ID: 1200216173

View in Genome Browser
Species Human (GRCh38)
Location X:154369152-154369174
Sequence CCCAGCAGGCAGCACCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 417}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200216164_1200216173 20 Left 1200216164 X:154369109-154369131 CCTATGAGGAGGGGCTGGGCTGT 0: 1
1: 0
2: 1
3: 19
4: 274
Right 1200216173 X:154369152-154369174 CCCAGCAGGCAGCACCTGGAGGG 0: 1
1: 0
2: 5
3: 38
4: 417
1200216166_1200216173 -3 Left 1200216166 X:154369132-154369154 CCATGGCAGCTGCTTCCCAGCCC 0: 1
1: 0
2: 11
3: 66
4: 559
Right 1200216173 X:154369152-154369174 CCCAGCAGGCAGCACCTGGAGGG 0: 1
1: 0
2: 5
3: 38
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200216173 Original CRISPR CCCAGCAGGCAGCACCTGGA GGG Intronic
900115681 1:1026866-1026888 CCCAGCAGGCAGGAGGTGCAGGG - Intronic
900393386 1:2443461-2443483 CCCAGCCGGCGGGACCGGGAAGG - Intronic
900463291 1:2811436-2811458 CCCAGCAGCTAGCACATGGCCGG + Intergenic
900528417 1:3140663-3140685 GCCACCAGGCAGCTCCTAGAAGG + Intronic
900625650 1:3607388-3607410 CCCTGAAAGCAGCTCCTGGATGG + Intronic
900697356 1:4020620-4020642 GCCAGCAGACATCAGCTGGATGG + Intergenic
900932971 1:5748184-5748206 CTGAGCACGCATCACCTGGAGGG - Intergenic
901031434 1:6309219-6309241 CCCAGTAGGCTGCAACTAGAGGG + Intronic
901168114 1:7234306-7234328 CCCAGGACGCAGCATCTGGGTGG - Intronic
901195192 1:7436430-7436452 CCTAGCACTAAGCACCTGGAGGG + Intronic
901529384 1:9843749-9843771 CCGAGCTGCCAGCACCTGGCAGG - Intergenic
901676565 1:10889000-10889022 CCAAGCAGGCGGCCCCTGGGCGG + Intergenic
901684419 1:10935637-10935659 CCAAGCTGCCACCACCTGGAGGG - Intergenic
901977244 1:13004901-13004923 CTCATCAGGCAGCACCTTGCGGG + Intronic
902004842 1:13224033-13224055 CTCATCAGGCAGCACCTTGCGGG - Intergenic
902024060 1:13369768-13369790 CTCATCAGGCAGCACCTTGCGGG - Intronic
902229717 1:15020164-15020186 CCCAGCTTGTATCACCTGGAGGG - Intronic
902275289 1:15335147-15335169 CCCAGCAGGCCTCACCTTGTGGG - Intronic
902360888 1:15942065-15942087 CCCAGCCTGCAGCACCTGCCCGG + Exonic
902695563 1:18138506-18138528 CCCAGGAGGTAGCAGCAGGAGGG + Intronic
903659611 1:24969107-24969129 CCCAGCTGGCACCAACTGGTTGG + Intergenic
903886032 1:26541773-26541795 CCCAGCTGGCAGCATTTGCAGGG - Intronic
904044892 1:27603186-27603208 CCTGGCAGGCAGCGCCGGGAAGG - Intronic
904586886 1:31585614-31585636 TCCCACAGGCAGCACCTGGAGGG + Intronic
905168345 1:36096652-36096674 CCCAGCCCGCAGCAGGTGGAAGG + Exonic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
908414424 1:63899012-63899034 CCCACCAAGAAGCACCGGGACGG + Intronic
909610988 1:77551653-77551675 CTCAGCACGCAGCACCTCAAGGG - Intronic
911959527 1:104283004-104283026 AGCAGCAGGCAGTACCAGGAGGG - Intergenic
913989591 1:143598500-143598522 CTCAGCAGGGAGCTGCTGGAAGG - Intergenic
914410316 1:147421123-147421145 CGCCGTAGGCAGCTCCTGGAAGG - Intergenic
914510852 1:148330595-148330617 CCCAGCAGGGAGGAGCAGGAAGG - Intergenic
915735474 1:158081938-158081960 CCCAGGAGGAAGATCCTGGATGG - Intronic
916712843 1:167427147-167427169 CCCTGCAGGCAGCCCTAGGAGGG - Exonic
917609387 1:176671063-176671085 GCCAGGTGGCAGCACCTGCAAGG - Exonic
918043397 1:180926800-180926822 CCCAGCAGACAGCTCCTCCAAGG - Intronic
918047327 1:180949396-180949418 CCCAGGTGGGAGCAGCTGGAGGG + Exonic
918169904 1:181986778-181986800 GCCAGCAGGCAGCGCCAGCATGG + Intergenic
919083302 1:192891650-192891672 CCCAGCAGGCACCCACAGGAGGG + Intergenic
919669646 1:200327309-200327331 TCAAGAAGGCAGCACCTGGCTGG - Intergenic
919851946 1:201678920-201678942 CCCAGCTGGAAGCAGATGGAGGG - Intronic
919860671 1:201737723-201737745 CTCAGCAGGGAGGGCCTGGAAGG - Intronic
919882827 1:201912074-201912096 GCCAGGAGGTTGCACCTGGAAGG + Intronic
919971957 1:202586661-202586683 GCCAGCAGCCAGCAGCTGCATGG + Exonic
919977660 1:202623323-202623345 CCCAGCAGGCAGCTCAGGGCTGG - Intronic
919978831 1:202629851-202629873 CCCAGCAGGCAGCTGGTGGGGGG + Intronic
920649710 1:207827654-207827676 CCCAGCAGGCAGAGCCAGGAGGG - Intergenic
920960215 1:210656882-210656904 CCCAGCAGCCAGCCCCTGGAGGG - Intronic
923106110 1:230855309-230855331 CCCAGCACTTAGCACCTTGATGG - Intronic
924244906 1:242074556-242074578 CCCAGCAGGAAGAATGTGGAAGG + Intergenic
1062855855 10:779257-779279 TCCAGCAGGCGGAACGTGGAGGG + Intergenic
1062935126 10:1379805-1379827 CCCAGGAGGCAGGACCTGCTTGG - Intronic
1064033902 10:11900284-11900306 CCCTGGAGGCAGCTCCTGGTTGG - Intergenic
1064655564 10:17552061-17552083 CCCAGGAGACTGCACATGGAGGG + Intergenic
1067374306 10:45713242-45713264 CCCAGCATTCAGAACCTGGTAGG - Intergenic
1067570906 10:47370190-47370212 CCCAGCAAGGAGCACAGGGAAGG - Intronic
1067882141 10:50054996-50055018 CCCAGCATTCAGAACCTGGTAGG - Intergenic
1069932410 10:71891647-71891669 CGCAGCATGCAGGCCCTGGAGGG + Intergenic
1069940079 10:71949305-71949327 CCCAACAGGCAGCATGGGGAAGG - Intergenic
1069942016 10:71963044-71963066 CCCAACAGGCAGCATGGGGAAGG - Intergenic
1070663932 10:78330154-78330176 GCCAGGAGGCAGCTCCTGAATGG + Intergenic
1070737042 10:78870259-78870281 CCCGGCAGGCAGCATGTGGACGG + Intergenic
1070823739 10:79379231-79379253 CACAGGAGGCAGCCCCTGGAAGG + Intergenic
1073845422 10:107548419-107548441 CTCAGTAGGCTGCACTTGGAAGG - Intergenic
1074116359 10:110460044-110460066 CCCAGCACTCAGCGCCTGAAAGG + Intergenic
1074410906 10:113227648-113227670 CCCAGCTGCCAGAACCTGGGGGG + Intergenic
1075312172 10:121423576-121423598 ACCAGCAGTCAGCCTCTGGAGGG + Intergenic
1075762124 10:124864811-124864833 CCCAGCTGGCAGTGCCAGGAAGG - Intergenic
1076218673 10:128715956-128715978 CCCAGCACACAGGACCTGGATGG - Intergenic
1076344857 10:129773271-129773293 CCCAGCAGGCCACACCTTGGAGG - Intergenic
1076344866 10:129773299-129773321 CCCAGCAGGCCACACCTTGGAGG - Intergenic
1076344875 10:129773327-129773349 CCCAGCAGGCCACACCTTGGAGG - Intergenic
1076344919 10:129773467-129773489 CCCAGCAGGCCACACCTTGGAGG - Intergenic
1076344928 10:129773495-129773517 CCCAGCAGGCCACACCTTGGAGG - Intergenic
1076344937 10:129773523-129773545 CCCAGCAGGCCACACCTTGGAGG - Intergenic
1076362661 10:129900458-129900480 CCCAGCGGTCAGCACCAGCAAGG + Intronic
1076378534 10:130009408-130009430 CCCAGCAGACACCACGCGGAGGG + Intergenic
1076450653 10:130554814-130554836 CCCAGCCTGCATCCCCTGGAGGG - Intergenic
1076890795 10:133282259-133282281 CCCTGCGGGCAGCCCCAGGACGG + Exonic
1077017998 11:405441-405463 CCATGCAGGCAGATCCTGGATGG - Intergenic
1077362216 11:2145745-2145767 CTCAGCAGGCAGCCCCACGAGGG - Intronic
1078277043 11:9859043-9859065 CCCAGCAGGAAGTCCCTGAAAGG - Intronic
1078534188 11:12160206-12160228 CCCAGCAGGCTCCTCCTGGCAGG + Intronic
1078901963 11:15650355-15650377 CCCGGGAGGCAGCGCCTGGATGG + Intergenic
1079103136 11:17553650-17553672 CCAGGCAGTCTGCACCTGGAAGG + Intronic
1079126182 11:17720032-17720054 CCCAGCGGGCACCACCAGGCGGG + Exonic
1079357255 11:19740018-19740040 CCGAGCAGGCTCCCCCTGGAGGG + Intronic
1081649567 11:44814774-44814796 CCCAGTAGGCAGTACCTTGTAGG - Intronic
1081702253 11:45159245-45159267 CCCAGGAGGCAGCAGGCGGAGGG - Intronic
1081850806 11:46274058-46274080 CTCAGCAGGCAGGCCCTGGGTGG - Intergenic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1083644506 11:64164828-64164850 CCCAGGAGGCAGGCCCTGAAAGG + Intronic
1084006708 11:66326977-66326999 CCCAGCTGCTAGGACCTGGAAGG + Intergenic
1084420587 11:69058603-69058625 CCCTGCTGGCAGGACCTGGTGGG + Intronic
1084651394 11:70491409-70491431 ACCGGCAGGCAGGGCCTGGAGGG + Intronic
1084889090 11:72227999-72228021 CCCAATAGGCAACACCAGGAGGG + Intronic
1084942061 11:72618213-72618235 CAGAGCAGGCAGTGCCTGGATGG - Intronic
1086900456 11:92361536-92361558 CCTAGCAGGCAGCATCTGTGAGG + Intronic
1088826662 11:113500991-113501013 CCCTGCTGGTGGCACCTGGAGGG + Intergenic
1089288101 11:117420449-117420471 CCCAGGAGGCATCACCCAGATGG - Intergenic
1090205061 11:124879457-124879479 CACTGCAGGCAGAACCTGGCAGG + Exonic
1091728176 12:2859649-2859671 CTCAGCTAGCAGCACCTGAAAGG + Exonic
1092102897 12:5900917-5900939 CCCTGCCGGCAGCACTTTGATGG + Intronic
1092407320 12:8230117-8230139 CTCAGGAGCCAGCTCCTGGATGG + Intergenic
1092926312 12:13275553-13275575 TCCAGCAGGAAACACCTGGCTGG + Intergenic
1094488230 12:30941731-30941753 TCCAGGAGGCAGCACCAGCAGGG - Intronic
1095389872 12:41692904-41692926 CACAGCAGGCTGCAACTGGGTGG + Intergenic
1095726974 12:45464652-45464674 GACAGCAGCCAGCACCTGGCTGG + Intergenic
1097191766 12:57222739-57222761 GCCAGCAGCTAACACCTGGAGGG - Intronic
1098048773 12:66430843-66430865 ACCAGCAGGAAGCATCTAGAAGG + Intronic
1098353371 12:69585934-69585956 CCCGGCAGGCGTCACCTTGATGG + Intronic
1099422063 12:82473546-82473568 CCCTACAGGCTGCCCCTGGAGGG - Intronic
1100331903 12:93590717-93590739 CCCAGCAGGCAGAGCCGAGATGG + Intergenic
1101315395 12:103624238-103624260 CCAGGCAGGCAGCACGTAGAAGG - Intronic
1101621606 12:106394278-106394300 CAGGGCAGGCAGCACCAGGAAGG + Intronic
1101745528 12:107538643-107538665 CCAAGCAGGAAGAGCCTGGAGGG - Intronic
1101921741 12:108938654-108938676 CCCAGTAGACAGGACCTGCAAGG - Intronic
1103700278 12:122845636-122845658 CCCAGCAGTCAGCAACACGAGGG - Intronic
1103816033 12:123657315-123657337 CTCAGCAAGCAGCATCTGGAAGG - Intronic
1103902828 12:124312060-124312082 CCCAGGAAGCAGCACCCAGAGGG - Intronic
1104902947 12:132198982-132199004 CCCAGCCCGCCCCACCTGGAAGG - Intronic
1105492417 13:20902144-20902166 TGCAGCCGGCAGCACGTGGAAGG - Intronic
1107431666 13:40345900-40345922 GCCATCAGGCAGCGCGTGGAGGG - Intergenic
1108219229 13:48216425-48216447 CACAGCAGGGAGGCCCTGGATGG - Intergenic
1108587436 13:51882924-51882946 CCCAGCAGGCTGCACTAGGCTGG + Intergenic
1109976318 13:69837737-69837759 CCCAGAAGACAGAATCTGGATGG - Intronic
1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG + Intronic
1113460634 13:110479670-110479692 CCCAGCAGGCAGCCCTTGGACGG + Intronic
1113506125 13:110817158-110817180 CACAGGAGGCACCACCTGCAGGG + Intergenic
1113588972 13:111484778-111484800 CCAAGCAGGCAGTACCCGGCTGG + Intergenic
1114080481 14:19198774-19198796 CCCTGCAGGCAGACCCAGGAAGG + Intergenic
1114211860 14:20622800-20622822 GCCAGCAGGCAGCATCTCGTAGG - Intergenic
1115182661 14:30647544-30647566 CAAAGCAGGCAGAAACTGGAGGG - Intronic
1117375563 14:55115520-55115542 CCAGGCAGGCAGCATCTGGGAGG + Intergenic
1119670015 14:76511182-76511204 CCCAGAAAGCAGGACCAGGATGG - Intergenic
1121843027 14:97150459-97150481 CCCAGCAGACAGTATCTGGCTGG - Intergenic
1122096250 14:99375004-99375026 CCCAGCACCCAGCACCTGCATGG + Intergenic
1122229260 14:100297374-100297396 CCCCTCAGGCAGCCCCTGGCAGG - Intronic
1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG + Intergenic
1122605296 14:102944106-102944128 CTCAGCAGGCAGAACCCAGAAGG + Exonic
1122795125 14:104202183-104202205 CCCAGCGGGCAGCACGTGCGTGG + Intergenic
1122809530 14:104281186-104281208 CCCAGCAGGCAGAGCCAGCATGG + Intergenic
1122977509 14:105176948-105176970 CCCAGCTGGCCTCACCTGGCCGG + Exonic
1124008292 15:25811841-25811863 CCAAGCTGGCTGCACCTGCATGG + Intronic
1124493310 15:30171687-30171709 CCCAGCAGGCAGCTCAGGGCTGG - Intergenic
1124750224 15:32366638-32366660 CCCAGCAGGCAGCTCAGGGCTGG + Intergenic
1125560906 15:40632524-40632546 CCCAACAGGCAGAACTTGCAAGG + Intronic
1125727530 15:41875680-41875702 CGCAGCAGGCTGGACCTGGGTGG + Intronic
1126859205 15:52868085-52868107 TCCAGCAAGCAGAACCTTGATGG - Intergenic
1128244183 15:66121653-66121675 CCCAGCAGGTAGCAGGTGAAAGG + Intronic
1128556418 15:68634940-68634962 CCAAACAGGAAGCACCTGGTGGG + Intronic
1128694083 15:69747370-69747392 CTCAGGAACCAGCACCTGGAGGG + Intergenic
1128786021 15:70398024-70398046 CCCAGCAGGCAGCAGCGGCCAGG - Intergenic
1128803626 15:70514206-70514228 CCCAGCAGGCTCCATATGGAGGG + Intergenic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129340424 15:74882293-74882315 CCCTGCACTCAGCCCCTGGAGGG + Intergenic
1129377084 15:75140534-75140556 CCCAGGAGACAACAGCTGGAAGG - Intergenic
1132593383 16:736606-736628 CCCAGGAGGCTGAACCTGGGAGG - Intronic
1132613203 16:827982-828004 TGCAGCAGACAGGACCTGGAAGG + Intergenic
1132909850 16:2303861-2303883 CCCAGCATGCAGCACCTGCGTGG - Intronic
1133270510 16:4608973-4608995 CCCAGCAGGCAGGCGCTGGGAGG + Exonic
1133796088 16:9047680-9047702 CCTAGCAGGAAGCCCCTGCAAGG + Intergenic
1134051458 16:11140639-11140661 CCCAACACGAAGCACCTGAAAGG + Intronic
1135794979 16:25433066-25433088 CCCAGGATGCTGCACTTGGATGG - Intergenic
1136566361 16:31073114-31073136 CCAGCCAGGCAGCCCCTGGAGGG + Intronic
1137445162 16:48527126-48527148 ACCAGGAGGCAGCAACTGGCTGG + Intergenic
1138715870 16:59021509-59021531 CCCAGCAGGGAGGGGCTGGAGGG + Intergenic
1139705560 16:68738161-68738183 CCCAGCCCGCAGCCCCGGGACGG - Intronic
1141620086 16:85232642-85232664 CCTAGCAAGGAGCACCTCGATGG - Intergenic
1141770231 16:86085359-86085381 CCCTGCAGGGAGCACCGGGGAGG + Intergenic
1142200975 16:88761046-88761068 CTCAGCCCGCAGCCCCTGGAGGG + Intronic
1142306546 16:89289149-89289171 CCGGGCAGGCAGCTCCTGGCTGG + Intronic
1142428511 16:90013440-90013462 CCCAGCATGCAGCACAGGGCTGG + Intronic
1142680063 17:1542122-1542144 CCCAGGAGGCAGAAGCTGCAGGG + Intronic
1142965631 17:3579379-3579401 CCCAGGAGACAGGTCCTGGAAGG + Intronic
1143015470 17:3889141-3889163 CCCAGCAGGCAGTGCCAGGCTGG - Intronic
1143432208 17:6895442-6895464 CCCTGGAGGCAGCACCAGGCAGG - Intronic
1143761807 17:9110205-9110227 CTCACCAGGCAGCACCTCAAGGG - Intronic
1145271960 17:21409570-21409592 CCCAGCAAGCTGCCCCTGGGAGG - Intronic
1145310168 17:21697035-21697057 CCCAGCAAGCTGCCCCTGGGAGG - Intronic
1146318478 17:31827681-31827703 CCCAGCACCCAGCACCTGCCTGG + Intergenic
1146906376 17:36620907-36620929 GCCTGCAAGCAGCACCTGGCAGG - Intergenic
1147119405 17:38327077-38327099 TTCAGAAGGCAGGACCTGGAGGG - Exonic
1147925276 17:43941963-43941985 CCCAGGAGGCAGCAGCTAGTGGG + Intronic
1148795119 17:50193181-50193203 CCCAGCAAGAAGCACCTGCAGGG - Intronic
1149036734 17:52142686-52142708 CCCTGCAGGCAGCCCTAGGAGGG + Intronic
1149413429 17:56432715-56432737 CCAAGCAGTCACCACCTGGGAGG - Intronic
1149607522 17:57935618-57935640 CCCAGCAGGCTGGAACTGAAAGG + Intronic
1149919029 17:60638921-60638943 TCCAGCAGGCAGCCACTAGAGGG - Intronic
1151255482 17:72873217-72873239 ACCGGCTGGCACCACCTGGATGG + Intronic
1152706620 17:81846847-81846869 TCCAGCAGGCAGCCTCAGGAAGG + Intronic
1153934867 18:9912747-9912769 TCCAGCAGGCTGTTCCTGGATGG + Intergenic
1154937915 18:21079532-21079554 CCCATCAGGCATTTCCTGGAGGG + Intronic
1155841640 18:30652200-30652222 CAAAGCAGGCAGAACCTGAAAGG + Intergenic
1156231240 18:35155846-35155868 CCCAACAGTCAGCACATGGAGGG + Intergenic
1156377942 18:36531485-36531507 GCCAGCAGGCAGAACATGGAGGG - Intronic
1156986163 18:43353613-43353635 CCCAGCAGGCAGCAAATGGGTGG + Intergenic
1157166938 18:45366367-45366389 CCCACCTGGTAGCACCTGGCTGG - Intronic
1157709892 18:49842990-49843012 CTCAGCAGGGAGGAGCTGGAGGG + Intronic
1159246463 18:65811541-65811563 AGCAGCAGGAAGCACTTGGAAGG - Intronic
1160796053 19:945933-945955 CCCTGCAGACGGGACCTGGACGG - Intronic
1160796870 19:949618-949640 TCCAGCAGGCATCCACTGGAGGG - Intronic
1160826735 19:1083640-1083662 GGCTGCAGGCAGCACCGGGATGG - Intronic
1161303181 19:3552938-3552960 CCCAGCCTGGGGCACCTGGAAGG + Intronic
1161332153 19:3693486-3693508 GCCAGCAGGCGCCAGCTGGACGG - Intronic
1162675447 19:12294921-12294943 CCCAGGAGGCGGGACCTGGAGGG - Intergenic
1162997987 19:14348551-14348573 CCCAGCAGCCAGACCCGGGACGG + Intergenic
1163128837 19:15259376-15259398 CCCAACAGTCATCACCTGGTGGG - Intronic
1164644131 19:29845421-29845443 CCCTGGAGGCAGCAGCTAGAGGG - Intergenic
1165069277 19:33246442-33246464 CTCTCCAGTCAGCACCTGGAAGG + Intergenic
1165432644 19:35781309-35781331 CCCAGCATGCAGCACGGGGCTGG - Intronic
1165831137 19:38730999-38731021 CACTGCAGCCAGCACCTGGATGG - Exonic
1166276775 19:41759166-41759188 CCCATCAGACAGCACCTGCCTGG - Intronic
1166406262 19:42524263-42524285 CCCATCAGACAGCACCTGCCTGG + Intronic
1166409747 19:42548630-42548652 CACAGCAGGCAGCACATGGATGG - Intronic
1166415405 19:42591747-42591769 CCCATCAGACAGCACCTGCCTGG + Intronic
1166785246 19:45363515-45363537 CCTGGCAGGCAACACCTGGCTGG - Intronic
1167351680 19:48978919-48978941 CCCAGGGGGCAGGCCCTGGAAGG + Intronic
1167690567 19:50982132-50982154 CACAGGAGGCAGGGCCTGGAGGG + Intronic
925428594 2:3771792-3771814 CCCAGCAGGCAGCACGGGCCAGG - Intronic
925681947 2:6431722-6431744 CACAGCAGGCAGCAAGAGGAGGG + Intergenic
926195184 2:10759425-10759447 CCCGGCAGGCAGCAGCATGAGGG - Intronic
926206139 2:10835423-10835445 CCCCGGAGGCCGCACCTGGAAGG - Intronic
926251079 2:11155725-11155747 CCCAGCCGGCAGCAGCTGCGAGG - Intronic
927110073 2:19858309-19858331 CCCAGCAACCAGCACCTGTGGGG + Intergenic
930015607 2:46968451-46968473 CCAAGCCTGCAGCACCTGGGTGG + Intronic
930094878 2:47559340-47559362 CCCAGCAGGGAGGCCCTGGGAGG + Intronic
930370325 2:50493372-50493394 CCAAGCTGGGACCACCTGGAAGG - Intronic
933912928 2:86960038-86960060 CCCACCAGGAAGCCCCAGGAGGG + Intronic
934010067 2:87809852-87809874 CCCACCAGGAAGCCCCAGGAGGG - Intronic
934715683 2:96542003-96542025 CCAGGCAGGCAGGACCTGCATGG - Intronic
934717993 2:96554329-96554351 CCCAGCACCCAGGGCCTGGAGGG - Intergenic
935003206 2:99042414-99042436 CCCAGCAGGTAGCACGGAGAAGG + Intronic
935011715 2:99141896-99141918 CCCTGCAGGCTGCAGCGGGAGGG - Exonic
935126461 2:100227724-100227746 CCCCTCAGGTAGCACCAGGAGGG + Intergenic
935171612 2:100614733-100614755 CCCAGCAGGGAGGCCCTGGAGGG + Intergenic
935773637 2:106450560-106450582 CCCACCAGGAAGCCCCAGGAGGG - Intronic
935906427 2:107845380-107845402 CCCACCAGGAAGCCCCAGGAGGG + Intronic
935914461 2:107934718-107934740 CCCAGCTGGAAGCTCCTGGAGGG - Intergenic
936008389 2:108909574-108909596 CACTGCAGGCTGCGCCTGGAAGG - Intronic
936080958 2:109432279-109432301 CCCTGCAGGCAGCTCCCCGAAGG + Intronic
936128211 2:109810489-109810511 CCCACCAGGAAGCCCCAGGAGGG + Intronic
936216486 2:110560996-110561018 CCCACCAGGAAGCCCCAGGAGGG - Intronic
936425627 2:112415567-112415589 CCCACCAGGAAGCCCCAGGAGGG - Intronic
936520634 2:113210122-113210144 CCCAGCAGCCAGCCCCAGGGAGG - Intergenic
936976704 2:118228024-118228046 GCTAGCAGGCAGGACCAGGAAGG - Intergenic
937281480 2:120720326-120720348 ACCAGCAGGACGCACTTGGAGGG - Intergenic
937335222 2:121058430-121058452 GGCAGGAGGCAGCCCCTGGAGGG + Intergenic
940638454 2:156325532-156325554 ACCTGCAGGCAGAACCTGAAAGG - Exonic
940646682 2:156399548-156399570 CCCAACAGGTAGCACCGTGAGGG - Intergenic
943041554 2:182811169-182811191 CACAGCAGGCTGCCCCTGCATGG - Intergenic
943676778 2:190723400-190723422 CTCAGGAGGCAGCACCTGCCGGG + Intergenic
944474666 2:200091337-200091359 CCCAGCAGGGTGCACCAGTAGGG + Intergenic
944668102 2:201973186-201973208 CCCAGCAGCCAGTTCCTTGATGG - Intergenic
944897239 2:204177760-204177782 CCCAGCAGGCAGCCCGAGGGAGG - Intergenic
947437431 2:230084632-230084654 CCCAGCAAGTAGACCCTGGAAGG - Intergenic
948185687 2:236019621-236019643 GGCAGCAGCCTGCACCTGGACGG + Intronic
948186619 2:236026329-236026351 CCCGGCAGGTGGCACGTGGAAGG + Intronic
948549490 2:238760253-238760275 ACCAGCAGTTAGGACCTGGAAGG + Intergenic
1169073246 20:2746513-2746535 CCCAGCAGGCAGCCCCTCCTTGG - Intronic
1169227571 20:3865944-3865966 CCCAGCATCCAGCTCCTGGAGGG + Exonic
1171968538 20:31548957-31548979 CCCACCTGTCAGCCCCTGGACGG - Intronic
1172390099 20:34560089-34560111 CCCACCAGCCAGCACCCAGAGGG - Exonic
1172390664 20:34562785-34562807 CCCAGCTGGCAGCTCCAGGCTGG + Intronic
1172485650 20:35296419-35296441 CAGAGCAGCCTGCACCTGGAGGG - Intergenic
1172620315 20:36314115-36314137 CCCAGCACGCTGTCCCTGGAAGG - Intronic
1172764014 20:37341519-37341541 CCCAGCGGCCAGCACCGGGAGGG - Intergenic
1174356552 20:50002083-50002105 CACAGCAGTGAGCACCTGCAAGG - Intergenic
1174869218 20:54167988-54168010 GCCAGCAGCCAGCTCATGGAGGG - Intronic
1175213157 20:57374475-57374497 ATCAGCGGGCAGCAGCTGGAAGG + Intronic
1175531823 20:59678791-59678813 CCTGGCTGGGAGCACCTGGAGGG + Intronic
1175575872 20:60060424-60060446 CCCATGAGGCAGCACCTGTGTGG - Intronic
1175766853 20:61598225-61598247 CCCAGCAGCCAATTCCTGGAAGG - Intronic
1175796797 20:61776302-61776324 CTCAGGAGGCTGCACCTGCAGGG - Intronic
1176047643 20:63101064-63101086 CCGTGCAGGCAGCAGCAGGAAGG - Intergenic
1177169741 21:17641805-17641827 CCCAACAGGCCCCACCTGGGAGG + Intergenic
1178405498 21:32319949-32319971 CACAGCAGACAGCACTTGGCGGG - Intronic
1178431148 21:32519974-32519996 CACAGCAGGCAGCTCATGGATGG - Intergenic
1179271104 21:39851610-39851632 GGAAGGAGGCAGCACCTGGAGGG - Intergenic
1179469496 21:41601196-41601218 CCCACCATCCAGCAGCTGGAGGG + Intergenic
1179477034 21:41653615-41653637 CCCAGCAGGCTGCCCAGGGAAGG + Intergenic
1179548557 21:42127996-42128018 CACGGCAGGCAGCCCTTGGACGG + Intronic
1179878767 21:44284885-44284907 CCCCGCAGGCATGGCCTGGAGGG - Intergenic
1179967037 21:44813285-44813307 CACACCAGGCAGCAGCTGGTGGG + Intronic
1180500298 22:15923910-15923932 CCCTGCAGGCAGACCCAGGAAGG - Intergenic
1180968377 22:19802230-19802252 CAGAGCAGTCAGCTCCTGGAAGG + Intronic
1181512133 22:23393845-23393867 CCCACAAGGCAGCACCCAGAAGG + Intergenic
1181527961 22:23500938-23500960 CCCACCAGGGAGCCCCAGGAAGG - Intergenic
1181980076 22:26760039-26760061 CCCAGAAGGCAGCAGGTGGCAGG + Intergenic
1182270514 22:29150314-29150336 CCCAGCAACCACCACCGGGAGGG - Intronic
1183259627 22:36786038-36786060 CTCACCAGGAAGCCCCTGGAGGG - Intergenic
1183297962 22:37043283-37043305 CCCAGCAAGGAGCAGCTGGCAGG - Intergenic
1183510769 22:38233462-38233484 CCCTGCAGGCAGCAGATAGACGG - Intronic
1183744238 22:39684237-39684259 GCCAGGGGGCAGCCCCTGGAAGG - Intronic
1183775208 22:39959625-39959647 CTCAGCCGGCTGCACCTGGTTGG + Intronic
1184262756 22:43328806-43328828 CACACCAGGCACCACCTTGATGG + Intronic
1184669390 22:46004831-46004853 CCAAGCAGGCAGCACCTGCATGG + Intergenic
1185299598 22:50072497-50072519 CCCAGGGGGCAGCACCTGATGGG + Intronic
1185366603 22:50439693-50439715 CCCAGCAGGCGCCATGTGGACGG + Exonic
949312086 3:2711309-2711331 CCCAGGAGGCAGAAACTGGCTGG - Intronic
950432397 3:12958360-12958382 CCCAGCAGGCAGGAGCTGTGTGG + Intronic
950903077 3:16514053-16514075 CCCAGCCATCAGCACCTTGATGG - Intergenic
951530941 3:23697643-23697665 GCCAGCAGGCACCAGGTGGAAGG + Intergenic
952418847 3:33113884-33113906 GCCAGCTGCCAGCACCTAGAGGG - Intergenic
953327351 3:42023682-42023704 CCCAGCGGTGAGGACCTGGAGGG + Intronic
954137288 3:48587882-48587904 CTCAGCAGCTATCACCTGGACGG - Exonic
956608812 3:71101036-71101058 CCCAGCAGGTGGCACCTGAAGGG + Intronic
958959532 3:100495690-100495712 CCCAACCTGCAGGACCTGGATGG - Intronic
959550751 3:107653961-107653983 CCATGCAGGTAGCACCTGGATGG + Intronic
960011002 3:112834675-112834697 CCTGGCAGGCAGCACTTGGCTGG + Intronic
960811278 3:121629684-121629706 CTCTGAAGGCAGCAACTGGAGGG - Exonic
961010616 3:123433312-123433334 CCCAGCTGGCATCACCTACAGGG + Intronic
961367073 3:126406777-126406799 TCCAGCAGGAAGCCCCTGGGAGG + Intronic
962218828 3:133546206-133546228 CCCCTGAGACAGCACCTGGAAGG + Intergenic
968471287 4:783516-783538 CCCAGCCAGCAGCATCAGGAAGG + Intergenic
968490147 4:885695-885717 CCCAGGAGTCAGGACCTGGGTGG - Intronic
968506861 4:974728-974750 CCCAGAGCGCAGCTCCTGGAGGG - Intronic
968526966 4:1064511-1064533 CCCATCAGCCAGCATCTTGATGG - Intronic
968568093 4:1325647-1325669 GCCATCAGGCAGCCCCTGGGAGG + Intronic
968599672 4:1503040-1503062 CTCAGCAGGCAGTACCTGCTGGG + Intergenic
968795152 4:2698417-2698439 CCCAGCAGCCACCTCGTGGATGG - Intronic
969251711 4:5972696-5972718 CCCCACAGGCAGAGCCTGGAGGG + Intronic
969369870 4:6724747-6724769 CCTAGCAGGGAGCAGCTCGAGGG + Intergenic
969569148 4:7998471-7998493 CCCCACAGGCAGCACCGGCAGGG - Intronic
970573851 4:17408420-17408442 CCCAGCAAGCAGAAACTGGAGGG + Intergenic
971151821 4:24041279-24041301 CCCAGCAGGGAGGAGTTGGAGGG - Intergenic
971248785 4:24954298-24954320 ACCAGCATGCAGCACCTGCCTGG - Intronic
973823783 4:54685295-54685317 CCCAGCAGGCAGCAGCAAAAAGG - Intronic
974087824 4:57279795-57279817 CCCAGAAGGCAGCAGTTGGTGGG - Intergenic
974311514 4:60216604-60216626 CCCAGCAGTCAGTACCTGCCTGG - Intergenic
976269543 4:83217307-83217329 CCTAGCAGGCAGCTACTGGTAGG - Intergenic
976401180 4:84608783-84608805 CCCACCAGGGACCACATGGAGGG - Intronic
978849079 4:113311332-113311354 CCCAGCAGTCAGTTCCTGGATGG + Exonic
979967125 4:127088658-127088680 CCCAGCTGGGAGGACCTGGCTGG - Intergenic
981952004 4:150421800-150421822 TCCAGCAGGAAGGACCTGGCAGG + Intronic
985366311 4:189236116-189236138 CTCACCAGGAAGCACGTGGATGG - Intergenic
985645731 5:1083942-1083964 CCCAGGAGGCAGACCCTGGGCGG + Exonic
985697447 5:1348804-1348826 CCCACAAGCCAGCACCTGGAGGG - Intergenic
985806604 5:2048895-2048917 CCCCACAGACAGCACCAGGAAGG - Intergenic
985818128 5:2141790-2141812 CCCAGGAGGGGGCACCTGGGTGG + Intergenic
987066489 5:14295024-14295046 CCCAGCAGGCATCACCTTCATGG - Intronic
987389223 5:17360430-17360452 CCCAGCTGGCAGCACGTGTTGGG + Intergenic
989225438 5:39022423-39022445 CACCGCTGGCAGCACCTGGCAGG - Intronic
990325431 5:54670806-54670828 CCCAGAAGGCAGCTTTTGGATGG - Intergenic
990403945 5:55468992-55469014 CCCAGCAGAGGTCACCTGGAAGG - Intronic
992302729 5:75400659-75400681 CTTAGCAGGCCGCCCCTGGAAGG + Intronic
995524761 5:113041628-113041650 CCCAGCTGACAGCACTTTGAAGG + Intronic
996279388 5:121709700-121709722 CAGAGGAGACAGCACCTGGAAGG + Intergenic
997283770 5:132664271-132664293 CCAGGCAGGCAGCACATGGCTGG - Intergenic
997311282 5:132885629-132885651 CCCAGCAGGCAACTACTGAAGGG + Intronic
997364814 5:133319063-133319085 CCCAGCAAGACCCACCTGGATGG - Intronic
997690619 5:135825466-135825488 CCCAGCAGGGTGCCCTTGGATGG + Intergenic
999262601 5:150246987-150247009 CCCAGAAGGAAGCCTCTGGAGGG + Intronic
999283368 5:150379524-150379546 CCCTGAAGGCTTCACCTGGAGGG - Exonic
1000196471 5:158963921-158963943 CCCAGCAGCGAGCTCCTTGAGGG - Intronic
1001044650 5:168362666-168362688 CCCAACAGGCAGCACACAGAGGG + Intronic
1001179265 5:169503419-169503441 CCCAGCAGGCTTCACCCTGAAGG + Intergenic
1001416393 5:171547417-171547439 CCCAGCAGTCAGCCTCTGCATGG - Intergenic
1002581761 5:180212964-180212986 CACAGCAGACAGCACCTGCTGGG + Intergenic
1002783281 6:383047-383069 GCCAGCAGGCTGCCCCTGGTGGG + Intergenic
1002841009 6:907274-907296 CCCAGCGGGGAGCAGCAGGACGG - Intergenic
1002992955 6:2254890-2254912 GCCATCAGGCAGGATCTGGATGG - Intergenic
1003409339 6:5849538-5849560 CTCAGCAGGCAGGAGGTGGAAGG + Intergenic
1004202126 6:13558674-13558696 AGCACCTGGCAGCACCTGGAAGG - Intergenic
1004335672 6:14762390-14762412 CCAAGCAGCCCGAACCTGGAAGG - Intergenic
1005494714 6:26378181-26378203 CCTAGCAGGCAGCAGTTGAAAGG - Exonic
1005499207 6:26415076-26415098 CCTAGCAGGCAGCAGTTGAAAGG - Exonic
1005503899 6:26453284-26453306 CCTAGCAGGCAGCAGTTGAAAGG - Exonic
1006349948 6:33513625-33513647 CTCAGAAGGCAGCAGGTGGAGGG - Intergenic
1006467748 6:34206227-34206249 CCCACCAGGAAGCCCCAGGAGGG + Intergenic
1006714065 6:36103051-36103073 CCCTGCAGGGAGCTCCTGGGTGG - Intronic
1009546756 6:65030278-65030300 GCCACCAGGAAGCACCTGGTTGG - Intronic
1011121508 6:83958708-83958730 CCCAGCTGGCAGCTCCCAGAGGG - Intronic
1012935867 6:105366380-105366402 CCCAGCAGGCAGTTCCAGCATGG + Intronic
1012937182 6:105380361-105380383 TACAGCAGGCGGCACCTGGTAGG + Intronic
1013076270 6:106774499-106774521 CCCAGCAGCCTGCACCTCGTGGG + Intergenic
1015265106 6:131283845-131283867 CCCAGGATTCTGCACCTGGATGG - Intergenic
1017875238 6:158518641-158518663 CCCAGCAGCAAGGACCTGGCAGG - Intergenic
1017931444 6:158959048-158959070 AGCAGCATGCAGCACCTGCATGG - Intergenic
1018706928 6:166470173-166470195 TGCAGCAGGCAGCACCTGGCTGG - Intronic
1021625408 7:22588337-22588359 ACCAGTAGGGAGCACCAGGAAGG + Intronic
1022702800 7:32777318-32777340 CCCAGAAGCCAGCAGCTGAAGGG + Intergenic
1022907025 7:34867438-34867460 CCCAGAAGCCAGCAGCTGAAGGG + Intronic
1022993007 7:35726712-35726734 CCCACCAGGCAGCACAGGGCAGG + Intergenic
1023750217 7:43365110-43365132 CCCAGCCGGCATCATCTGTAGGG + Intronic
1024024773 7:45400868-45400890 CCCAGCAGGCTGCACTCGGCTGG - Intergenic
1024797275 7:53035515-53035537 ACTTGCCGGCAGCACCTGGAAGG + Intergenic
1025207094 7:57000223-57000245 CCCAGCTGGCAGGAGCTGGGAGG - Intergenic
1025664843 7:63576667-63576689 CCCAGCTGGCAGGAGCTGGGAGG + Intergenic
1026907026 7:74068649-74068671 CCAGGCAGGCCCCACCTGGACGG - Exonic
1027402304 7:77821895-77821917 CACAGCAGGCTGCTCCTGGTAGG - Intronic
1028602223 7:92615012-92615034 TCCAGAAGACAGCAGCTGGAAGG + Exonic
1028833047 7:95346371-95346393 CCCCACAGGCAGCACCAAGAAGG - Intergenic
1028984829 7:97001671-97001693 CAAACCAGGCAGGACCTGGATGG - Intergenic
1029572485 7:101379387-101379409 CCCATCAGGCAGAGCCAGGACGG - Intronic
1030520162 7:110588695-110588717 CACAGCAGGAAGCACATGGAAGG + Intergenic
1032471775 7:132184207-132184229 CCCAGCAGGGGGCAGCGGGAGGG + Intronic
1032904604 7:136349722-136349744 CCCAGCAGCCATCATCTGGTTGG + Intergenic
1034021875 7:147653412-147653434 CCCGGTGGGCAGCACCTGGGGGG + Intronic
1034875905 7:154724635-154724657 GCCAGGAGCCAGCTCCTGGAGGG - Intronic
1034973141 7:155431608-155431630 CCCAGCATGCAGCCGCTGGGTGG + Intergenic
1035451401 7:158979395-158979417 CCCAGAAGTAAGCACCTGGACGG - Intergenic
1035995290 8:4539956-4539978 ATCTGCAGGCAGCACCTGGACGG - Intronic
1036111814 8:5911107-5911129 CCCAGCATGCAGCTTCAGGAGGG + Intergenic
1036396733 8:8377032-8377054 CCCAGAAAGCAGCATCTGGCTGG - Exonic
1036648299 8:10625703-10625725 CACAGCCGGGGGCACCTGGATGG - Intronic
1036847690 8:12181037-12181059 CTCAGCAGCCGGCTCCTGGATGG + Intergenic
1036869058 8:12423352-12423374 CTCAGCAGCCGGCTCCTGGATGG + Intergenic
1037711804 8:21360996-21361018 TCCAGGAGGCAGCTCCTTGAGGG - Intergenic
1038396311 8:27248077-27248099 ACCACCAGGCAGGAGCTGGAGGG - Intronic
1039490306 8:37942476-37942498 CCCTTCAGGAAGAACCTGGAAGG - Intergenic
1039998018 8:42551240-42551262 CCCAGGAGGCAGAACTTGCAGGG + Intronic
1040560960 8:48523282-48523304 ACCAGCAGGCAGCATAGGGATGG + Intergenic
1041571203 8:59338477-59338499 TCCAGCATGCAGCACATGGAAGG - Intergenic
1042028539 8:64449294-64449316 TCCAGCAGGGAGCAACTAGAAGG + Intergenic
1047362204 8:124179329-124179351 CCCAGCAAGCAGCACCAGATGGG + Intergenic
1047571130 8:126099695-126099717 CCCAACAGGTAGCATCTGCAAGG - Intergenic
1047811058 8:128409491-128409513 CCAAGGGGGCAACACCTGGAGGG + Intergenic
1049351089 8:142165197-142165219 CCCAGCAGGCAGGGCCAGGATGG - Intergenic
1052351176 9:27459712-27459734 CCCAGCACCCAGCACCTAGGAGG + Intronic
1052821231 9:33139228-33139250 CTCAGCAGGGAACTCCTGGAAGG - Intronic
1052826151 9:33176734-33176756 CCCAGCAGGTAGTACCTGATGGG - Intergenic
1053152635 9:35752795-35752817 GCTAGTAGGCAGCACCTTGATGG - Exonic
1053282066 9:36826912-36826934 CCCTGCAGGCAGGTCCTGGATGG + Intergenic
1054872187 9:70057902-70057924 CCCAGCTGAGGGCACCTGGATGG - Intronic
1056578845 9:87876011-87876033 CCACCCAGGCAGGACCTGGACGG + Intergenic
1056877626 9:90349741-90349763 CCAAGCAGGCAACACCTGCTAGG + Intergenic
1058015548 9:100028322-100028344 CCCATCAGTCAGCCCCTGGTGGG - Intronic
1059432458 9:114258388-114258410 CCCAGCAGCCTCCACATGGAAGG - Intronic
1059746588 9:117207119-117207141 CCCTGCAGGCTGCTCCTGGTGGG + Intronic
1059819549 9:117956848-117956870 GCAAGCAGGCAGCAGCTAGAAGG + Intergenic
1061084385 9:128390611-128390633 CGGGGCAGGCAGCACCTGGTAGG + Exonic
1061223690 9:129267532-129267554 CCCAGCAGGGGGCAAGTGGATGG + Intergenic
1061450922 9:130666623-130666645 CTCCGCAGGCAGCACCAGGCTGG - Exonic
1061678856 9:132232710-132232732 CCCTGCAGGGAGGACCTGGTGGG + Intronic
1061843839 9:133375907-133375929 GCCCGCAGGCCGCACCTGGTCGG + Exonic
1061940284 9:133880258-133880280 GCCGGCAGGCAGCACGGGGAGGG + Intronic
1062047584 9:134431646-134431668 CCCCGCAGGCAGACCCTAGAGGG + Intronic
1062076919 9:134594619-134594641 CCCAGCATGCAGCCCCCAGAGGG - Intergenic
1062082191 9:134629997-134630019 CACAGCATGGGGCACCTGGAAGG - Intergenic
1062150688 9:135017324-135017346 CCACGCAGGCAGCTCCTGGCAGG - Intergenic
1062245878 9:135565809-135565831 CCCAGGAGGCAGGACCAGGCAGG - Intronic
1062334024 9:136057039-136057061 TCCAGCAGCCAGTACCTCGAGGG + Intronic
1062428314 9:136516168-136516190 CCCAGCAGTGAGCGCCTGGCTGG + Intronic
1062501939 9:136855440-136855462 CCCAGGAGGCAGCGGCTGCAGGG - Exonic
1062519552 9:136952003-136952025 CCCAGCATGGGGCACTTGGAAGG + Intronic
1062549551 9:137079655-137079677 CTCAGCAGGCAGCTGCTGTAAGG + Intronic
1062651625 9:137580764-137580786 CCCAGCAGGTGGCACCGTGAGGG - Intergenic
1062732935 9:138119663-138119685 CCCACCAGGCAGCACCCAGGAGG - Intronic
1185652095 X:1655421-1655443 CCCAGCAGGCAGCACCCAGCAGG - Intergenic
1186692985 X:11999126-11999148 TCCAGGAGGCAGCACGTGCAAGG - Intergenic
1186959652 X:14722004-14722026 GGCAGCAGGCAGAAGCTGGAAGG - Intronic
1190064099 X:47228784-47228806 CCCAGCAGGCAGCGGCTGGAGGG + Exonic
1192034182 X:67545627-67545649 CCCAGCAGGGACAACGTGGATGG - Exonic
1192233158 X:69279476-69279498 CACAGCTGGAAGCAGCTGGAAGG + Intergenic
1194424177 X:93716723-93716745 ACCTGCTGCCAGCACCTGGATGG + Intergenic
1194888492 X:99348544-99348566 CCCAGCAGGCATCACCTGTCTGG + Intergenic
1196029071 X:111075673-111075695 TCCACCAGGCAGTACCTGGTTGG - Intronic
1199673203 X:150163685-150163707 CCCAGCAGACAGGACCTGCATGG + Intergenic
1200164502 X:154026849-154026871 ACCAGCAGGCAGGGCCGGGAGGG + Intronic
1200216173 X:154369152-154369174 CCCAGCAGGCAGCACCTGGAGGG + Intronic