ID: 1200216769

View in Genome Browser
Species Human (GRCh38)
Location X:154371525-154371547
Sequence GCGAAACCCGGGCTCCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200216757_1200216769 10 Left 1200216757 X:154371492-154371514 CCCCACTAGGCCCCCGGGTTCGG 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1200216753_1200216769 22 Left 1200216753 X:154371480-154371502 CCGTTGGAATGCCCCCACTAGGC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1200216760_1200216769 8 Left 1200216760 X:154371494-154371516 CCACTAGGCCCCCGGGTTCGGCT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1200216748_1200216769 28 Left 1200216748 X:154371474-154371496 CCCCGCCCGTTGGAATGCCCCCA 0: 1
1: 0
2: 0
3: 0
4: 43
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1200216756_1200216769 11 Left 1200216756 X:154371491-154371513 CCCCCACTAGGCCCCCGGGTTCG 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1200216750_1200216769 26 Left 1200216750 X:154371476-154371498 CCGCCCGTTGGAATGCCCCCACT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1200216762_1200216769 -1 Left 1200216762 X:154371503-154371525 CCCCGGGTTCGGCTGATCAGACG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1200216749_1200216769 27 Left 1200216749 X:154371475-154371497 CCCGCCCGTTGGAATGCCCCCAC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1200216751_1200216769 23 Left 1200216751 X:154371479-154371501 CCCGTTGGAATGCCCCCACTAGG 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1200216764_1200216769 -3 Left 1200216764 X:154371505-154371527 CCGGGTTCGGCTGATCAGACGCG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1200216759_1200216769 9 Left 1200216759 X:154371493-154371515 CCCACTAGGCCCCCGGGTTCGGC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1200216761_1200216769 0 Left 1200216761 X:154371502-154371524 CCCCCGGGTTCGGCTGATCAGAC 0: 1
1: 0
2: 3
3: 8
4: 39
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1200216763_1200216769 -2 Left 1200216763 X:154371504-154371526 CCCGGGTTCGGCTGATCAGACGC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1200216769 X:154371525-154371547 GCGAAACCCGGGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200216769 Original CRISPR GCGAAACCCGGGCTCCAGGG TGG Intronic