ID: 1200218048

View in Genome Browser
Species Human (GRCh38)
Location X:154377331-154377353
Sequence TGGAGGTTTGCCCATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200218048_1200218060 23 Left 1200218048 X:154377331-154377353 CCCACCCCATGGGCAAACCTCCA No data
Right 1200218060 X:154377377-154377399 ACCAGCCAGGCCAGCCATTCTGG No data
1200218048_1200218057 10 Left 1200218048 X:154377331-154377353 CCCACCCCATGGGCAAACCTCCA No data
Right 1200218057 X:154377364-154377386 GTCTGTGACCCTCACCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200218048 Original CRISPR TGGAGGTTTGCCCATGGGGT GGG (reversed) Intergenic
No off target data available for this crispr