ID: 1200221152

View in Genome Browser
Species Human (GRCh38)
Location X:154390331-154390353
Sequence GCCCGCCGCTGCCGGGGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200221147_1200221152 -5 Left 1200221147 X:154390313-154390335 CCAGAGGTCGTGGCACCTGCCCG No data
Right 1200221152 X:154390331-154390353 GCCCGCCGCTGCCGGGGCGTCGG No data
1200221143_1200221152 17 Left 1200221143 X:154390291-154390313 CCCGAGAAGGGGCGAGAAACGTC No data
Right 1200221152 X:154390331-154390353 GCCCGCCGCTGCCGGGGCGTCGG No data
1200221142_1200221152 22 Left 1200221142 X:154390286-154390308 CCATTCCCGAGAAGGGGCGAGAA No data
Right 1200221152 X:154390331-154390353 GCCCGCCGCTGCCGGGGCGTCGG No data
1200221144_1200221152 16 Left 1200221144 X:154390292-154390314 CCGAGAAGGGGCGAGAAACGTCC No data
Right 1200221152 X:154390331-154390353 GCCCGCCGCTGCCGGGGCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200221152 Original CRISPR GCCCGCCGCTGCCGGGGCGT CGG Intronic