ID: 1200217533

View in Genome Browser
Species Human (GRCh38)
Location X:154374679-154374701
Sequence GCCGGGCGCGGGGCGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2118
Summary {0: 1, 1: 4, 2: 40, 3: 301, 4: 1772}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200217533_1200217550 18 Left 1200217533 X:154374679-154374701 CCCGCGCCCGCCCCGCGCCCGGC 0: 1
1: 4
2: 40
3: 301
4: 1772
Right 1200217550 X:154374720-154374742 CTTAATTGGTAAAATTGCCCAGG 0: 1
1: 0
2: 1
3: 7
4: 135
1200217533_1200217547 4 Left 1200217533 X:154374679-154374701 CCCGCGCCCGCCCCGCGCCCGGC 0: 1
1: 4
2: 40
3: 301
4: 1772
Right 1200217547 X:154374706-154374728 CCCGGCGAGAAAGCCTTAATTGG 0: 1
1: 0
2: 0
3: 0
4: 30
1200217533_1200217552 26 Left 1200217533 X:154374679-154374701 CCCGCGCCCGCCCCGCGCCCGGC 0: 1
1: 4
2: 40
3: 301
4: 1772
Right 1200217552 X:154374728-154374750 GTAAAATTGCCCAGGAGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 162
1200217533_1200217551 25 Left 1200217533 X:154374679-154374701 CCCGCGCCCGCCCCGCGCCCGGC 0: 1
1: 4
2: 40
3: 301
4: 1772
Right 1200217551 X:154374727-154374749 GGTAAAATTGCCCAGGAGCCCGG 0: 1
1: 0
2: 3
3: 6
4: 134
1200217533_1200217553 30 Left 1200217533 X:154374679-154374701 CCCGCGCCCGCCCCGCGCCCGGC 0: 1
1: 4
2: 40
3: 301
4: 1772
Right 1200217553 X:154374732-154374754 AATTGCCCAGGAGCCCGGGACGG 0: 1
1: 0
2: 0
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200217533 Original CRISPR GCCGGGCGCGGGGCGGGCGC GGG (reversed) Intergenic