ID: 1200218436

View in Genome Browser
Species Human (GRCh38)
Location X:154379026-154379048
Sequence CCGCGCGGGCGCGGAGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200218436_1200218451 25 Left 1200218436 X:154379026-154379048 CCTTTTGCTCCGCGCCCGCGCGG 0: 1
1: 1
2: 1
3: 5
4: 55
Right 1200218451 X:154379074-154379096 ATCCCCGTGCTTGTGACATATGG 0: 1
1: 0
2: 0
3: 2
4: 46
1200218436_1200218452 26 Left 1200218436 X:154379026-154379048 CCTTTTGCTCCGCGCCCGCGCGG 0: 1
1: 1
2: 1
3: 5
4: 55
Right 1200218452 X:154379075-154379097 TCCCCGTGCTTGTGACATATGGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200218436 Original CRISPR CCGCGCGGGCGCGGAGCAAA AGG (reversed) Intergenic
900191706 1:1354901-1354923 CCACGCGGTCGCGCAGAAAAAGG + Exonic
900227572 1:1540241-1540263 GCGCGCGGGCGGGGAGCAGGGGG + Intronic
903233862 1:21937331-21937353 CGGGGCGGGCGGGGAGGAAAGGG - Intergenic
906481639 1:46203313-46203335 CCGCGCGGGCGGGGACCCACCGG + Exonic
912879034 1:113390683-113390705 CCGCTCGGGCGCTGAGCCCAGGG + Intergenic
921172107 1:212558993-212559015 CGGCGGGGGCGGGGAGCAAGGGG + Intergenic
923429219 1:233904917-233904939 CCGCGCGGGCGCGCACAAAGCGG + Exonic
924754764 1:246931426-246931448 CCGGGCGTGCGCGGGGCCAACGG - Intronic
1073292154 10:102418780-102418802 GCGGGCGGGCCTGGAGCAAACGG - Exonic
1076908237 10:133373643-133373665 CCGCGCGGAGGCGGAGGCAACGG + Exonic
1077107869 11:849761-849783 CCGCGCGGGGGCGGAGCCGCCGG + Intronic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1110318600 13:74135559-74135581 CGGCGGGGGCGGGGAGCAGACGG + Intergenic
1118749033 14:68793400-68793422 CCGCGCGGGCGCAGAGCGGGAGG + Intronic
1121201477 14:92121737-92121759 CCGCGCCCGCACGGAGCAGAGGG + Exonic
1125742092 15:41972425-41972447 CGGCGCGGACGCGGTGCAGACGG - Exonic
1129791199 15:78341621-78341643 CCGGGCGGGCGCGGGGGATACGG - Intronic
1132398208 15:101489473-101489495 CGGCGGGGGCGCGGAGCAGGCGG + Exonic
1136957138 16:34801854-34801876 CCGCGGCGGCGGGGTGCAAAAGG - Intergenic
1137530332 16:49275382-49275404 CCGCGCAGGCGAGGAGCCGAGGG - Intergenic
1140223762 16:73063176-73063198 CTGCGCGCGCGGGGAGGAAAGGG + Intergenic
1142492153 17:286189-286211 CCACGAGGACGCGGAGCCAACGG + Intronic
1142810586 17:2393899-2393921 CCACGCGGGCGCTGAGCACATGG - Intronic
1144438671 17:15262528-15262550 CTGCGCGCGCGCGAAGCAAGGGG + Exonic
1147599109 17:41734754-41734776 CCGCGCGGGAGGGGAGCTAGTGG + Intergenic
1150326700 17:64263352-64263374 GGGCGCGGGGGCGGAGCAAACGG + Intergenic
1152652032 17:81499296-81499318 CGGCGCGGGCGCGAAGCAAGAGG - Intergenic
1157384162 18:47247842-47247864 CGGCGCGGGCGCGGCGCCCAAGG - Intronic
1161183356 19:2900357-2900379 CCGCGTGGGCGCGGACCCCATGG - Intergenic
1163593199 19:18205574-18205596 CCGCGTGGGCGCGGAGGGCAGGG - Intergenic
1163714651 19:18866700-18866722 CCGCGGCGGCGAGGAGCAGAGGG + Exonic
1168401461 19:56088085-56088107 CCGCGCGGGCGGGGAGGAGGAGG - Exonic
929788762 2:45009370-45009392 GCGGGCGGGCGCGGAGCATGCGG - Exonic
937045248 2:118847860-118847882 CCGCACGTGTGCGGAGCCAATGG + Intergenic
941119093 2:161507804-161507826 CCGGGCGTGCGCGGGGCCAACGG - Intronic
944114245 2:196170958-196170980 CCGCGCGGGCCCGCCGCGAAGGG + Intronic
1172146592 20:32762269-32762291 CCGCCCGGGCGCGGGGGGAACGG - Intergenic
1178561251 21:33641866-33641888 CCGCTCGGGGGCGGAGAAAGAGG + Intronic
1180699849 22:17775306-17775328 ACGCGAGGGCGCAGAGCAACTGG - Intergenic
1183149802 22:36028610-36028632 GCGGGCGGGCGGGGAGCAAGCGG - Intergenic
949548878 3:5096163-5096185 GCGCGCAGGCGCGGAGCCCACGG + Intergenic
954176198 3:48847668-48847690 CCTCGCGGGCGCGGAGCGAAAGG - Exonic
968353321 3:198080703-198080725 CCGCGCGGGCGCTGAGCTGCAGG - Intergenic
968382366 4:107675-107697 CCGCGCGGGGGAGGAGCAGGAGG - Intergenic
968835798 4:2963618-2963640 CCGGGCGGGCTCGGCGCTAACGG - Intronic
982257592 4:153466101-153466123 CCGCCCCGGCGCGGAGCACATGG - Intergenic
988578027 5:32444912-32444934 CCGCGCGGCCGCGGGGCGACGGG + Intergenic
1017877570 6:158536977-158536999 CCGGCCGGGCGCGGAGCCTACGG + Intronic
1019588521 7:1817313-1817335 CCGCCCGGGCGCGCAGCCAGGGG + Intronic
1019631762 7:2053297-2053319 CCGGGCGGGGGCAGAGCACAGGG + Intronic
1023015625 7:35967420-35967442 CAGCGCGGGCCCGGAGCAGGGGG + Intergenic
1025916839 7:65873120-65873142 GCGCGCGGGCGCGGAGGGAGGGG - Intergenic
1037575270 8:20197170-20197192 GCGCGCGGGCGCAGAGGGAAGGG - Intergenic
1049724323 8:144138445-144138467 CCGCGCGGGCGGGGAGGGGACGG + Intronic
1053239783 9:36486931-36486953 CGGCGCGGGCCCCGAGCAGAGGG - Intronic
1060191998 9:121599424-121599446 CAGCGCGGGCGGGGAGCAGAGGG - Intronic
1060700734 9:125747319-125747341 CCGCGCGGGCGGGGAGCGCGCGG + Intergenic
1061828472 9:133275663-133275685 CGTCGCGGGCGCGGGGCACAGGG - Intergenic
1061961770 9:133992348-133992370 CCGCGCGCGCGCGGGGCTCAGGG + Intronic
1062346824 9:136118817-136118839 CAGCGCGGGCCCGGAGCAGGGGG - Exonic
1062439486 9:136563362-136563384 CCACGCGGGCTGGGAGGAAAGGG - Intergenic
1200218409 X:154378925-154378947 CCGCGCGGGCGCGGAGCAGAAGG - Intergenic
1200218436 X:154379026-154379048 CCGCGCGGGCGCGGAGCAAAAGG - Intergenic