAGTTAGGAGG - Intronic
1102394265 12:112574254-112574276 AAGAGGAAGAGGAGAGTGGGAGG + Intronic
1102403084 12:112647790-112647812 TTGAGGAATAGCAAGGAGGGTGG + Intronic
1102654120 12:114466002-114466024 CTGATGAAGAGCAAGGTGTGTGG - Intergenic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1103256287 12:119544122-119544144 CTGAGGGACAGTCAGGTGGGGGG + Intergenic
1103325383 12:120116785-120116807 CTGAGGAGGAGGAGGGGGAGCGG - Exonic
1103525155 12:121562653-121562675 AGGAGGAGGAGGAAGGGGGGAGG + Intronic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103576696 12:121882829-121882851 CTGAGGCAGGAGAAGCTGGGAGG - Intergenic
1103766505 12:123283967-123283989 CTGTGGGAGGGCAAGGTGGGTGG - Intergenic
1103999246 12:124849817-124849839 CTTTGGAAGACCAAGGTGGGAGG + Intronic
1104215481 12:126728901-126728923 CTGAGGAAGAGAAAGGAGAGTGG - Intergenic
1104224967 12:126822655-126822677 CTGAGGCAGAGGAAGGGAGGGGG + Intergenic
1104638668 12:130453402-130453424 CTGAGAGAGAGGATGGTGGAAGG - Intronic
1104725519 12:131073125-131073147 CACAGGAAGAAAAAGGTGGGAGG - Intronic
1104988923 12:132613748-132613770 CTTTGGGAGAGCAAGGTGGGAGG + Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105239487 13:18597442-18597464 CTGAGGAAGGTCAAGTTGGGAGG + Intergenic
1105405127 13:20127371-20127393 GTGAGGGTGAGGAGGGTGGGGGG - Intergenic
1105500293 13:20965895-20965917 CTGTGGGAGACCAAGGTGGGTGG - Intergenic
1105521210 13:21132432-21132454 CTCAGGAAGCTGGAGGTGGGAGG - Intergenic
1105728359 13:23187301-23187323 CTGAGGAAGAGGCTTGTGGATGG - Intronic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1105828333 13:24142647-24142669 ATGAGGAAGAGGAAAGGGGGAGG - Intronic
1105897312 13:24727164-24727186 GTGAGGGAGAGGACAGTGGGTGG + Intergenic
1106220019 13:27738684-27738706 CTGAGGAGGAGGAAGAGGAGGGG - Intergenic
1106247541 13:27962317-27962339 CTGATGAAGAAGGGGGTGGGGGG - Exonic
1106457230 13:29937995-29938017 CAGATGCAGAGGCAGGTGGGTGG + Intergenic
1106593388 13:31116937-31116959 CAGAGGGAGAGGGAGGAGGGAGG + Intergenic
1106898973 13:34334921-34334943 CTGAGGAAGAGGAGAGTGCAGGG + Intergenic
1107829319 13:44360342-44360364 CTTTGGAAGACCAAGGTGGGAGG - Intergenic
1107830107 13:44367589-44367611 CTTGGGAAGAGGGGGGTGGGAGG - Intergenic
1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG + Intergenic
1108467035 13:50726776-50726798 CTGAGGCCCAGGAAGGTAGGGGG - Intronic
1108526860 13:51292917-51292939 CTGAGGAGGAGGGCGGTGGCTGG + Intergenic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1108853319 13:54762569-54762591 ATGAGGAAGAGGAGGGTAGCAGG + Intergenic
1109242131 13:59902329-59902351 CAGAGAAGGAGTAAGGTGGGAGG - Intronic
1109372036 13:61435214-61435236 CTGAGGAAAAGTAAGGTCTGTGG + Intergenic
1110222570 13:73089288-73089310 CTTTGGAAGGGCAAGGTGGGAGG - Intergenic
1110227201 13:73132138-73132160 CAGAGGAAGAGGAAGTTAGTAGG - Intergenic
1110775721 13:79406030-79406052 CTGGGGAAGAGGGAAGGGGGAGG - Exonic
1110857222 13:80310115-80310137 CTCAGGAAGAGGAAAGGGGCTGG - Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1111741504 13:92211344-92211366 ATGAGGAAGAGCAAGATGGATGG - Intronic
1112105095 13:96231499-96231521 CAGAGCAGGAGGAAGGCGGGAGG + Intronic
1112289442 13:98132225-98132247 CTGAGGAAGAATAAGGAGGTGGG - Intergenic
1112311070 13:98317975-98317997 ATGAGGAAGAGGAAGGAGAGAGG - Intronic
1112454148 13:99543033-99543055 CTGAGGAACAGCAAGGTAGCCGG - Intronic
1112924674 13:104659573-104659595 AGGAGGAAGAGGGAGGAGGGAGG - Intergenic
1112986656 13:105458273-105458295 GTGAGGAAGGGGGAGCTGGGGGG - Intergenic
1113149464 13:107246050-107246072 ATGAGATAGAGGAGGGTGGGCGG - Intronic
1113571752 13:111362920-111362942 CTGAAGACAAGGGAGGTGGGGGG + Intergenic
1113734052 13:112664479-112664501 AGAAAGAAGAGGAAGGTGGGTGG - Intronic
1113814503 13:113161842-113161864 CTGAGCAGGAGGAGGATGGGGGG - Intronic
1113814532 13:113161926-113161948 CTGAGCAGGAGGAGGATGGGGGG - Intronic
1113814583 13:113162094-113162116 CTGAGCAGGAGGAGGATGGGGGG - Intronic
1113814624 13:113162220-113162242 CTGAGCAGGAGGAGGATGGGGGG - Intronic
1113814803 13:113162766-113162788 CTGAGCAGGAGGAGGATGGGGGG - Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114732493 14:25008258-25008280 CTGTGGGAGATGAAGGTGGGAGG + Intronic
1114844938 14:26309458-26309480 CTGGGGAAGAGGCAGCTGTGGGG + Intergenic
1115094540 14:29618971-29618993 ATGAGGAGGAGGAAGGGGGAGGG + Intronic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115475554 14:33809901-33809923 TTGAGAAAGATGGAGGTGGGGGG + Intergenic
1115573194 14:34686398-34686420 GTGAGGAAGAAGGAGGTGGCAGG + Intergenic
1115864791 14:37732934-37732956 CTGAGGCAGAGGAAGAAGAGGGG + Intronic
1117152452 14:52903292-52903314 CTTTGGGAGACGAAGGTGGGAGG + Intronic
1117201689 14:53396245-53396267 CTCAGGGAGAGGAAGGTCAGAGG - Intergenic
1117401606 14:55363570-55363592 CTTTGGGAGACGAAGGTGGGTGG - Intergenic
1117496668 14:56312492-56312514 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1117702952 14:58433308-58433330 CTGTGGGAGACCAAGGTGGGCGG - Intronic
1118073460 14:62271431-62271453 CTGGGGAAGAGGTTTGTGGGAGG - Intergenic
1118171983 14:63396335-63396357 AGGAGGAAGAGGAGGGTGGGAGG + Intronic
1118433560 14:65747746-65747768 CTCAGAAAGAGGAGGGTGGGAGG + Intergenic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1118813350 14:69291500-69291522 CTGACCAAGAGCAGGGTGGGTGG - Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1118936272 14:70291679-70291701 GTGAGGTAGAGGGAGGAGGGGGG - Intergenic
1119168517 14:72515259-72515281 TGGAGGAAGAGGAAGGGGAGGGG - Intronic
1119309410 14:73633893-73633915 CTGAAGAGGAGGGAGGAGGGGGG - Intergenic
1119326827 14:73764823-73764845 CTGGGGAGGGGGCAGGTGGGAGG - Intronic
1119435920 14:74597778-74597800 GTGGTGGAGAGGAAGGTGGGAGG - Intronic
1119487737 14:75002809-75002831 CTCAGGCAGAGGAAGGGGGCGGG + Intergenic
1119686113 14:76632672-76632694 CTGAGGAGAGGGAAGGTTGGAGG + Intergenic
1119742582 14:77023893-77023915 CTGAGGATGAGGAAGAGGGGGGG - Intergenic
1119883753 14:78122979-78123001 CAGAGGAAAAGGAGGGTGAGCGG + Intergenic
1120164866 14:81186840-81186862 CTCAGGAGGATGAGGGTGGGAGG + Intronic
1120333272 14:83120906-83120928 TTGAGACAGAGAAAGGTGGGAGG + Intergenic
1120421918 14:84298317-84298339 CAGAGGAAAAGGTAGGAGGGAGG + Intergenic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1120930604 14:89844640-89844662 CTGAGAGTGAGGAAGGTTGGGGG - Intronic
1121004677 14:90482454-90482476 ATGAGAAAGAGGAAAGTGGGAGG - Intergenic
1121466036 14:94116081-94116103 CTGAGGGAGATGGAGGAGGGAGG + Intronic
1121505249 14:94472246-94472268 CTGAGCAAGGGGTAGGTGAGTGG - Intronic
1121550100 14:94792841-94792863 AAGAGAAAGAGGAAGGAGGGAGG + Intergenic
1121720459 14:96105273-96105295 CAGAGGAAGAAGATGCTGGGTGG - Intergenic
1121739864 14:96243725-96243747 CTGAGGCAGAGGAGAGTGGGTGG - Exonic
1122038339 14:98964522-98964544 CTGAGGCACAGGGAGGTGAGTGG - Intergenic
1122477430 14:102020514-102020536 CTGAGAAACAGGAAGAGGGGTGG - Intronic
1122746488 14:103900001-103900023 GTGAAGAAGAGCACGGTGGGTGG + Intergenic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122972431 14:105157896-105157918 CTGAGGATGAGGAGGGTGGTGGG - Intronic
1122987000 14:105217109-105217131 CTGAGGAAGGAGGATGTGGGTGG - Intronic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1202946621 14_KI270726v1_random:33505-33527 CTGAGGACGGGACAGGTGGGCGG + Intergenic
1123548259 15:21355735-21355757 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1123878977 15:24656778-24656800 CTGAAGAAGAGGTGGGCGGGGGG + Intergenic
1124106167 15:26740137-26740159 GTGAGGATGGGGATGGTGGGGGG - Intronic
1124614882 15:31234312-31234334 CTGAGGAAGGGGCAGAAGGGTGG + Intergenic
1125558503 15:40607001-40607023 CTTTGGAAGACCAAGGTGGGTGG - Intronic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126385940 15:48093479-48093501 CTGAGGAAGATGAGGGAAGGGGG - Intergenic
1126785777 15:52176952-52176974 CTGAGGAAGAGTGAGGAGGCAGG - Intronic
1127116277 15:55730884-55730906 ATAAGGAATAGGAAGCTGGGAGG - Intronic
1127691077 15:61398482-61398504 TTGAGGAGGAAGAAGGTAGGAGG + Intergenic
1127691099 15:61398599-61398621 CTGAGGAAGAGAAAGGTTGGTGG + Intergenic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1127938257 15:63665288-63665310 CTTTGGAAGACCAAGGTGGGTGG + Intronic
1128113801 15:65093232-65093254 CTGAGGAAGAGGAGACAGGGAGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128328643 15:66741488-66741510 ATGAGGAGGAGGTGGGTGGGAGG + Intronic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1128520702 15:68372766-68372788 GTGAGGTAGAGTCAGGTGGGAGG - Intronic
1128606806 15:69042640-69042662 CTGAGAAAGAGAAGAGTGGGAGG - Intronic
1128670319 15:69569925-69569947 TTGAGAAACAGGAAGGTAGGAGG - Intergenic
1128714228 15:69895455-69895477 CTGAGCAAGAGGAAGGATGGAGG - Intergenic
1128726800 15:69993977-69993999 CTGAGGAGGAAGAAGGAGAGGGG - Intergenic
1128818644 15:70632191-70632213 CAAAGGAAAAGGAAGCTGGGGGG - Intergenic
1128931065 15:71705294-71705316 GAGAGGAAGAGCAAGGCGGGCGG + Intronic
1129064082 15:72886469-72886491 CTGAAGAGGAGTAATGTGGGTGG + Intergenic
1129069352 15:72937920-72937942 CTGTGGAAGAGGAAGGATGCTGG + Intergenic
1129161647 15:73751291-73751313 CAGAGGCAGAGGAGGCTGGGTGG - Exonic
1129173274 15:73821058-73821080 AAGAGGAAGAGGAAGTGGGGAGG + Intergenic
1129183064 15:73889046-73889068 CTAGGGAGGAGGCAGGTGGGAGG - Intronic
1129897150 15:79117004-79117026 CTGCTGAAGAGGCAGGTGGAAGG + Intergenic
1129996536 15:80011279-80011301 CTTTGGAAGACCAAGGTGGGCGG + Intergenic
1130044842 15:80435576-80435598 CTGAGCCAGAGGAATGTGAGAGG - Intronic
1130308355 15:82730655-82730677 CTCTTGAAGAGTAAGGTGGGAGG + Intergenic
1130361103 15:83187231-83187253 CTGAGGAAGAGTAAGTCTGGGGG - Intronic
1130510652 15:84586471-84586493 GTGAGGAAGAGTAAGGGGGAGGG - Intergenic
1130525627 15:84703772-84703794 CTGAGGAAGAGATATGTGGATGG + Intronic
1130601766 15:85280254-85280276 CAGAGCCAGAGGAAGGTGGGGGG - Intergenic
1130661368 15:85833756-85833778 ATGGGGAAGGGGCAGGTGGGCGG + Intergenic
1131018708 15:89079775-89079797 CTGAGCTAGAAGAAGGAGGGAGG - Intergenic
1131364135 15:91823441-91823463 CAGAGCAGGAGCAAGGTGGGTGG - Intergenic
1131390575 15:92044598-92044620 CCTAGGAGGAGGAAGGTGAGGGG - Intronic
1131405861 15:92163848-92163870 CTGAGGGGGAGCCAGGTGGGGGG + Exonic
1131540337 15:93270153-93270175 ATGAGGAGGAGGAGGGTAGGAGG + Intergenic
1131621438 15:94072295-94072317 ATGAGGAAGTGGAAGGTGTTGGG - Intergenic
1132012900 15:98291708-98291730 AAGAGGAAGAGAAAAGTGGGTGG + Intergenic
1132097170 15:98995821-98995843 GTGAAGAGGAGGAAGGTGGTGGG - Intronic
1132171454 15:99660946-99660968 CTGAAGAAGAACAAGGTGAGAGG + Intronic
1132273254 15:100544639-100544661 CGGAGGAGGAGGCAGGTGCGGGG - Exonic
1202956591 15_KI270727v1_random:82965-82987 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1132590085 16:722751-722773 CTGAGGCTGAGGAAGCTGGCAGG - Exonic
1132681123 16:1142170-1142192 CTGAGGAAGAGGATGGGACGGGG - Intergenic
1132873566 16:2125988-2126010 GGTAGGAAGAGGATGGTGGGGGG + Intronic
1133371335 16:5247992-5248014 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1133392851 16:5423083-5423105 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1133692790 16:8232738-8232760 CAGAGGCAGAGGAAGGTGGGTGG - Intergenic
1134066228 16:11230187-11230209 CTGAGGAGGAAGCAGGTGAGAGG + Intergenic
1134119035 16:11570811-11570833 CTGAGGTAGAAGGAGGTTGGGGG + Intronic
1134136792 16:11681825-11681847 GGGAGGAAGAGGAAGGGGTGGGG - Intronic
1134268448 16:12711974-12711996 CTGAGAATGAGGAAAATGGGAGG - Intronic
1134291290 16:12904109-12904131 CTGTGGTTGCGGAAGGTGGGCGG - Intronic
1134301830 16:12998636-12998658 CTCAGGAAGACCGAGGTGGGAGG - Intronic
1134572560 16:15303846-15303868 CGGAGGAAGTGGGGGGTGGGGGG - Intergenic
1134630735 16:15753960-15753982 CTGTGGAAGGCCAAGGTGGGTGG + Intronic
1134729822 16:16452176-16452198 CGGAGGAAGTGGGGGGTGGGGGG + Intergenic
1134803597 16:17106919-17106941 CTGAGGATGAGGAGGATGGGGGG + Exonic
1134937609 16:18259720-18259742 CGGAGGAAGTGGGGGGTGGGGGG - Intergenic
1135218557 16:20593557-20593579 CTCAGAAGGAGGAAGGTGGGAGG - Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135485321 16:22859960-22859982 TTGAGGAAGAGCAATGTGGCTGG - Intronic
1135586081 16:23672097-23672119 CTGAGGAAGAGTAGGGTCAGAGG + Exonic
1135892128 16:26366668-26366690 CAGAGGGAGAGGGAGGAGGGTGG + Intergenic
1135919913 16:26640581-26640603 CGGAGGCAGATGAAGCTGGGAGG + Intergenic
1135948587 16:26889837-26889859 CTCAGAAAGAGGAGGGTGGAAGG - Intergenic
1136233843 16:28902976-28902998 GTGAGGAGGAAGGAGGTGGGCGG - Intronic
1136381330 16:29897249-29897271 GTGGGGAAGGGAAAGGTGGGGGG - Intronic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136510604 16:30736309-30736331 GTGAGGGAGAGGAAGCTGGCCGG + Exonic
1136702233 16:32154768-32154790 CTGAGGGCGGGGGAGGTGGGCGG - Intergenic
1136765434 16:32772717-32772739 CTGAGGGCGGGGGAGGTGGGCGG + Intergenic
1136802665 16:33097662-33097684 CTGAGGGCGGGGGAGGTGGGCGG - Intergenic
1137063687 16:35814718-35814740 CTGAGGGAGAGCAAGGTTGGTGG - Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137250832 16:46739542-46739564 AGGAGGATGAGGAAGGTGAGGGG - Intronic
1137524863 16:49225957-49225979 CTGAGGAAGAGGAAGAGGACAGG + Intergenic
1137576530 16:49603853-49603875 TGGAGGATGAGGAAGGAGGGAGG - Intronic
1137774383 16:51043235-51043257 TTGAGACAGGGGAAGGTGGGTGG - Intergenic
1138085271 16:54127646-54127668 CTTTGGGAGAGCAAGGTGGGAGG - Intergenic
1138191383 16:55016805-55016827 GTGAGGAAGAGGAAGATGCTGGG - Intergenic
1138276080 16:55736048-55736070 CTGGGGAACAGGAAGGGGAGAGG + Intergenic
1139206745 16:65036418-65036440 CTGTGGAAGAGGAACATGGCAGG - Intronic
1139308184 16:66005917-66005939 CAGAGGCAGAGGAAGGGGTGAGG + Intergenic
1139921322 16:70462254-70462276 CTTTGGAAGACCAAGGTGGGAGG - Intronic
1140205917 16:72933319-72933341 CAGAGGAGTAGGAAGGTGGAGGG + Intronic
1140283500 16:73577551-73577573 CTGAGGGACAGGCAGGTGAGCGG - Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140609612 16:76582216-76582238 TTGAAGAAGAGCAAGGTAGGAGG - Intronic
1140766557 16:78164860-78164882 GTAAAGCAGAGGAAGGTGGGGGG + Intronic
1141115465 16:81304942-81304964 ATGAGGTTGAGGAAGGAGGGAGG + Intergenic
1141182702 16:81765221-81765243 CTGAGGCAGAGGATGGGGAGAGG + Intronic
1141443187 16:84042442-84042464 ATGGGGATGAGGAAGGTTGGGGG - Intronic
1141663314 16:85453279-85453301 GGGAGGTAGAGGAGGGTGGGCGG - Intergenic
1141921802 16:87140469-87140491 CTCCGGAAGAGGAAAGTCGGTGG - Intronic
1142000338 16:87660680-87660702 CTGTGGAAGAGGCAGCTGGTGGG - Intronic
1142018230 16:87763790-87763812 CTGAAGGAGAGCAAGGTGGTAGG + Intronic
1142269166 16:89080162-89080184 CTGAGGAGGAGGAGTGTGGTGGG + Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142325601 16:89412442-89412464 GAGAAGAAGAGGAAGGTAGGAGG - Intronic
1203067822 16_KI270728v1_random:1034939-1034961 CTGAGGGCGGGGGAGGTGGGCGG + Intergenic
1142523623 17:522144-522166 CTGAGGAAGACTGAGGTGGGTGG + Intronic
1142553179 17:753119-753141 CTGACGAAGAAGGAAGTGGGGGG + Intronic
1142553198 17:753210-753232 CTGACGAAGAAGGAAGTGGGGGG + Intronic
1142553218 17:753301-753323 CTGACGAAGAAGGAAGTGGGGGG + Intronic
1142553238 17:753392-753414 CTGACGAAGAAGGAAGTGGGGGG + Intronic
1142606377 17:1083649-1083671 CAGAGGGAGAGGAGGGTGGGAGG + Intronic
1142608929 17:1097117-1097139 CAGAGGAAGAGGCTCGTGGGTGG + Intronic
1142963001 17:3563062-3563084 CTGGGCCAGAGGGAGGTGGGAGG - Intergenic
1142994110 17:3750903-3750925 GAGAGGAGGAGGAAGCTGGGTGG + Intronic
1143023611 17:3928982-3929004 TTGAGGCAGAGGAAGCTGAGCGG - Intronic
1143135427 17:4710185-4710207 CTGGGAAGGAGGATGGTGGGGGG - Intergenic
1143391489 17:6561519-6561541 ATGAGGAAGAGGAGGAGGGGAGG - Intergenic
1143571498 17:7761726-7761748 CTGAGGGAGGCTAAGGTGGGTGG - Intronic
1143592295 17:7892895-7892917 CTGAGGCTGAGGCAGGAGGGTGG - Intronic
1143772638 17:9178450-9178472 ATTAGGAAGAGGAGGGAGGGAGG - Intronic
1143779586 17:9222225-9222247 GTGAGGAGGAGGACGGAGGGAGG - Intronic
1143942486 17:10556959-10556981 CTCTGGAAGACCAAGGTGGGAGG + Intergenic
1144183348 17:12772931-12772953 GAGAGAAAGAGGAGGGTGGGTGG + Intergenic
1144277484 17:13687860-13687882 CTGAGGAAGAGGAAGAAGAGAGG - Intergenic
1144327204 17:14193728-14193750 CTAAGGAAGAGGAACGTGACCGG - Intronic
1144409296 17:14985001-14985023 CTGAGGAGGAGGAAGAGGAGGGG - Intergenic
1144476092 17:15590591-15590613 CTAAGGAAGAGGAACGTGACCGG - Intronic
1144521094 17:15952759-15952781 CCGAGGAAGGTGCAGGTGGGAGG - Intronic
1144758860 17:17695763-17695785 CTTAGGGAGGCGAAGGTGGGAGG - Intronic
1145095191 17:20019131-20019153 CTGTGGGAGACCAAGGTGGGAGG + Intronic
1145414733 17:22705114-22705136 CTGAAGAAGAGGAAGATGACTGG + Intergenic
1145722699 17:27088539-27088561 ATGAGGAGGAGGAAAGAGGGTGG - Intergenic
1145792578 17:27637216-27637238 CTGAGAGAGATGAAGGTGGGGGG + Intronic
1145807456 17:27745082-27745104 CTCAGAGAGATGAAGGTGGGGGG + Intergenic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146178138 17:30679670-30679692 CAGAGGAGCAGGAAGGAGGGGGG + Intergenic
1146191778 17:30774245-30774267 CTTTGGAAGACCAAGGTGGGAGG + Intronic
1146581311 17:34040448-34040470 GAGGGGACGAGGAAGGTGGGGGG + Intronic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1146884013 17:36459013-36459035 CTGAGGCTGAGGAAGGTGAAGGG + Intergenic
1146911584 17:36651744-36651766 CTGGGGGAGAGGTAGGTAGGGGG - Intergenic
1147130009 17:38402087-38402109 CCCAGGAGGAGAAAGGTGGGTGG - Exonic
1147302294 17:39539594-39539616 CTGAGGAAGAAGACTGGGGGAGG + Intronic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147429019 17:40360274-40360296 CTGAGCCAGAGGAAGGTGACCGG + Intergenic
1147581048 17:41627296-41627318 GTGGTGAAGAGCAAGGTGGGTGG - Intergenic
1147624699 17:41892495-41892517 CTGGGGAAGGGGAAGCTGAGGGG + Intronic
1147659187 17:42108109-42108131 CTGAGCAAGAGGAGAGTTGGAGG + Intronic
1147669218 17:42167132-42167154 CTGAGGAAGAGGAGCCTGAGAGG - Intronic
1147710918 17:42463992-42464014 CTGAGGAGGAGGAAGGGGAGGGG + Intronic
1147782361 17:42952758-42952780 CAGAGGAAGAGGAAAATGGACGG + Intronic
1147888632 17:43701514-43701536 CTGACAAACAGGAAGGTGGCAGG - Intergenic
1147970264 17:44215646-44215668 CCGGAGAAGAAGAAGGTGGGGGG - Exonic
1148045084 17:44738535-44738557 CTCAGGAAGATGAAGGTGCAGGG - Intronic
1148062737 17:44847900-44847922 CTGGGGAAGAGGCAGATGGTAGG + Exonic
1148083507 17:44980433-44980455 GTGAGGAAGAGGGAGGAGAGAGG + Intergenic
1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG + Intronic
1148336684 17:46846776-46846798 GTGAGGAAGAAGAGGGAGGGAGG + Intronic
1148444794 17:47731040-47731062 TGGAGGAAGAGGAAGGCTGGGGG - Intergenic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148598723 17:48878004-48878026 CTCAGGAGGCTGAAGGTGGGAGG - Intergenic
1148601222 17:48895606-48895628 TTGAGGGAGAGGAAGGGGTGAGG - Intronic
1148634149 17:49134097-49134119 CTGAAAAGGAGGAAGCTGGGAGG + Intronic
1148741932 17:49897915-49897937 CTAGGGAAGGGGAAGGTGAGAGG + Intergenic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149420687 17:56508175-56508197 CTGAGGAAGAGATAGCAGGGAGG - Intronic
1149445356 17:56708921-56708943 CTGATAAAGAGGGAGGTGGAAGG + Intergenic
1149712942 17:58759069-58759091 GTGGGGGAGTGGAAGGTGGGCGG - Intronic
1149773822 17:59341868-59341890 CTGAGGGAGAGGAAAGGCGGTGG - Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149925981 17:60702832-60702854 CTTTGGGAGATGAAGGTGGGCGG - Intronic
1149978694 17:61291921-61291943 GTGAGGAGGAAGAGGGTGGGAGG + Intronic
1150108443 17:62478688-62478710 GAGGGGACGAGGAAGGTGGGGGG - Intronic
1150330212 17:64288187-64288209 AGGAGGAAGAGGGAGGAGGGAGG + Intergenic
1151808734 17:76423157-76423179 AGGAGGAAGAGGTAGGTGAGGGG + Intronic
1151822292 17:76502812-76502834 CTGAGGCAGAGGGAGATGTGAGG + Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151850718 17:76688105-76688127 CTGAGGAGGAGGACGGTGAGTGG - Exonic
1151923207 17:77173392-77173414 CTGAGGGGGAGGGAGGTGAGAGG + Intronic
1152214435 17:79024332-79024354 GTGCAGAAGAGGAGGGTGGGGGG - Exonic
1152239680 17:79154895-79154917 CTGTGGAAGAGCAGGGAGGGAGG - Intronic
1152245630 17:79183268-79183290 TGGAGGTAGAGGAAGGCGGGCGG + Intronic
1152259536 17:79259619-79259641 CTGATGCAGAGGCAGCTGGGAGG + Intronic
1152368919 17:79873019-79873041 ATTAGGAAGAGGAAGGAGGTCGG - Intergenic
1152457183 17:80423203-80423225 CGAGGGAAGAGGAAGCTGGGAGG + Intronic
1152570321 17:81118823-81118845 CTAGGGAAGAGGAAGCTGGCAGG + Intronic
1152778547 17:82216418-82216440 CTGTGGCAGAGCAAGGTGGGTGG + Intergenic
1152892087 17:82888315-82888337 CTGAGAAAGAAGACGCTGGGAGG - Intronic
1153008029 18:514453-514475 CTGACGAACAGGAAAGAGGGTGG - Intergenic
1153218829 18:2845239-2845261 ATGAAGAAGAGGAAGAGGGGGGG - Intergenic
1153362593 18:4214220-4214242 CTGAGGAACAGGAAGGTGGCAGG + Intronic
1153451431 18:5234391-5234413 CTTTGGAAGACAAAGGTGGGAGG + Intergenic
1153544383 18:6191185-6191207 CTGGGGCAGAGGGAGGTGGCTGG + Intronic
1153659208 18:7311566-7311588 CTGAGGAGGAGGAAGAGGAGAGG + Intergenic
1153666462 18:7371051-7371073 TGGAGGAAGAGGAAGGGGCGCGG + Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1153956849 18:10103783-10103805 GTTAGGAAGAGGAAGGGTGGTGG - Intergenic
1154111936 18:11577692-11577714 AAGGGGAAGGGGAAGGTGGGAGG + Intergenic
1154250881 18:12743697-12743719 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1154373157 18:13784761-13784783 CTGAGGAGGAGGAAGTGGAGGGG - Intergenic
1154449308 18:14461179-14461201 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1154492373 18:14931998-14932020 CAGAGCAGGAGGGAGGTGGGAGG - Intergenic
1154530867 18:15343947-15343969 CTCAGCAAGAGGAATGTGGTAGG + Intergenic
1155323119 18:24638368-24638390 CTGAGAGACAGGAAGGTAGGAGG + Intergenic
1155961237 18:31996914-31996936 CTTTGGAAGACCAAGGTGGGCGG + Intergenic
1156111418 18:33731843-33731865 GTGAGGAGGAGGAAGGGGGAAGG - Intronic
1156442574 18:37206292-37206314 CTGAGGAAGAGGACGGTTTAAGG + Intronic
1156961297 18:43034901-43034923 CAGAGGAGGAGGAAGGTGAGAGG - Intronic
1157403850 18:47407641-47407663 CTGAAGAAGAGGGAGGCAGGAGG - Intergenic
1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG + Intergenic
1158414172 18:57234660-57234682 ATGAGGAAAAGAAAGGTGGGAGG + Intergenic
1158938214 18:62384409-62384431 TGGAGGAAGAGGAAGGAGAGAGG - Intronic
1158962777 18:62600506-62600528 CTGAGGCAGAGGTAGGGGGAGGG + Intergenic
1159753228 18:72328694-72328716 CTGAGGAGGAGGAAGAAGAGGGG + Intergenic
1159877993 18:73832112-73832134 TTGGGGAAGAGGCAGGTGAGAGG - Intergenic
1160210110 18:76870799-76870821 CTGAGAAGCAGGAAGGTGGCTGG + Intronic
1160318199 18:77867313-77867335 CAGGTGGAGAGGAAGGTGGGTGG - Intergenic
1160345762 18:78130560-78130582 CAGAGGAGGAGTGAGGTGGGAGG + Intergenic
1160356183 18:78229797-78229819 ATGAAGAAGAGAAAGGAGGGAGG - Intergenic
1160367116 18:78335649-78335671 ATGAGGCAGAGGGAGGTAGGAGG + Intergenic
1160396117 18:78573356-78573378 CTGAGCAGGATGAAGGGGGGTGG - Intergenic
1160447134 18:78936665-78936687 CTGAGGGCCAGGGAGGTGGGCGG + Intergenic
1160448670 18:78947107-78947129 GAGAGGAAGAGGATGGAGGGAGG + Intergenic
1160680460 19:409635-409657 CTGTAGATGAGGAAGGTGGGGGG + Intergenic
1161012694 19:1968080-1968102 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012730 19:1968188-1968210 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012789 19:1968358-1968380 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161063460 19:2226623-2226645 CTGAGCAAGAGGCAGCTGGACGG + Exonic
1161237973 19:3207348-3207370 CTGAGGTCGAGGATGGTGCGCGG - Intronic
1161289965 19:3488423-3488445 GTGAGGATGAGGGAGGTTGGAGG + Intergenic
1161306435 19:3571800-3571822 TTGAGGAAGAGGAAGTGGGCCGG + Intronic
1161339699 19:3734468-3734490 GGGAGGGAGAGGGAGGTGGGAGG + Intronic
1161488056 19:4546366-4546388 CTGCGGGAGAGGGAGGTGGGTGG - Intronic
1161644677 19:5445726-5445748 CAGAGGAGGAGGGAGGAGGGAGG + Intergenic
1161684807 19:5697490-5697512 CTGAGGCAGAGGGAGGAGGGGGG + Intronic
1161707190 19:5827719-5827741 GGGAGGAAGAGAAAGGAGGGGGG - Intronic
1161839462 19:6670217-6670239 CGGAAGAAGAGGAGGGTGAGTGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1161942222 19:7412496-7412518 CTTTGGGAGACGAAGGTGGGCGG + Intronic
1161957982 19:7506802-7506824 CTGGGGAAGAGGGAGGAGGTGGG - Intronic
1161989036 19:7673500-7673522 ATGAGGAGGAGGAAGGAGGGAGG - Intergenic
1161989717 19:7677761-7677783 CTTGGGAAGGGGCAGGTGGGCGG + Intronic
1162018900 19:7859888-7859910 CACAGGAAGAGGATGGTGGCTGG + Intronic
1162034391 19:7931466-7931488 TGGAGGAAGAGAAAGGTGGCTGG + Intronic
1162034529 19:7931950-7931972 AGGAGGAAGAGGACGTTGGGCGG + Intronic
1162054172 19:8052949-8052971 CTGAGGAAGAGGAGGGGAGTGGG - Intronic
1162158533 19:8696032-8696054 CTGTGGAGGAGGGAGTTGGGAGG + Intergenic
1162314326 19:9928559-9928581 CTGAGGGAGGCCAAGGTGGGTGG + Intronic
1162428994 19:10615617-10615639 AAGAGGAAGAGGAAGGGGAGGGG + Intronic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1162565987 19:11446109-11446131 CTGAGGAGGGGGCAGGAGGGTGG + Intronic
1162920041 19:13895559-13895581 CAGAGGAAGATGAAGGGGTGGGG + Intronic
1162925109 19:13926944-13926966 AGGAGGGAGAGGAAGTTGGGTGG - Intronic
1163035770 19:14567974-14567996 CTGGGGAGGAGGGATGTGGGAGG - Intronic
1163095250 19:15052635-15052657 CTGAGGAAGAAGAATATTGGGGG - Intronic
1163163911 19:15482320-15482342 CTGAGGAGGAGGAAGAGGAGGGG - Intronic
1163203962 19:15788738-15788760 CTGTGGGAGACCAAGGTGGGTGG - Intergenic
1163222430 19:15931142-15931164 GTGAGGAAGAGCAAGATAGGAGG + Intronic
1163282991 19:16328404-16328426 CTGAGAATGGGGAAGGTGAGGGG - Intergenic
1163431594 19:17271231-17271253 CTTAGGGAGGGCAAGGTGGGTGG - Intronic
1163538961 19:17895324-17895346 CTGAGGAAGGAGAATCTGGGAGG - Intergenic
1163704946 19:18806924-18806946 CTTGGGAAGACAAAGGTGGGTGG + Intergenic
1163995310 19:21040079-21040101 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164001905 19:21108180-21108202 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164592650 19:29514642-29514664 CAGATGAAGAGGAAGGAGGGGGG + Intergenic
1164672660 19:30081732-30081754 GTGAGGAAGAGGAAAGTGTTGGG + Intergenic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1164744650 19:30602159-30602181 ATGAGGAATAGGAAGGCAGGTGG + Intronic
1165221455 19:34320073-34320095 CTGAAGTAGAGGAAGCTGTGCGG + Exonic
1165503300 19:36207298-36207320 CTTTGGAAGATCAAGGTGGGCGG + Intronic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165641495 19:37391774-37391796 ATGAGGAAGATGAAGGTGTAGGG + Intronic
1165816124 19:38643376-38643398 TTGAGGGACAGCAAGGTGGGGGG + Intergenic
1165848950 19:38837977-38837999 CTGAGGCAGCGGAAGGGAGGAGG - Intronic
1166032824 19:40145838-40145860 CTTAGGAAGACCAAGGCGGGTGG + Intergenic
1166147774 19:40849218-40849240 TGGAGGAAGAGGATGGAGGGAGG + Intronic
1166151910 19:40880989-40881011 TGGAGGAAGAGGATGGAGGGAGG + Intronic
1166259492 19:41627631-41627653 CTGTGGTGGAGGGAGGTGGGTGG + Intronic
1166330600 19:42076118-42076140 CGGCCGAGGAGGAAGGTGGGAGG + Intronic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1166499929 19:43332843-43332865 CTGTGGTGGAGGGAGGTGGGTGG + Intergenic
1166701078 19:44882043-44882065 CTGAGCATGAGGAAGGAGCGAGG - Intronic
1166746802 19:45145603-45145625 AGGAGGAAGAGGAAGGGGAGAGG + Exonic
1166816055 19:45546910-45546932 CTTTGGAAGACCAAGGTGGGAGG - Intronic
1166872485 19:45879277-45879299 CTCAGGCAGAGGAAGCTGGCAGG - Intergenic
1166930760 19:46299802-46299824 GTGAGGAAGCAGACGGTGGGGGG + Intronic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
1167048992 19:47067478-47067500 CGGAGGAGGAGGAAGGGGAGCGG - Exonic
1167056066 19:47112355-47112377 AGGAGGAGGAGGAAGGGGGGCGG - Intronic
1167233424 19:48298980-48299002 CGGATGGAGAGAAAGGTGGGGGG - Intronic
1167259706 19:48451393-48451415 CTCAGCAAGAGGAAGGGTGGCGG + Intronic
1167276521 19:48543445-48543467 ATGAGCAAGATGAGGGTGGGAGG + Intergenic
1167323923 19:48812651-48812673 CTGTAGAATAGGAAGGTGGCTGG - Intergenic
1167443185 19:49521776-49521798 TTCAGGAAGGGTAAGGTGGGAGG - Intronic
1167586914 19:50380574-50380596 CGGAGTAAGAGGAAGGGGAGAGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167775633 19:51552979-51553001 AGGAGGAAGAGGAGGGGGGGAGG + Intergenic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1167915187 19:52734651-52734673 CTGAGGAGGGGGAGGCTGGGAGG + Intronic
1167955108 19:53058038-53058060 ACGAGGAGGAGGGAGGTGGGGGG + Intergenic
1167960760 19:53102903-53102925 ACGAGGAGGAGGGAGGTGGGGGG + Intronic
1167971871 19:53192852-53192874 ACGAGGAGGAGGGAGGTGGGGGG + Intronic
1168345522 19:55648613-55648635 CTAAGGAAGAGGCAGGTGCAGGG - Exonic
1168411272 19:56141617-56141639 CTGAGGGAGAGGACGGGGGAGGG + Intronic
1168498728 19:56875686-56875708 CTGAGTAGGAGTAAGGAGGGAGG + Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168663321 19:58183898-58183920 CTGAGGAAACCGAAGTTGGGAGG - Intronic
925025730 2:605902-605924 GTGAGCAAGTGGAGGGTGGGCGG - Intergenic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925162220 2:1693867-1693889 CTCAGGCAGAGCAAGCTGGGAGG + Intronic
925288964 2:2734026-2734048 CTGGGGTAGAGAAAGGAGGGTGG - Intergenic
925372923 2:3360892-3360914 CTCAGGAAGAGGAAAGTATGGGG + Intronic
925377760 2:3400461-3400483 CTGAGGCAGGGGCAGCTGGGGGG - Intronic
925574211 2:5343824-5343846 CTGAGGAACGGCCAGGTGGGTGG - Intergenic
925636563 2:5946774-5946796 CTAAGGGACAGGGAGGTGGGGGG - Intergenic
925774319 2:7319190-7319212 CTGAGGGAGAGGGAGGTAGAAGG - Intergenic
925818431 2:7776074-7776096 CTTAGGAAGATGAGGGTGGTCGG + Intergenic
926011959 2:9415651-9415673 CTGAGGAAGTGGCAGTAGGGAGG + Intronic
926417660 2:12665651-12665673 CTGAAGTAGAGGAAGGAAGGTGG - Intergenic
926429102 2:12767703-12767725 CTGAGGAAGATGGAGGTGGTAGG - Intergenic
927031776 2:19127759-19127781 CAGAGAAAGAGGCAGGTGTGAGG + Intergenic
927333744 2:21896343-21896365 CTGGGGAGGGGGAAGGTTGGGGG + Intergenic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
927541132 2:23912251-23912273 CTTAGGAAGGCCAAGGTGGGAGG + Intronic
927704942 2:25291161-25291183 CTGAGGAACTGGAAGGAGCGAGG - Intronic
927812219 2:26186437-26186459 CTGAGGAAGAGGAAGTCTTGAGG + Intronic
927887779 2:26729035-26729057 CTGGGGATGAGGAAGGGGAGTGG - Exonic
927999124 2:27507658-27507680 CTGGGGCAGAAGAAGATGGGAGG - Intronic
928325369 2:30315370-30315392 CGGAGGAAAAAGAAGGTGTGAGG + Intronic
928427640 2:31192259-31192281 AGGTGGAAGAGCAAGGTGGGAGG - Intronic
928605569 2:32942550-32942572 CTGAGGGAAAGGAAAGTGAGAGG - Intergenic
928896281 2:36267386-36267408 AGGAGGAAGAGGAAGAGGGGAGG + Intergenic
929188224 2:39117269-39117291 CTTTGGGAGAGCAAGGTGGGCGG - Intronic
929248960 2:39732010-39732032 CTCGGGAAGAGGAATGTGGATGG - Intergenic
929399772 2:41566548-41566570 CTGCAGAAGAGGCAGGTTGGAGG - Intergenic
929432364 2:41897974-41897996 CAGAGGAACAGTCAGGTGGGTGG - Intergenic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929667118 2:43841698-43841720 CTGGGTAAGAGGAAGGGGAGAGG - Intronic
929913075 2:46109134-46109156 CTGAAGAAGAAGAAAGTTGGGGG - Intronic
930049843 2:47206480-47206502 CTGGGCAAGAGGGAGGTGGGTGG + Intergenic
931202400 2:60111024-60111046 CTGAGGTAGAGGAAGGGGAGTGG + Intergenic
931331327 2:61287543-61287565 AAGAGGAGGAGGAAGGTGAGGGG - Intronic
931393517 2:61865272-61865294 CTGAGTAAGAAAAAGGTGGCTGG + Intergenic
931482522 2:62656190-62656212 ATGGGGAACAGGAAGGTTGGTGG - Intergenic
931622648 2:64226757-64226779 CAGAGCAAGAGGAAGGCGAGAGG - Intergenic
931627452 2:64269831-64269853 CTGAGGAGGAGGAAGAGGAGGGG - Intergenic
931730819 2:65151884-65151906 CTGGAGAAGACGCAGGTGGGTGG + Intergenic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
932086398 2:68766378-68766400 CTGAGGAAGAGGCAGCTCTGGGG + Intronic
932303556 2:70685811-70685833 GGGAGGAAGAGGGAGGTGGGAGG - Intronic
932309653 2:70729301-70729323 CTGAGGCAGAGGGAGGAAGGAGG - Intronic
932501941 2:72190137-72190159 CTCAGGGAGGTGAAGGTGGGAGG - Intronic
932600280 2:73119379-73119401 CTCAGCAAGAGGAATGTGGTAGG + Intronic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
932905634 2:75747097-75747119 CTTTGGAAGACCAAGGTGGGTGG - Intergenic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
933260297 2:80124757-80124779 CAGAGGAAGAGGAAGGGGAGGGG - Intronic
933766935 2:85716011-85716033 CTAAGGAAGAGTAAGGCTGGAGG + Intergenic
933775791 2:85770434-85770456 CTGGGGAAAAGGGGGGTGGGTGG + Intronic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
934551743 2:95267093-95267115 CGGTGGACGTGGAAGGTGGGGGG + Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
934927425 2:98391344-98391366 CTGAGCAAGCAGCAGGTGGGCGG + Intronic
934947091 2:98550012-98550034 CAGAGGAAGAGGAATGGGAGGGG + Intronic
934949163 2:98564545-98564567 CAGAGGAAGGGGGCGGTGGGGGG + Intronic
935315129 2:101825424-101825446 CTGAGGGTAAGGAAAGTGGGTGG + Exonic
935469694 2:103443492-103443514 CTGAAGGATAGGAAGGAGGGTGG + Intergenic
935473661 2:103490807-103490829 CTGAGGAAGAGGAAGAAGAGGGG - Intergenic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
935655114 2:105415372-105415394 CTAAGGAAGAGAATGGAGGGAGG + Intronic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
936061954 2:109300673-109300695 AGGAGGAAGAGGAAGGTGGTTGG - Intronic
936064081 2:109317454-109317476 CAGGGGAAGAGCAGGGTGGGGGG - Intronic
936067006 2:109339932-109339954 GTGAGGAGGAGGCAGGTGGTTGG + Intronic
936086910 2:109475498-109475520 ATGAGGCAGAAGTAGGTGGGTGG - Intronic
936155366 2:110043348-110043370 CTGAGGATTAGGAAGGGTGGGGG - Intergenic
936189314 2:110328065-110328087 CTGAGGATTAGGAAGGGTGGGGG + Intergenic
936395561 2:112125630-112125652 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
936461976 2:112720992-112721014 CTGAGGGAGAGGAGAGTGGCTGG + Intergenic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
936796714 2:116215012-116215034 CTAAGGCAAAGCAAGGTGGGTGG - Intergenic
936918099 2:117660774-117660796 CTGAGGAACAAGAAGGAGGCTGG - Intergenic
937062552 2:118991369-118991391 CTTTGGGAGACGAAGGTGGGAGG - Intronic
937065980 2:119018032-119018054 CCGAGGAAGAGGAATGCAGGAGG + Intergenic
937118685 2:119427323-119427345 TTGAGGAGTTGGAAGGTGGGAGG - Intergenic
937305288 2:120867146-120867168 AAGAGGAAGAGGAAGCTGGGTGG - Intronic
937833250 2:126445958-126445980 CAGAGGAAGAGAAAGGGAGGAGG + Intergenic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938074893 2:128326535-128326557 CTGCAGAAGAGGGAGGTGGCAGG + Intergenic
938087363 2:128410213-128410235 CTGAGGGAAAGGGTGGTGGGTGG + Intergenic
938130462 2:128710998-128711020 TTGAGAAAGAGGAAGGGGGCAGG + Intergenic
938682161 2:133703023-133703045 CTCTGGAGGAGGAAGGTGGGAGG + Intergenic
938890409 2:135698767-135698789 CCGAGGAAGAGAAGAGTGGGGGG + Intronic
938949548 2:136244107-136244129 CTGAGGAAGAGAGAGGCGGCTGG + Intergenic
939018677 2:136932702-136932724 CTGAGGAGGAGGAAGAGGAGGGG + Intronic
939853362 2:147326636-147326658 CTGAGGAGGAGGAAGAGGAGGGG - Intergenic
939979394 2:148760133-148760155 CTGAGGCTGAGGGAGGAGGGAGG + Intronic
940062196 2:149584803-149584825 CTTAGGGAGGCGAAGGTGGGTGG + Intronic
940062699 2:149590024-149590046 TAGAGGTATAGGAAGGTGGGAGG - Intergenic
940179765 2:150918923-150918945 CTTAGGAAGGCCAAGGTGGGTGG + Intergenic
940194639 2:151080195-151080217 CTGAGAGAGAGGACGGTGGGTGG + Intergenic
940257895 2:151750451-151750473 CTGTGGGAGATCAAGGTGGGAGG + Intergenic
940696378 2:156984673-156984695 AGGAGGAGGAGGAAGGAGGGAGG + Intergenic
940847476 2:158657178-158657200 CTGAGTAAGAGGAAAGTAGGTGG - Intronic
941144341 2:161824929-161824951 CTGAGGAGGAGGAAGAGGAGGGG - Intronic
941640178 2:167978756-167978778 ATCAGGAAGAGGAAGATGGGAGG - Intronic
941815173 2:169788868-169788890 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
942135255 2:172919028-172919050 CTGCAGAGGAGGAGGGTGGGAGG + Intronic
942168412 2:173265227-173265249 CTGAGGAAGCTGAGGCTGGGAGG + Intronic
943317840 2:186411689-186411711 TTGGGGAAGAGGTATGTGGGTGG - Intergenic
943366240 2:186970100-186970122 TGGAGGATCAGGAAGGTGGGGGG - Intergenic
943437216 2:187881104-187881126 ATGAGGAAGAGAAAGAAGGGGGG + Intergenic
943470783 2:188291950-188291972 ATTAGGAAGAGGAGGGAGGGGGG + Intronic
944142051 2:196467369-196467391 GGGAGGGAGAGGAAGGAGGGAGG + Intronic
944340842 2:198596929-198596951 CTGAGGAAGACCAAGTTTGGTGG + Intergenic
944366063 2:198920665-198920687 CTGAGAAAAAGAAAGCTGGGAGG + Intergenic
944427265 2:199596162-199596184 CTTATAAAGAGGAAGATGGGAGG + Intergenic
944498443 2:200332488-200332510 CTGTGGGAGACCAAGGTGGGAGG - Intronic
944735367 2:202558073-202558095 CTGTGGAAGACTGAGGTGGGTGG + Intronic
944931645 2:204526268-204526290 CTGAGGATTAGCATGGTGGGTGG - Intergenic
945011483 2:205468631-205468653 CTGAGGAAGAGGTAGGGGAATGG + Intronic
945032746 2:205680882-205680904 GGGAGGAAGAGGAAGGAGGGAGG + Intergenic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945291818 2:208134569-208134591 CTAAGAAGCAGGAAGGTGGGTGG - Intergenic
945642264 2:212444466-212444488 CTGGGGAAGAGGTATGTGGGTGG + Intronic
945868125 2:215199435-215199457 CTGAGACAGAGGCTGGTGGGTGG + Intergenic
945948419 2:216015866-216015888 CTGAGATAGAGGAGTGTGGGAGG + Intronic
945990012 2:216388271-216388293 CTGACTAACAGGCAGGTGGGAGG - Intergenic
946025264 2:216668227-216668249 GGGAGGATGAGGTAGGTGGGAGG - Intergenic
946074925 2:217065836-217065858 CTGGAGAAGAGGAGGCTGGGAGG - Intergenic
946252859 2:218424060-218424082 GTGAGGAAGAGGAAGTGGAGAGG - Intronic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946305331 2:218853807-218853829 TTCAGGAAGAGGAAAGTGGGCGG - Intergenic
946354274 2:219175255-219175277 CTTTGGAAGACCAAGGTGGGTGG + Intronic
946527782 2:220539341-220539363 CTGAGGAAGAGATACGTGGGTGG - Intergenic
946587924 2:221211187-221211209 CTGAGGAGGAGGAAGAGGAGGGG + Intergenic
946881901 2:224185012-224185034 GTGAGGCAGAGGAGGGTGGATGG - Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947232674 2:227903647-227903669 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232682 2:227903664-227903686 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232690 2:227903681-227903703 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947373764 2:229474789-229474811 CTGAGAAGGAGCAAGGTGGTGGG - Intronic
947605885 2:231484850-231484872 CTGAGGAAGAGGAGGAGGAGGGG - Intergenic
948078683 2:235187832-235187854 AAGAGGAAGAGGAAGAGGGGAGG - Intergenic
948233218 2:236366794-236366816 GAGAGGAGGAGGAAGGAGGGAGG - Intronic
948347678 2:237312913-237312935 GAGAGGAAGAAGGAGGTGGGAGG - Intergenic
948543378 2:238705597-238705619 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
948667486 2:239545664-239545686 CTGAGGGAGGGGAAAGTGTGAGG - Intergenic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948924823 2:241088713-241088735 GGGAGGAAGAGGCAGGGGGGTGG + Exonic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG + Intronic
1169621130 20:7507735-7507757 CTTTGGAAGACCAAGGTGGGTGG + Intergenic
1169660429 20:7972910-7972932 CTGGGGAGGAGGTGGGTGGGAGG - Intergenic
1169800059 20:9505665-9505687 GTGATGAAGAGGAGGCTGGGAGG + Intergenic
1170594143 20:17792845-17792867 CTGAGGGAGGGGAGGTTGGGTGG - Intergenic
1170797818 20:19565047-19565069 CTTTGGAAGACTAAGGTGGGTGG - Intronic
1171399071 20:24860005-24860027 GTGAGGAAGAGGAACGGGGATGG - Intergenic
1171958284 20:31475859-31475881 AGGAGGAAGAGGCAGGAGGGCGG - Intronic
1172134800 20:32679731-32679753 CTGAGGGAGAGGAAACTGGAGGG + Intergenic
1172184618 20:33023604-33023626 GTGGGGCAGAGGAAGGAGGGGGG - Exonic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172608422 20:36231415-36231437 CTCAGGCTGAAGAAGGTGGGAGG + Exonic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1172647143 20:36477652-36477674 CTGAGGCTGAGGCAGGTGGAGGG - Intronic
1172773460 20:37394596-37394618 CTGGGGAAGAGGAAGAAGCGGGG - Intronic
1172797512 20:37551404-37551426 CTTTGGGAGACGAAGGTGGGTGG - Intergenic
1172963225 20:38813454-38813476 CTGATGGAAGGGAAGGTGGGAGG + Intronic
1173059708 20:39650038-39650060 CCTAGGAAGAGAGAGGTGGGAGG - Intergenic
1173080010 20:39856973-39856995 AAGAGGAAGAGGAAGATGGGAGG - Intergenic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1173200785 20:40953644-40953666 CTAAGGATGAGGAAGTTGGTAGG + Intergenic
1173344280 20:42184492-42184514 AGGAGGAGGAGGAAGGGGGGAGG - Intronic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173461409 20:43246262-43246284 CTCAGGATGAGGGAGGTGAGAGG + Intergenic
1173526737 20:43738525-43738547 CTTTGGAAGGGTAAGGTGGGTGG + Intergenic
1173680647 20:44878462-44878484 CTGAGGAAGAACAAAGTTGGAGG + Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173790934 20:45827357-45827379 CTGGGGAGCAGGGAGGTGGGAGG - Intronic
1173955028 20:47024982-47025004 CTGAGGAAGAGGAAGAAGATAGG - Intronic
1174009371 20:47437201-47437223 CTTAGGGAGATCAAGGTGGGTGG + Intergenic
1174063530 20:47848748-47848770 CAGAGGAAGAGGAAGGGACGTGG - Intergenic
1174535509 20:51248287-51248309 ATGAGGGTGAGGGAGGTGGGAGG - Intergenic
1174808248 20:53623460-53623482 CTGAGGAGAAGGACGGAGGGTGG + Intergenic
1174861148 20:54092479-54092501 CTGAGCTAGAGGCAGGTGGGTGG - Intergenic
1175080854 20:56419181-56419203 CTTAAAAGGAGGAAGGTGGGAGG + Intronic
1175554342 20:59837449-59837471 CTGAGGCAAAGAAAGGAGGGAGG - Intronic
1175691897 20:61071521-61071543 CTGAGTAAGTGGAGGGTGAGAGG + Intergenic
1175711146 20:61222056-61222078 ATGGGGAAGAGGAAGGCAGGAGG + Intergenic
1175828862 20:61951178-61951200 CCCAGGAAAAGGAAGGTGGGGGG - Intergenic
1175853018 20:62103977-62103999 GGGAGGAACAGGGAGGTGGGCGG + Intergenic
1175895442 20:62333806-62333828 ATGAGCCAGAGGAAGGTGGCGGG + Intronic
1175950432 20:62580691-62580713 CTGTGGAGCAGGGAGGTGGGAGG + Intergenic
1176057096 20:63154708-63154730 GGGAGGAAGAGGGAGGAGGGAGG - Intergenic
1176057113 20:63154760-63154782 GGGAGGAAGAGGGAGGAGGGAGG - Intergenic
1176283522 20:64328524-64328546 CTGGAGGAGAGGAAGGTGTGGGG + Intergenic
1176446864 21:6829200-6829222 CTGAGGAAGGTCAAGTTGGGAGG + Intergenic
1176674051 21:9760642-9760664 CTTAGTAGGAGGAAGGAGGGGGG - Intergenic
1176696912 21:9989314-9989336 CAGAGAAAGATGATGGTGGGGGG - Intergenic
1176766545 21:13024517-13024539 CTCAGCAAGAGGAATGTGGTAGG - Intergenic
1176825035 21:13694226-13694248 CTGAGGAAGGTCAAGTTGGGAGG + Intergenic
1176902854 21:14464512-14464534 CTGAAGAAGAGGCAGTGGGGAGG + Intergenic
1176984774 21:15422986-15423008 CTCAGAAAGAGGAGTGTGGGAGG + Intergenic
1177197421 21:17918087-17918109 CTGAGGATAAGGAAGGTGTTAGG + Intronic
1177198106 21:17924075-17924097 CTGAGGAAGCTAAAGGTGAGAGG + Intronic
1177395953 21:20536507-20536529 ATCAGGCAGAGGAACGTGGGAGG - Intergenic
1177449406 21:21245765-21245787 CTGAGGGAGAGGAAGTTAGGTGG + Intronic
1177606737 21:23389077-23389099 CTGAGGAAGAGTAAGCAGGGTGG + Intergenic
1177608999 21:23421658-23421680 CTTTGGGAGACGAAGGTGGGAGG + Intergenic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1178790682 21:35697322-35697344 TTGAGGGAGAGGAAGGGGAGGGG - Intronic
1179174883 21:39001080-39001102 CTGAGGCAGTAGAGGGTGGGTGG - Intergenic
1179477062 21:41653744-41653766 TTGAGGAAGAGGAAGATGTCAGG - Intergenic
1179799089 21:43802580-43802602 CTGCAGACAAGGAAGGTGGGTGG - Intronic
1179904944 21:44418021-44418043 CTGAGGAGGATGAAGGGGGGCGG - Exonic
1180228875 21:46414478-46414500 AGGAGGAAGAGGAGAGTGGGCGG - Intronic
1180228977 21:46414880-46414902 AGGAGGAAGAGCAGGGTGGGTGG - Intronic
1180513667 22:16118965-16118987 CTCAGCAAGAGGAATGTGGTAGG - Intergenic
1180904894 22:19402860-19402882 CTTTGGAAGATGCAGGTGGGAGG + Intronic
1180930740 22:19589141-19589163 CTTTGGGAGACGAAGGTGGGAGG - Intergenic
1181331746 22:22098274-22098296 CTGAGGAGGATGAAGGAGAGAGG - Intergenic
1181600794 22:23950820-23950842 CTTAGGAGGAGTAAGTTGGGAGG - Intergenic
1181607718 22:23990515-23990537 CTTAGGAGGAGTAAGTTGGGAGG + Intergenic
1182299765 22:29330953-29330975 CCGAGGAGGAGGAAGGCGTGTGG - Intronic
1183029405 22:35092190-35092212 CTGAGGAAGAAGCAGGTTTGGGG - Intergenic
1183489228 22:38107964-38107986 CAGCGGAAGAGGGTGGTGGGTGG - Intronic
1183598284 22:38825215-38825237 CTGGGCATGAGGAAGATGGGTGG + Intronic
1183649832 22:39147528-39147550 CTGAGAAAGAGGGTGGGGGGTGG - Intronic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
1184204278 22:42991377-42991399 CTCAGGCTGAGAAAGGTGGGAGG - Intronic
1184339514 22:43878658-43878680 GTGATGGAGAGGGAGGTGGGAGG + Intergenic
1184523297 22:45008074-45008096 CTAGGGAAGTGGAAGGTGGTGGG + Intronic
1184569251 22:45311431-45311453 CTGAGCTGAAGGAAGGTGGGAGG + Intronic
1184691321 22:46118616-46118638 CTGAGCGGGAGGAAGGAGGGTGG - Intergenic
1184694384 22:46131478-46131500 CTGAGGTGGAGGGAAGTGGGTGG + Intergenic
1184765291 22:46569128-46569150 CCCAGGGAGAGGAAAGTGGGCGG + Intergenic
1185184535 22:49390586-49390608 GTGGGGAGGAGGAAGGTGAGAGG - Intergenic
1203247492 22_KI270733v1_random:85027-85049 CTGGGGGGGAGGGAGGTGGGCGG - Intergenic
949359104 3:3213043-3213065 CTCAGGAAGCCGAGGGTGGGAGG - Intergenic
949638992 3:6014145-6014167 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
949930568 3:9074977-9074999 CAGAGGAAGAGACAGGTGGGGGG + Intronic
949970038 3:9396886-9396908 CGAAGGAAGGGGAGGGTGGGAGG + Intergenic
950094312 3:10319877-10319899 GAGAGGGAGAGGAAGGGGGGAGG + Intronic
950094334 3:10319954-10319976 GAGAGGGAGAGGAAGGGGGGAGG + Intronic
950098925 3:10345643-10345665 CTGAGGAAGTGGAGGGAGTGAGG - Intronic
950294253 3:11814717-11814739 CTTTGGAAGACCAAGGTGGGAGG + Intronic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
950571786 3:13804914-13804936 CTGAGGAGGAGGAAGAGGAGGGG - Intergenic
951768887 3:26232406-26232428 TAGAGGAAGATGAGGGTGGGAGG - Intergenic
951886736 3:27532047-27532069 CTCAGCAAGAGGAATGTGGTAGG - Intergenic
951906189 3:27710204-27710226 CTGAGGGAGAGAAAGGTCGGGGG - Intergenic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
953230263 3:41058369-41058391 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
953230269 3:41058386-41058408 GGGAGGAAGAGGGAGGAGGGAGG + Intergenic
953407851 3:42668473-42668495 GTGAGAATGAGGGAGGTGGGGGG - Intergenic
953708313 3:45247800-45247822 GAGAGCAAGAGAAAGGTGGGAGG - Intergenic
953753648 3:45629006-45629028 GAGAGGAAGAGGAAGCGGGGAGG + Intronic
953982420 3:47419390-47419412 CTGAGGATGAGGAACTTTGGAGG - Exonic
954035382 3:47848414-47848436 CTGGGGACCAGGCAGGTGGGAGG + Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954613173 3:51956756-51956778 CTGAGCAGGAGAAAGGAGGGTGG + Exonic
955025524 3:55163923-55163945 CAGAAGAAGAGGAAGGCAGGAGG - Intergenic
955032545 3:55234804-55234826 CTCAGGAGGGGGATGGTGGGAGG - Intergenic
955410612 3:58653241-58653263 CTGAGAAGGAGCCAGGTGGGAGG + Intronic
955833643 3:63030427-63030449 AGGAGGAAGAGGAAGGGGAGGGG + Intergenic
955974763 3:64469242-64469264 CTGGGAAAGAGGAAGATGGCAGG + Intergenic
955985557 3:64570572-64570594 CTTAGGTAGGGGAAGTTGGGAGG + Intronic
956731873 3:72203860-72203882 CAGAGGAAGAGGAAGGAAGTGGG + Intergenic
956738738 3:72258777-72258799 CAAAGAAATAGGAAGGTGGGGGG + Intergenic
956747935 3:72324221-72324243 CAAGGGAAGAGGAAGGTGGCAGG - Intergenic
957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG + Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
959034667 3:101346968-101346990 AGGAGGAGGAGGAAGGAGGGAGG + Intronic
959181181 3:102982531-102982553 CTAAGGAAAAGGCAGGTTGGGGG - Intergenic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
959497525 3:107068763-107068785 GTGAGGAAAAAGAAGGTAGGGGG - Intergenic
959498588 3:107079168-107079190 CTGGGGCAGAGGAAGGAGGCAGG + Intergenic
959943255 3:112101798-112101820 CTGAGAAAGGCGTAGGTGGGAGG - Intronic
960320236 3:116226033-116226055 CTGAGGAAAAGGAAGATTTGAGG - Intronic
960494657 3:118360124-118360146 TTGGGGAAGAGGTAAGTGGGTGG - Intergenic
960788500 3:121400214-121400236 CTGGGTGAGAGGTAGGTGGGAGG - Intronic
960807565 3:121598757-121598779 CTGTGGGAGACCAAGGTGGGAGG - Intronic
960865456 3:122194941-122194963 AGGAGGAAGAGGAAGGGAGGTGG - Intronic
961021300 3:123509475-123509497 CACAGGAAGGGGAAGGTTGGAGG - Intronic
961282511 3:125775020-125775042 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
961569202 3:127786058-127786080 ATGTGGAGGAGGAAGGTGAGAGG + Intronic
961672045 3:128540298-128540320 CTGAGGAGGAGTAACGTGGGTGG - Intergenic
961869382 3:129976783-129976805 AAGAGGAAGAGGAAGAAGGGGGG + Exonic
961955580 3:130799615-130799637 CTCAGAAGGAGGATGGTGGGAGG + Intergenic
962203982 3:133420189-133420211 CTCAGGAAAAGGGAGTTGGGAGG + Intronic
962346550 3:134623329-134623351 CTGTGAATGAGGAAAGTGGGTGG - Intronic
962954491 3:140251828-140251850 CTGAGGAAGTGGAATCTGTGTGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963021860 3:140879438-140879460 CTGAGGAAGAGGCATGTGGCTGG + Intergenic
963106789 3:141654177-141654199 GAGGGGAAGAGGAAAGTGGGGGG + Intergenic
963248287 3:143082907-143082929 CTGAGGTGGGGGAAGGGGGGTGG - Intergenic
963253230 3:143120581-143120603 CTTAGGAGGAGGAGGCTGGGAGG + Intronic
963267082 3:143250289-143250311 CTGAGGCAGAAGAAGGTTGCAGG + Intergenic
963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG + Intronic
964343823 3:155735917-155735939 CTGAGGAACAGAGATGTGGGAGG + Intronic
964362322 3:155911591-155911613 CTTAGGGAGATCAAGGTGGGTGG + Intronic
964441720 3:156718173-156718195 CTGAGGAGGAGGAGGAAGGGGGG + Intergenic
964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
965157354 3:165080751-165080773 ATGAGGTGGAGGAAGGGGGGAGG + Intergenic
965246396 3:166276663-166276685 ATGAGTAAGAGGAAGGTAAGAGG + Intergenic
965478246 3:169184590-169184612 CTGAGGAAGAGGTAGGAGCTAGG + Intronic
965904229 3:173683275-173683297 AAGAGGAAGAGGAAGGAAGGAGG - Intronic
966219068 3:177532843-177532865 CTTTGGGAGACGAAGGTGGGTGG - Intergenic
966744493 3:183262905-183262927 CATAGGAACAGGAAGATGGGAGG + Intronic
966912868 3:184569125-184569147 GTGAGGGAGAGGGAGGAGGGAGG + Intronic
967439038 3:189485645-189485667 CTAAGAAAGAGGAGGGAGGGTGG - Intergenic
967831813 3:193926253-193926275 CTGGGGAAGAGAAAGCAGGGTGG - Intergenic
967871537 3:194233990-194234012 GCGAGGAAGAGGAGGTTGGGGGG - Intergenic
967988779 3:195115733-195115755 CCGAGGTGGAGGAAGGAGGGCGG + Intronic
968315411 3:197720175-197720197 CAGAGGATGAGGAGGGTAGGAGG - Intronic
968317377 3:197736441-197736463 CTTAGGGTGAGGAGGGTGGGTGG - Intronic
968511204 4:996715-996737 CTGAGGCAGAGACACGTGGGAGG - Intronic
968592414 4:1465678-1465700 CTGAGGAGGAGGAGGCGGGGAGG + Intergenic
968647983 4:1749410-1749432 GTGGGGAAGGGGGAGGTGGGGGG - Intergenic
968720537 4:2199818-2199840 CTTTGGGAGAGCAAGGTGGGCGG - Intronic
968800275 4:2738762-2738784 TTGAGGAAGAGGTATGTGGATGG + Intergenic
968970893 4:3793196-3793218 CTGAGGGAGAGGCAGAGGGGAGG - Intergenic
969015216 4:4099377-4099399 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
969050057 4:4366319-4366341 CGGAGGAAGAGAAAGGAGGCTGG + Intronic
969495912 4:7526032-7526054 CTGAGGAGGAGACAGGTGTGAGG - Intronic
969501124 4:7553808-7553830 GAGAGGAAGGTGAAGGTGGGAGG + Intronic
969673824 4:8604014-8604036 CTGAAGCGGATGAAGGTGGGCGG - Exonic
969738718 4:9008874-9008896 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969797922 4:9540519-9540541 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
970088482 4:12374884-12374906 AGGAGGCAGAAGAAGGTGGGAGG - Intergenic
970725017 4:19033627-19033649 GTTAGAAAGAGAAAGGTGGGGGG + Intergenic
971174032 4:24263641-24263663 CTGAGGAGGAGGAAGAGGAGAGG - Intergenic
971484603 4:27146402-27146424 CTGAGGATGAGGAATTTGGGGGG + Intergenic
972103139 4:35447468-35447490 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972103215 4:35447771-35447793 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972103228 4:35447818-35447840 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972166859 4:36297140-36297162 CTGAGGAGGAGGAAGAGGAGGGG + Intronic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972575023 4:40343624-40343646 CTGAGGAAAGGGAAGGTAAGAGG + Intronic
972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG + Intronic
973267581 4:48226448-48226470 CTGAGGAGGAGGAAGAGGAGGGG - Intronic
973575380 4:52282779-52282801 CTGAGGAGGAGGAATGGGAGGGG - Intergenic
973602899 4:52559636-52559658 TTGAGGAAGGGGAAGGGAGGTGG + Intergenic
973626405 4:52777049-52777071 CTTTGGGAGAGCAAGGTGGGAGG - Intergenic
973656511 4:53053706-53053728 CTGAGGAACAGGAGGGTGTTGGG - Intronic
973721110 4:53724532-53724554 GTGGGGAGGAGGAAGGAGGGAGG - Intronic
974586303 4:63883084-63883106 GTGAGGAAGGGGATGGGGGGTGG - Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
974934699 4:68398388-68398410 CTGGGGAACAGGGAGTTGGGAGG + Intergenic
975007914 4:69313486-69313508 CAGAGTAGGAGGAAGGTGGAGGG - Intronic
975830882 4:78367159-78367181 CTTAGGGAGAGCAAGGTGGGAGG + Intronic
976324009 4:83750425-83750447 CTGAGGGAGGCCAAGGTGGGTGG + Intergenic
976403152 4:84630694-84630716 CTTTGGAAGACCAAGGTGGGAGG + Intronic
976646546 4:87393183-87393205 CTTGGGAAGACCAAGGTGGGTGG - Intergenic
977058535 4:92225183-92225205 CTGTTGAATAGGAAGGAGGGAGG + Intergenic
977509530 4:97945207-97945229 CTTAGAAAGGGGAGGGTGGGAGG - Intronic
977919220 4:102625191-102625213 GGGAGAAAGAGGAAGGAGGGAGG - Intergenic
977930320 4:102743190-102743212 TTGGGGAAGAGGTACGTGGGTGG - Intronic
978311958 4:107394522-107394544 CTGAGGAGGAGGAAGAGGAGGGG + Intergenic
978420827 4:108531127-108531149 ATGAGGCAGAGGAATGAGGGAGG + Intergenic
980369517 4:131849491-131849513 CAGAGAAAGATGAGGGTGGGGGG - Intergenic
980385700 4:132086407-132086429 TTGAGGAAGAGGTATGTGGATGG - Intergenic
980848139 4:138348781-138348803 CACAGAAGGAGGAAGGTGGGAGG + Intergenic
980986118 4:139696157-139696179 CTGAGGAAGAGGAAGAAGAGGGG + Intronic
981175929 4:141683325-141683347 CTTTGGAAGGGCAAGGTGGGTGG + Intronic
981830717 4:148997822-148997844 CTAAGGAAGAACAAGTTGGGAGG + Intergenic
982516648 4:156359601-156359623 CTTTGGAAGGCGAAGGTGGGTGG - Intergenic
983400008 4:167250776-167250798 CTGAGAAAGAGGATGGTGTCAGG - Intergenic
983595852 4:169466999-169467021 CTGAAGAGGAGGAAGTTGGGGGG - Intronic
983904314 4:173168758-173168780 CGGAGGAGGGGGAAGGAGGGAGG + Exonic
984211369 4:176852746-176852768 CTGAGGAAGAGAAAGGAGTGAGG + Intergenic
984620326 4:181944863-181944885 AAGTGGAAGAGGAAGGAGGGAGG - Intergenic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
985128724 4:186720995-186721017 TTGAGGCAGCGTAAGGTGGGTGG - Intronic
985168475 4:187123222-187123244 CTGAGGAGGAGGAAGGAGAGGGG - Intergenic
985734118 5:1567590-1567612 CTCAGCAAGAGGAATGTGGCAGG + Intergenic
985800687 5:2003865-2003887 CTGAGGCGGAGGAAAGAGGGGGG + Intergenic
985851626 5:2392626-2392648 AAGAGAAAGAGGAAGGAGGGAGG - Intergenic
985929619 5:3046967-3046989 ATTAGGAAGAGAAGGGTGGGTGG + Intergenic
986145195 5:5071408-5071430 CTAAGGTGGAGGGAGGTGGGAGG + Intergenic
986310025 5:6544785-6544807 CTGAGGGTGGGGACGGTGGGGGG - Intergenic
986503175 5:8422682-8422704 TTGAGGAAGAGTAAGGTAAGGGG + Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
986678254 5:10208648-10208670 CTGAAGAAGAGGAAGAGGGAGGG - Intergenic
986793750 5:11189432-11189454 CTGAGGAGGAGGAAGCAGAGAGG - Intronic
986957094 5:13165819-13165841 CTGAGGAAGAGGAGGAAGTGGGG + Intergenic
987061382 5:14247063-14247085 GTGGGGAAGGGGGAGGTGGGGGG - Intronic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987266162 5:16257170-16257192 CTGAGGAAGAGGAAGGACTCTGG + Intergenic
987505031 5:18757682-18757704 CTGAGGAGGAGGAAGAGGAGGGG + Intergenic
988216275 5:28277682-28277704 GAAAGGAAGAGGAAGGAGGGAGG - Intergenic
988228794 5:28448388-28448410 CTGAGGAAGAGAAGGCAGGGTGG - Intergenic
988394261 5:30677614-30677636 CTGAGGAGGCTGAAGGGGGGAGG - Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988716825 5:33836721-33836743 CTGAGGGAGAAGAACCTGGGTGG + Intronic
988993467 5:36693099-36693121 CTCTGGGAGAGGAAGCTGGGTGG - Intergenic
989477562 5:41891638-41891660 CAGAGGAAGAGGCAGCTGTGGGG + Intergenic
990042432 5:51390122-51390144 CTGAGGGCGGGGAAGCTGGGAGG + Intronic
990403098 5:55459846-55459868 CTGAGGAGGAGGAAGAGGAGAGG - Intronic
990598562 5:57334699-57334721 CTTTGGTAGAGGAAGGTGGCTGG - Intergenic
990637755 5:57748529-57748551 TTGAGATAGAGGAAGGTGTGGGG + Intergenic
990695225 5:58408928-58408950 CTCAGAAAGAGGATGGTGAGAGG - Intergenic
992403612 5:76434340-76434362 CTCAGAAAGAGGAGGGTGGGAGG - Intronic
992836031 5:80642209-80642231 CTGATGTAGAGGAAGCTGAGTGG + Intronic
993611586 5:90060869-90060891 CAGAGGAAGAGGCAGGTAGCAGG - Intergenic
993625457 5:90219339-90219361 GTGGGGAAGAGGAGGGGGGGAGG + Intergenic
993726381 5:91372077-91372099 CTGAAGATAAAGAAGGTGGGAGG - Intronic
993761626 5:91802823-91802845 CTGATGAAGAGTGAGGAGGGAGG - Intergenic
994212560 5:97102511-97102533 CAAAGGAAGAGGAAGATGTGAGG - Intronic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
994546867 5:101177645-101177667 CAGAGCAGGAGGAAGGTGGGTGG - Intergenic
994709972 5:103255331-103255353 CTGAGGAGGAGAAAGGTGGAAGG - Intergenic
994729638 5:103476723-103476745 CTGGGGAAGGGGGTGGTGGGGGG - Intergenic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
995512628 5:112923629-112923651 CTGAGGCACAGCAAGGAGGGAGG - Intergenic
995815002 5:116158153-116158175 CGGAGGGAGAGGAGGGAGGGAGG - Intronic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996470835 5:123858396-123858418 GTGAGGAAGAGGAGGTAGGGAGG + Intergenic
996825078 5:127673766-127673788 ATGAGTAAGAGGAAGGTGACTGG + Intergenic
996911015 5:128656578-128656600 AGGAGGAAGAGCAAGGGGGGAGG + Intronic
997264115 5:132485153-132485175 CTTTGGAAGGCGAAGGTGGGTGG - Intronic
997266188 5:132496646-132496668 GAGCGGAAGGGGAAGGTGGGGGG - Intergenic
997339343 5:133130608-133130630 GAGAGGAAGTGGAAGGGGGGAGG - Intergenic
997737508 5:136224823-136224845 CAGAGGAAGAGAAGGGTGGCAGG - Intronic
998133629 5:139663423-139663445 CTGAGGGCGAGGGAGGTAGGAGG + Intronic
998605786 5:143633198-143633220 CAGAGGAAGTGGAAGATGTGGGG + Intergenic
999304243 5:150509464-150509486 CTAAGGAAGAGGCAGGAGCGAGG - Intronic
999370508 5:151052318-151052340 CTGAGCTAGAGGATGGTGGGGGG + Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999575411 5:152971234-152971256 CTCAGAAGGAGGAGGGTGGGAGG + Intergenic
999743422 5:154574116-154574138 CTGAGGGAGAGGCAGGTGCGTGG - Intergenic
999764209 5:154726081-154726103 CTGTGGAAGGCCAAGGTGGGCGG - Intronic
1000163159 5:158620615-158620637 GTAAGGTAGAGGAAGGTGGATGG + Intergenic
1000495138 5:161972936-161972958 CTGAGGAAAAGAAAGGAGGCTGG + Intergenic
1000965293 5:167648668-167648690 CTGAGAAAGAGGGCGGAGGGTGG + Intronic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001155166 5:169266407-169266429 CTGAAGAAAAGGAATGTGGGTGG + Intronic
1001344828 5:170884550-170884572 CTGAGGAAGAGAAAGAGGAGAGG + Intronic
1001405033 5:171470229-171470251 TTGAGGATGATGAGGGTGGGAGG - Intergenic
1001566120 5:172700603-172700625 CTGTGGAGGAGTAAGGCGGGAGG - Intergenic
1001650701 5:173314017-173314039 CTGAAGTAGGGGAAGGTGTGTGG + Intergenic
1001933392 5:175688392-175688414 CTGGGGCAGAGGATGGTGGCTGG - Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1002061467 5:176628290-176628312 CTGGGGAGGAGGCAGGAGGGAGG + Intronic
1002429364 5:179194163-179194185 CTGCGGAGGAGGGAGGAGGGAGG + Intronic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1002803204 6:546591-546613 CTGAGGAAGAGCAAGAGGAGGGG - Intronic
1002854194 6:1022990-1023012 ATGATGAATAGGAAGGTTGGAGG - Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003601884 6:7525318-7525340 GAGAGGGAGAGGAAGGTGAGTGG + Intergenic
1003837559 6:10088029-10088051 CTCAGGAAGGGGTGGGTGGGAGG - Intronic
1004275749 6:14233764-14233786 CTGAGGAAGAGAAATTTGGAAGG + Intergenic
1005098274 6:22142242-22142264 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
1005173456 6:23015061-23015083 AGGAGGAAGTGGAAGGTGGAAGG + Intergenic
1005430206 6:25748683-25748705 CTCAGCAAGAGGAATGTGGTAGG + Intergenic
1005560834 6:27039278-27039300 TTGTGGAAGAGGAAGGTGCCAGG - Intergenic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1005952315 6:30641161-30641183 GTGAGGAAGAGGAAGGAGTGGGG - Intronic
1006001584 6:30969341-30969363 CTGGGGAAGAGAAAGCAGGGTGG - Intergenic
1006062382 6:31433487-31433509 CTGAGGAAGAGAAAGCAGGGTGG - Intergenic
1006338103 6:33431552-33431574 CCAAGGAAGGGGCAGGTGGGGGG - Intronic
1006404874 6:33839079-33839101 CTGGGGAAGAGGAGTGGGGGTGG - Intergenic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006971630 6:38051182-38051204 TTGAGGGAGAGGATGGTGGTGGG - Intronic
1007197039 6:40071276-40071298 CTGAGTAAAAGGAAACTGGGGGG - Intergenic
1007258534 6:40545590-40545612 CAGAGGAAGAGGAAGAGGGGAGG + Intronic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1007515408 6:42406756-42406778 CTGGGGAGGAGGGGGGTGGGGGG - Intronic
1007800409 6:44387681-44387703 CTGCGCAAGCGCAAGGTGGGAGG - Exonic
1007827758 6:44613908-44613930 CTGAGGAAGGGGAAGGTTTTGGG + Intergenic
1008055458 6:46941089-46941111 CTTTGGAAGATCAAGGTGGGAGG + Intronic
1008124047 6:47648945-47648967 CTGAGGAGGAGGAAGAGGAGGGG - Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1008855858 6:56086592-56086614 CTGAGGAAGAAGAAGAGGAGGGG + Intronic
1008876317 6:56333292-56333314 CCTAGGAAGGGGAGGGTGGGAGG - Intronic
1009870996 6:69451867-69451889 CAGAGGAGGAGGAAGGCCGGGGG - Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010026860 6:71228826-71228848 GTAAGGAAGAGAAAGGGGGGAGG - Intergenic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG + Intergenic
1010463284 6:76138041-76138063 GTGAGGTAGGGGAAGGGGGGAGG - Intergenic
1010726213 6:79336743-79336765 CTTTGGGAGATGAAGGTGGGAGG - Intergenic
1010952959 6:82058504-82058526 ATGAGGAAGAGGGAGGAGAGAGG + Intergenic
1011521281 6:88209441-88209463 CTCCGGAAGAGGAAAGTGAGTGG + Intergenic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012172843 6:96041001-96041023 CTGATGATGAGGAAAGGGGGCGG - Intronic
1012286853 6:97401014-97401036 CTGAGGAGGAGGAAGGGGAGAGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012899884 6:104993222-104993244 CTTAGGAAGACTGAGGTGGGAGG + Intronic
1012925214 6:105260848-105260870 CCGAGGGAGAGGGAGGGGGGAGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013001468 6:106027059-106027081 TTGTGGAAGAATAAGGTGGGTGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013591851 6:111625562-111625584 CAGAGTAAGAGGCAGGCGGGCGG - Intergenic
1014206119 6:118657124-118657146 GTGAGGAAGATGAAGATTGGGGG + Intronic
1014269800 6:119324162-119324184 CTGAGGAGGAGGAAGAGGAGAGG - Intronic
1014545307 6:122728462-122728484 CTTTGGGAGAGCAAGGTGGGTGG + Intergenic
1014755535 6:125298571-125298593 CTTAGGAAGGGGAAGGTCAGGGG - Intronic
1014820393 6:125982791-125982813 CTGAGGAAAAGGAGGATGGATGG - Intergenic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1015848633 6:137548995-137549017 CTTTGGGAGACGAAGGTGGGTGG - Intergenic
1016283962 6:142451795-142451817 CTGAGGAAGGGGTAGTGGGGAGG - Intergenic
1017004593 6:150020722-150020744 AGAAGGAAGAGGAGGGTGGGAGG + Intronic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017620065 6:156287397-156287419 CTGTGGGAGACCAAGGTGGGTGG + Intergenic
1017720657 6:157241017-157241039 CTGAGGAAGAGGGTGGAGGGAGG + Intergenic
1017737871 6:157380749-157380771 CTGGGGAGGAGGAAGAAGGGAGG + Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018042825 6:159940296-159940318 CTCAGCTAGAGGAAGGTGGAGGG - Intergenic
1018150003 6:160928794-160928816 CAGAGGACGAGGAAGGTAGTTGG - Intergenic
1018176811 6:161184418-161184440 ATGGGGGAGAGGAAGGTGTGTGG + Intronic
1018236891 6:161735275-161735297 CTGAGGAGGAAGAAGGGGAGAGG - Intronic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018586079 6:165360626-165360648 CTGGGGAAGAGGTGGCTGGGAGG + Intronic
1018666264 6:166141206-166141228 TGGAGGAAGAGGCAGGTGGTGGG - Intergenic
1018796565 6:167190061-167190083 CTGAGGAAGAGCAAGGAGGCCGG + Intronic
1018819754 6:167365056-167365078 CTGAGGAAGAGCAAGGAGGCCGG - Intronic
1019208955 6:170389056-170389078 CTGAGAAGGAGGAAGAGGGGTGG + Intronic
1019258152 7:64726-64748 CTGAGCAAGAAGAAGGGAGGGGG - Intergenic
1019276119 7:176879-176901 CTGAGGTGCAGGGAGGTGGGAGG + Intergenic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019388151 7:770332-770354 TTGAGAAAGAGGAAGCGGGGAGG + Intronic
1019446769 7:1075268-1075290 CTTAGGAAGGCCAAGGTGGGCGG + Intronic
1019494899 7:1333297-1333319 AGGAGGAAGAGGATGATGGGAGG - Intergenic
1019812780 7:3176653-3176675 CAGGGGATGAGGCAGGTGGGGGG + Intergenic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020219198 7:6221753-6221775 CTCAGGGAGAGTGAGGTGGGAGG + Intronic
1020577783 7:9956356-9956378 AAAAAGAAGAGGAAGGTGGGGGG - Intergenic
1020955143 7:14731102-14731124 GTGACGCAGCGGAAGGTGGGAGG + Intronic
1021171183 7:17399544-17399566 CTGAGGAGGAGGAAGAGGAGGGG + Intergenic
1021688843 7:23213055-23213077 ATGAGGAAGAGGAGGGGGAGGGG + Intergenic
1021758770 7:23882629-23882651 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1022318518 7:29266274-29266296 ATGAAGAAGAGGGAGGAGGGAGG - Intronic
1022400755 7:30034669-30034691 CAGAGGAAGAGGAAGAGGAGGGG + Intronic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1022699698 7:32747676-32747698 ATAAGGAAGAGGGGGGTGGGTGG + Intergenic
1022800520 7:33772636-33772658 CAGAGGAGGAGGAAGGGTGGAGG - Intergenic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1022845921 7:34209667-34209689 GTGAGGCAGAGGAAGGTAGCAGG + Intergenic
1022935650 7:35173386-35173408 ATAAGGAAGAGGGGGGTGGGTGG + Intergenic
1023270253 7:38455167-38455189 CTGAGGCAGGAGGAGGTGGGAGG - Intronic
1023989274 7:45118513-45118535 CTGAGGCAGAGGAATGGGGCAGG + Intergenic
1024056580 7:45663388-45663410 CTGAGGAAGAGGACAGTTTGAGG - Intronic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1024672874 7:51612552-51612574 CTGAGGTGGGGGTAGGTGGGAGG + Intergenic
1024880364 7:54078851-54078873 CTGTGGAAGAGCAAAGAGGGAGG + Intergenic
1025945395 7:66100454-66100476 ATGAGGAGGAGGAAAGAGGGAGG + Intronic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1026941684 7:74290712-74290734 CAGAGGAGGAGGAGGGTGCGGGG + Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027163236 7:75817277-75817299 GTGGGGAGGAGGAAGTTGGGGGG + Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1027923345 7:84426069-84426091 CTCAGGAAGGGAAGGGTGGGAGG + Intronic
1027980360 7:85211728-85211750 CTGAGGAGGAGGAAGATGAGGGG - Intergenic
1028032188 7:85930238-85930260 GTGAGAGAGAGGGAGGTGGGTGG - Intergenic
1028151599 7:87379868-87379890 CTTTGGGAGACGAAGGTGGGAGG + Intronic
1028763978 7:94529644-94529666 CTGAGTAATAGGAATGTGGCTGG + Intronic
1029073892 7:97921038-97921060 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1029177770 7:98677065-98677087 CTGAGGCACAGGAAGGTAAGTGG - Intergenic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029266343 7:99344221-99344243 CTGCGGCACAGGCAGGTGGGTGG - Intronic
1029284693 7:99457622-99457644 CTGATGAAGAGGAAGCAGGGAGG + Intronic
1029365946 7:100116393-100116415 CTTTGGGAGACGAAGGTGGGCGG + Intronic
1029670487 7:102027139-102027161 CTTTGGGAGATGAAGGTGGGCGG + Intronic
1029831604 7:103266120-103266142 ATAAGGAAGAGGGGGGTGGGTGG + Intergenic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030308736 7:108047353-108047375 CTGAGGAGGAGGAAGAAGAGGGG - Intronic
1030803507 7:113885141-113885163 CTGAGGCACAGGAACCTGGGAGG - Intronic
1031209331 7:118802441-118802463 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
1031474364 7:122204729-122204751 TTGGGGAAGAGGTATGTGGGTGG - Intergenic
1031913609 7:127542508-127542530 CTGGGGAAGAGGCATGTGGCTGG + Intergenic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032197960 7:129800043-129800065 ATGAGGGAGAGGAGTGTGGGTGG + Intergenic
1033039014 7:137901503-137901525 ATGAGGAAAAGGAGGGTTGGGGG + Intronic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1033150509 7:138910794-138910816 CTGAGGCAGAGGAGGTTGGGAGG - Intronic
1033589515 7:142797630-142797652 CTGGGGAAGAGGGAGGGGGTGGG + Intergenic
1033755873 7:144398230-144398252 TTGAGATTGAGGAAGGTGGGAGG - Intronic
1033804207 7:144936446-144936468 ATGAGGAAGAGGAATGTGGGTGG - Intergenic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034400709 7:150859813-150859835 CTGAGGAAGAGGAGGAGGAGGGG + Intronic
1034423649 7:151001798-151001820 CTGCGGGAGAGGAAGGTGTGAGG - Intronic
1034439661 7:151080333-151080355 CTGTGGGAGAGGGAGGTGGTCGG - Intronic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1034982456 7:155487767-155487789 CTGAGGAGGAGGCGGGTGTGGGG + Intronic
1035070418 7:156140575-156140597 AGGAGAAAGAGGCAGGTGGGGGG + Intergenic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1035130411 7:156647345-156647367 CTCAGGAGGCGGAGGGTGGGAGG - Intronic
1035156926 7:156921665-156921687 ATGAGGAAGAGGAAGGTCTCTGG - Intergenic
1035249170 7:157585734-157585756 AAGAGGAAGAGGAAGAGGGGAGG + Intronic
1035416886 7:158696719-158696741 CTTAGGAGGAGGAGGGTGGCAGG - Intronic
1035421211 7:158730145-158730167 CTGAGGCAGTGGGAGGTGGCTGG + Intergenic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035848519 8:2890781-2890803 TTGAGGAAGAGCAAGGAGGCAGG + Intergenic
1035964454 8:4174741-4174763 GTGAGGAAGAGGGATGTGAGGGG + Intronic
1036080338 8:5548419-5548441 CTGGGGAAGATGAAATTGGGTGG + Intergenic
1036162932 8:6406307-6406329 CTGAGGATCAGGAAGGGGAGGGG - Intergenic
1036243813 8:7100258-7100280 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036256976 8:7213793-7213815 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036309026 8:7672392-7672414 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036360508 8:8073720-8073742 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036444587 8:8810489-8810511 CTGAGGAGGAGGAAGAGGAGGGG - Intronic
1036468186 8:9022857-9022879 ATAAGGAAGAGGAAAGTGGGTGG - Intronic
1036662168 8:10715607-10715629 CTGAGGAAGAGGGCGGCGGCTGG - Intergenic
1036890463 8:12593247-12593269 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036898031 8:12651165-12651187 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1037041651 8:14243806-14243828 CTGAGGAACTGAAGGGTGGGAGG - Intronic
1037512188 8:19594793-19594815 CTGTGGAAGGCCAAGGTGGGTGG - Intronic
1037523562 8:19703060-19703082 CTGAGGCAGGGGAAGAAGGGAGG + Intronic
1037661763 8:20933871-20933893 CTTAGGAAGACTGAGGTGGGCGG + Intergenic
1037816678 8:22116235-22116257 CTGTGGCACAGGGAGGTGGGAGG + Intronic
1038536634 8:28358351-28358373 CTTTGGGAGACGAAGGTGGGTGG - Intronic
1038591471 8:28842208-28842230 CTGAGGAGGAGGAAGACGAGGGG + Intronic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1038783135 8:30585839-30585861 CTTAGGGAGATGGAGGTGGGAGG + Intronic
1038970305 8:32626185-32626207 CTTGGGAAGTGGGAGGTGGGAGG + Intronic
1039385515 8:37132085-37132107 CTGTGGAGGAGGCAGGTGGCGGG - Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1040317291 8:46271233-46271255 CTCAGCAAGAGGAATGTGGTAGG + Intergenic
1040343185 8:46455707-46455729 CTCAGCAAGAGGAACGTGGTAGG + Intergenic
1040554765 8:48468943-48468965 CAGAGGTAGAGGAAGTTGGGAGG - Intergenic
1041201663 8:55455395-55455417 CTGAGGGGGAGGAAGGATGGAGG - Intronic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041625849 8:60025773-60025795 AGGAGGAAGAGCAAGGTGGCTGG - Intergenic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1041892876 8:62890973-62890995 CTGAAAGAGAGCAAGGTGGGAGG + Intronic
1042076280 8:64998501-64998523 CTGAGGAAGAGGAATTTGGTGGG - Intergenic
1042616006 8:70650089-70650111 CTTTGGGAGATGAAGGTGGGAGG - Intronic
1042883687 8:73523754-73523776 CTGATGAACTGGAAAGTGGGAGG + Intronic
1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
1043342978 8:79263948-79263970 CTGAGGAAGGAGAACGCGGGAGG + Intergenic
1043448146 8:80339610-80339632 CTTTGGAAGACAAAGGTGGGTGG - Intergenic
1043456016 8:80412798-80412820 CTTTGGAAGACCAAGGTGGGTGG - Intergenic
1043585477 8:81763821-81763843 CTGAGAAGCAGGAAGGAGGGTGG + Intergenic
1043637373 8:82403136-82403158 CTGATAAAGAGGTAGGCGGGTGG + Intergenic
1043800928 8:84608540-84608562 CTGGGGAAGGGCAAAGTGGGAGG - Intronic
1045149630 8:99389654-99389676 CTGAGGAGGAGGAAGAGGAGGGG + Intronic
1045280002 8:100741941-100741963 CTGAGGATAAGGTAGGTGGGTGG + Intergenic
1045382923 8:101644752-101644774 CGGAGTAAGAGGAAAGTGTGTGG + Intronic
1045447583 8:102283325-102283347 CTTAGGAAGGGGAAGGCGGGGGG + Intronic
1045669220 8:104528529-104528551 CTTAGGGAGACCAAGGTGGGCGG + Intronic
1045899742 8:107263108-107263130 CTTTGGGAGAGCAAGGTGGGCGG + Intronic
1046765608 8:118066188-118066210 CTGAGGAGGAGGAAGATGAGGGG - Intronic
1046810003 8:118523213-118523235 TTGGGGAGGAGGGAGGTGGGGGG + Intronic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1047015698 8:120720849-120720871 CTGTGGAAGGGTAAGGTAGGTGG - Intronic
1047426109 8:124748453-124748475 AAGAGCAGGAGGAAGGTGGGTGG + Intergenic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1047904028 8:129453702-129453724 CTGATGAACAGGCAGCTGGGTGG - Intergenic
1047932649 8:129746055-129746077 CTGAGGATGAGCATGGTGCGGGG + Intergenic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048286397 8:133145173-133145195 CAGAGGAAGAGGAAGGCAGAAGG + Intergenic
1048517816 8:135126396-135126418 CTCAGGGAGGGGGAGGTGGGAGG - Intergenic
1048805098 8:138232939-138232961 GTGGTGAAGAGGAAAGTGGGAGG - Intronic
1048947970 8:139467906-139467928 CTGAGGAAGAGAAAGAGGGCTGG - Intergenic
1049545376 8:143228373-143228395 CTGCGGGAGAGGGAGGCGGGGGG + Intergenic
1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG + Intergenic
1050038933 9:1466816-1466838 CTGAGTTGGAGGAAGGAGGGAGG + Intergenic
1050236322 9:3584785-3584807 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050736048 9:8764552-8764574 CTTAGGAAGGCCAAGGTGGGTGG + Intronic
1050840721 9:10145366-10145388 CTGAGGAGGAGGAAGAAGAGGGG - Intronic
1050901868 9:10960262-10960284 TTGAGGAAGAGGTATGTGGATGG + Intergenic
1051044589 9:12857799-12857821 CTTAGGGAGACCAAGGTGGGTGG + Intergenic
1051170381 9:14314698-14314720 AGGAGGAGGAGGAAGGTGGGGGG - Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1051784339 9:20725425-20725447 CTGAGAAAGAGAGAGGGGGGTGG + Intronic
1051797903 9:20895256-20895278 CTGAAGAAGAGCAAAGTTGGAGG - Intronic
1052368736 9:27641465-27641487 GTGAGGAAGAGGTATGTGGATGG + Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052987922 9:34501731-34501753 CTGAGGAGGAGGCAGGAAGGGGG - Intronic
1053376346 9:37609828-37609850 CTGAGGAAGAGCAAGGAGGCTGG - Intronic
1053404505 9:37860401-37860423 CTGGGGTTGAGCAAGGTGGGAGG + Intronic
1053407532 9:37890458-37890480 CTTTGGAAGACCAAGGTGGGAGG + Intronic
1053462661 9:38282509-38282531 ATGAGGCATAGGAAGGAGGGTGG + Intergenic
1053505600 9:38640913-38640935 CTGAGGAAAGGGAAGCTGAGAGG + Intergenic
1053633895 9:39975151-39975173 CAGAGAAAGATGATGGTGGGGGG - Intergenic
1053771851 9:41488353-41488375 CAGAGAAAGATGATGGTGGGGGG + Intergenic
1054209992 9:62275546-62275568 CAGAGAAAGATGATGGTGGGGGG + Intergenic
1054315001 9:63573408-63573430 CAGAGAAAGATGATGGTGGGGGG - Intergenic
1054904758 9:70404977-70404999 CTGAGGAACTGGAATGTGAGGGG - Intronic
1054912699 9:70468448-70468470 TTCAGGCAGAGGAAGGAGGGTGG - Intergenic
1055015593 9:71614451-71614473 GTGAGGAAAGGGCAGGTGGGAGG + Intergenic
1055269147 9:74536287-74536309 CTGAAGAAGAGGAGGAGGGGAGG + Intronic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055825867 9:80323881-80323903 GTGAGGATGAGGAAGGTAGCTGG - Intergenic
1056040522 9:82660705-82660727 AGGAGGAGGAGGAAGGAGGGGGG + Intergenic
1056110231 9:83388027-83388049 CTGAGTGAGACGAAGGTGGCAGG - Intronic
1056418729 9:86402955-86402977 CCCAGGAAGAGGAATATGGGTGG - Intergenic
1056640499 9:88365967-88365989 CTGTGGAAGTGTGAGGTGGGTGG - Intergenic
1056655217 9:88503376-88503398 CTCAGGCAGAGGAAGGAGAGGGG + Intergenic
1057059612 9:91991792-91991814 CTGCGGAAGAGGCGGGTGGGGGG - Intergenic
1057148656 9:92776523-92776545 CTTTGGAAGACCAAGGTGGGGGG - Intergenic
1057917109 9:99065403-99065425 ATGAGGAAGAAGACGGGGGGTGG + Intronic
1058057028 9:100458748-100458770 CTTGGGAAGGCGAAGGTGGGAGG + Intronic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058425053 9:104868962-104868984 TAGAGGACAAGGAAGGTGGGAGG + Intronic
1058824657 9:108764222-108764244 CTGAGGAAGAGGAAAGTGAGGGG - Intergenic
1058845723 9:108957227-108957249 CTCAGGAGGTGGAAGGTGGGAGG - Intronic
1059099733 9:111458633-111458655 GAGAGGGAGAGGAGGGTGGGGGG + Intronic
1059216012 9:112562907-112562929 CTTTGGAAGACCAAGGTGGGAGG - Intronic
1059286057 9:113172565-113172587 CTGAGGCAGAGGGTCGTGGGTGG - Intronic
1059392409 9:114007518-114007540 CTGGGTAAGAGGGAGGAGGGAGG - Intronic
1059423282 9:114205875-114205897 CCGAGGCAGAGGGAGGTGGTGGG + Intronic
1059470019 9:114497872-114497894 CTGGGAAGGAGGCAGGTGGGAGG + Intronic
1059531116 9:115036545-115036567 CCGAGGTAGAGGACGGTCGGAGG + Intronic
1059639209 9:116200117-116200139 TTGAGGAAGATGAAGCTGGAGGG - Intronic
1059702149 9:116785675-116785697 ATGAGGGAGAGAAAGGAGGGAGG - Intronic
1059718375 9:116934610-116934632 TTCAGGGAGTGGAAGGTGGGAGG + Intronic
1059891933 9:118813556-118813578 CTGGGGAAGAGGGAGTGGGGCGG - Intergenic
1060143944 9:121234937-121234959 CTGAGAAACAGGGAGGTGTGGGG + Intronic
1060297793 9:122355042-122355064 GGAAGGAAGAGGAAGGAGGGAGG + Intergenic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060522083 9:124299659-124299681 CTGAGGCAGAGGCAGGGGTGGGG + Intronic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060736780 9:126071186-126071208 CAGAGGAAGAGGTAGCTGGAAGG - Intergenic
1060819341 9:126652284-126652306 CTGAGGAGGAGAAGGGGGGGGGG + Intronic
1060976855 9:127770176-127770198 GGGATGAAGAGGAAGGAGGGAGG - Intronic
1061028637 9:128066784-128066806 CTGAGGAGGACGGAGCTGGGGGG - Exonic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1061138820 9:128752146-128752168 CTGAGGATCAGGAAGGAAGGAGG - Intronic
1061238036 9:129353268-129353290 CTGATGAAGGGGCTGGTGGGAGG + Intergenic
1061264893 9:129499172-129499194 CTGAGTAAGAGGTAGGCAGGTGG - Intergenic
1061284865 9:129616457-129616479 CTTAGGAAGGCGAAGGGGGGTGG - Intronic
1061383953 9:130277156-130277178 CTGGGCAAGAGGAGGGTGTGGGG - Intergenic
1061605621 9:131708470-131708492 TTGAGGAGGAGGAAGTTGGCAGG - Intronic
1061631594 9:131875495-131875517 CTGAGGAAGAGGCCTGCGGGAGG + Intronic
1061989015 9:134147774-134147796 CTTCGGAAGACCAAGGTGGGAGG + Intronic
1061999000 9:134206662-134206684 GAGAGGAAGGGGAGGGTGGGAGG + Intergenic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062179240 9:135181893-135181915 ATCAGGCAGAGGAAGGTGGAAGG + Intergenic
1062190334 9:135244768-135244790 CTGGCAAAGAGGCAGGTGGGAGG + Intergenic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1062594120 9:137290052-137290074 CTGAGGGAGGCCAAGGTGGGTGG - Intergenic
1203522328 Un_GL000213v1:55331-55353 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1203463900 Un_GL000220v1:68262-68284 CTGGGGGGGAGGGAGGTGGGCGG - Intergenic
1185992015 X:4901799-4901821 CTTTGGGAGATGAAGGTGGGTGG + Intergenic
1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG + Intergenic
1186179350 X:6957905-6957927 CTTTGGAAGACCAAGGTGGGTGG + Intergenic
1186192966 X:7084061-7084083 CTTAGGAAGAGGATGGAGGCCGG - Intronic
1186226041 X:7400171-7400193 GGGAGGTAGAGGCAGGTGGGTGG - Intergenic
1186456218 X:9712112-9712134 AAGAGGAAGAGGCAGGTGGAAGG - Intronic
1187148232 X:16657131-16657153 CTTTGGGAGACGAAGGTGGGTGG - Intronic
1187949781 X:24460475-24460497 CTGAGAGAGAGAGAGGTGGGGGG + Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188987082 X:36777585-36777607 CTGAGGAAGGGCATGGTAGGAGG - Intergenic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189341513 X:40207951-40207973 CTGGGGAAGAAGGAGGGGGGTGG + Intergenic
1189705417 X:43754712-43754734 CAGAGGAATAGGAACTTGGGTGG + Intergenic
1190006223 X:46741333-46741355 TTGAGAAAGAGTAAGGTTGGAGG + Intronic
1190061044 X:47211928-47211950 CAGAGGGCGAGGCAGGTGGGAGG - Intronic
1190781297 X:53598472-53598494 CTGAGGAGGAGGAAGGAAGTGGG - Intronic
1190795038 X:53733055-53733077 CTGAGGAGGAGGAAGAAGAGGGG - Intergenic
1190823300 X:53994456-53994478 TTGAATAAGATGAAGGTGGGAGG - Intronic
1191634773 X:63363645-63363667 CTGAGGGACAGGGAGGTAGGTGG + Intergenic
1191719155 X:64215085-64215107 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1191791572 X:64976937-64976959 GTGGGGAAGAGGAGGATGGGAGG + Intronic
1191946434 X:66539647-66539669 CTGGGGAAGAGGTATGTGGCTGG + Intergenic
1192213977 X:69145085-69145107 GTGAGGAGGAGGGAGGGGGGAGG + Intergenic
1192261365 X:69507417-69507439 CTGAGGCTGAGGGAGGCGGGAGG - Intronic
1192264403 X:69529179-69529201 CTGGGGAAGAGGGAGGAGGCCGG + Intronic
1192530733 X:71882074-71882096 ATGAAGAAGAACAAGGTGGGAGG + Intergenic
1192831817 X:74758156-74758178 TTGGGGAAGAGGAGAGTGGGTGG + Intronic
1193732988 X:85123919-85123941 CTGAAGAGTAGGATGGTGGGAGG + Intergenic
1194038512 X:88911230-88911252 CTGTGGGAGACCAAGGTGGGAGG + Intergenic
1194980897 X:100439249-100439271 CTGGGGAAGAGAACGGTGCGTGG - Intergenic
1195074268 X:101311609-101311631 CAAAGGAAGAGAAAAGTGGGAGG - Intergenic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195370965 X:104172156-104172178 CTTTGGAAGACCAAGGTGGGAGG + Intronic
1195436785 X:104853470-104853492 ATGATGAAGGGGAATGTGGGAGG + Intronic
1195538691 X:106037992-106038014 CTCAGGAAGAAGATGGAGGGTGG - Intronic
1195551454 X:106176027-106176049 AAGAGGAAGAGGAAGTTGCGGGG + Intronic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1195751193 X:108163072-108163094 CTGAGGCAGAGGGAGGTGACGGG + Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195886111 X:109639335-109639357 CTGAGGCAGAGGAAATGGGGAGG + Intronic
1195923547 X:110003955-110003977 CTGAGGCAGACGAAGGAGGACGG + Exonic
1196135877 X:112209213-112209235 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1196652310 X:118180394-118180416 GAGAGGAAGAGGAGGTTGGGTGG + Intergenic
1196657333 X:118232206-118232228 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1196754199 X:119143595-119143617 CTGGAGAAGAGGAAAGGGGGAGG - Intronic
1196820128 X:119694565-119694587 CTGAGGAGGAGGCAGGAGAGAGG + Intergenic
1196893532 X:120311574-120311596 CTGAGGGGGAGGGAGGAGGGGGG - Intergenic
1197515034 X:127416800-127416822 CTGAAAATGAGGAAAGTGGGAGG - Intergenic
1197769797 X:130082717-130082739 CTGGCGAGGAGGGAGGTGGGAGG - Intronic
1197792636 X:130270786-130270808 CAGAGGCAGAGGAAGTTGGATGG - Intergenic
1198214910 X:134546540-134546562 CTCAGGAGCAGGTAGGTGGGCGG - Intergenic
1198299163 X:135317650-135317672 CTGTGGTAGAGGCAGCTGGGTGG + Intronic
1198810783 X:140534179-140534201 TGGAAGAAGAGGAAGGAGGGAGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199269512 X:145866092-145866114 CTGAGAAACAGGAAAGTTGGTGG - Intergenic
1199614091 X:149641593-149641615 CTGAGGAAAAGGAAGAGGAGGGG + Intergenic
1199813414 X:151373473-151373495 CTGAGGGAGAATAAGGTGAGGGG + Intergenic
1200044227 X:153392512-153392534 CAGTGGCAGAGGAAAGTGGGAGG + Intergenic
1200099795 X:153684847-153684869 CTGAGGAGGAGGGAGAGGGGAGG - Intronic
1200129150 X:153831496-153831518 CTGAGGAACAGGTAGGCGGCGGG - Intergenic
1200204158 X:154303839-154303861 ATGAGCAAGAAGATGGTGGGGGG - Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic
1201300168 Y:12498411-12498433 GAGAGAAAGAGGAAGGAGGGAGG - Intergenic
1201567748 Y:15384456-15384478 CTCAGGAGGAGGAAGGAGGATGG - Intergenic
1201579112 Y:15492569-15492591 CTCAGGAGGCTGAAGGTGGGAGG + Intergenic
1201595997 Y:15669917-15669939 GGGAGGTAGAGGCAGGTGGGTGG - Intergenic
1201607307 Y:15801112-15801134 CTGAGGAGGAGGAAGAGGAGGGG + Intergenic
1201796583 Y:17903010-17903032 TTGAGGAAGAGGTATGTGGACGG - Intergenic
1201804972 Y:18002975-18002997 TTGAGGAAGAGGTATGTGGACGG + Intergenic