ID: 1200222650

View in Genome Browser
Species Human (GRCh38)
Location X:154398906-154398928
Sequence GGCCGCCTCCTGTGTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200222649_1200222650 -6 Left 1200222649 X:154398889-154398911 CCGGGAAAAACGGGTGCGGCCGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1200222650 X:154398906-154398928 GGCCGCCTCCTGTGTCCTACAGG 0: 1
1: 0
2: 1
3: 8
4: 139
1200222641_1200222650 24 Left 1200222641 X:154398859-154398881 CCGCGTGCGTTGTCGGACGTGAA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1200222650 X:154398906-154398928 GGCCGCCTCCTGTGTCCTACAGG 0: 1
1: 0
2: 1
3: 8
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200222650 Original CRISPR GGCCGCCTCCTGTGTCCTAC AGG Intronic
900127161 1:1073717-1073739 GGCAGCCTCCTGGGCCCCACGGG - Intronic
900167138 1:1248324-1248346 GGCCTCCCCCTCTGCCCTACAGG + Intergenic
900167583 1:1249644-1249666 GGCCTCCCCCTCTGCCCTACAGG + Intergenic
900371747 1:2335321-2335343 GGCCGCCTCCTGCTTCCGCCGGG - Intronic
903499887 1:23795071-23795093 GGCCCCCTCCTGTGACCTCAGGG + Exonic
905773037 1:40650422-40650444 GGCCTTCTCCTTTGTCCTGCAGG - Intronic
913143121 1:115961866-115961888 GGGTGTCTCCTGGGTCCTACAGG - Intergenic
918150903 1:181797599-181797621 GGCAGACTCCTGGGTCCTTCAGG - Intronic
923458570 1:234187551-234187573 GGCTGTCTCCTGGGTCCTGCGGG - Intronic
1067528214 10:47051079-47051101 GGCCCCAGTCTGTGTCCTACTGG - Intergenic
1067559013 10:47291607-47291629 GGCATCCTCCTGTGTCCCTCTGG + Intergenic
1069416067 10:68201928-68201950 TGCCCCCACCTGTGTTCTACTGG + Exonic
1070466010 10:76724398-76724420 GGCCACCTCCTGTGTGCACCTGG + Intergenic
1073110989 10:101062916-101062938 GGTCGCCGCCTGTGTCCAGCCGG - Exonic
1075579082 10:123603337-123603359 GGCAGCCTCCTGATTTCTACAGG + Intergenic
1076406453 10:130215302-130215324 TGCTGCCTCCTGGGTCCTTCTGG + Intergenic
1076678413 10:132159749-132159771 GGCCTCTTCCTGTGTGATACTGG + Intronic
1076815196 10:132911160-132911182 GGCCGGCTCCGGGGACCTACAGG - Intronic
1077297779 11:1834191-1834213 GGCTGGCTCCTGTCACCTACAGG - Intronic
1077413748 11:2415047-2415069 GGCCGACGCCCGTGTCCTCCAGG - Exonic
1083072735 11:60003334-60003356 GGGTGTCTCCTGTGTCCTGCAGG - Intergenic
1083625326 11:64069329-64069351 GGCAGCCTCCTGTGCCCCCCAGG - Intronic
1083777782 11:64902602-64902624 TGCCGACTCCTGTGCCCTGCTGG - Exonic
1086264646 11:84983236-84983258 GGGCGTCTCCTGGGTCCTTCAGG - Intronic
1089184037 11:116602807-116602829 GGCTGCTTTCTGTGTCCTTCTGG + Intergenic
1091231896 11:133993457-133993479 GGACGCTTCCTTTGTCCTTCTGG + Intergenic
1094624189 12:32107069-32107091 GGCCGCCGCATGTGTCCTCGGGG - Intronic
1094718435 12:33035352-33035374 GGGTGTCTCCTGGGTCCTACAGG + Intergenic
1096556748 12:52408565-52408587 AGCCTCCTCCTGTGTCCTTCTGG + Intergenic
1101290260 12:103361166-103361188 GGCTGTCTCCTGGGTCCTGCAGG - Intronic
1105420598 13:20248519-20248541 GGACTCCACCTCTGTCCTACTGG - Intergenic
1108522736 13:51260027-51260049 AGCCTCCTCCTGTGTCCTATTGG - Intronic
1112035506 13:95493021-95493043 GGGTGTCTCCTGTGTCCTGCAGG + Intronic
1112666768 13:101584205-101584227 GGCTGTCTCCTGTCCCCTACTGG - Intronic
1113312050 13:109141020-109141042 GGCCGCCCCCCGCGCCCTACAGG + Exonic
1116870572 14:50065907-50065929 AGCCCCCTCCTGTCTCCTCCTGG - Intergenic
1118236412 14:64008990-64009012 GTACACCTCCTGTTTCCTACCGG + Intronic
1118639199 14:67776649-67776671 TGGCACCTCCTATGTCCTACAGG + Intronic
1122290905 14:100679960-100679982 GGCCGCCTCCTCTGCCTTGCTGG - Intergenic
1124910436 15:33915307-33915329 GGTTGTCTCCTGTGGCCTACAGG - Intronic
1129178456 15:73856732-73856754 GCCAGCCTCCTGTTTCCTGCTGG - Intergenic
1134215147 16:12311489-12311511 GGCCGCCTCCCATTTCCTCCAGG + Intronic
1138221126 16:55251187-55251209 GGCAGCCTACTATGTCCTGCAGG - Intergenic
1138294017 16:55871598-55871620 GGCTGCCTGCTGTGTGCTTCGGG - Intronic
1138514659 16:57529309-57529331 GGACGCCTCCTCGGACCTACGGG + Exonic
1140623830 16:76769094-76769116 GCCCGCCTGCTGTGTCGAACTGG - Intergenic
1141628092 16:85272023-85272045 GGCTGCCTCCTGTGCACTACAGG + Intergenic
1142193174 16:88727192-88727214 CGGCGGCTCCTGTGTCCTGCAGG - Exonic
1142253339 16:89002606-89002628 GCCCGGCTCCTCTGTCCTCCCGG - Intergenic
1142413099 16:89926086-89926108 GGCAGCGTCCTGTGTCCCGCGGG - Intronic
1142690966 17:1605888-1605910 GGCCACCTCCTGTGCCTTCCCGG + Intronic
1144578297 17:16443650-16443672 GGCCCCCTCCAGGGTCCTCCTGG + Exonic
1144726731 17:17506041-17506063 GGCTGCCTGCTGGGTCCTGCAGG + Intronic
1145211634 17:21017576-21017598 GTCACCCTCCTGTGTCCTCCTGG - Intronic
1148197061 17:45721687-45721709 GGTCTCCTCCTGTGTACCACAGG + Intergenic
1148225720 17:45896623-45896645 GGCTTCCTCCCGTGTCCTCCAGG - Intronic
1148432037 17:47650282-47650304 CCCCGGCTCCTGCGTCCTACCGG - Exonic
1151414587 17:73952935-73952957 GGCCGGCTCCCGCGTCCCACTGG + Intergenic
1151632676 17:75321574-75321596 GGGCGCCTCCCCTTTCCTACAGG + Intronic
1151946293 17:77321756-77321778 GTCCGCCTGCTGTGCCCGACTGG - Intronic
1151996312 17:77611508-77611530 GGAAGCCTCCTGGGTCCTGCTGG + Intergenic
1153179149 18:2413463-2413485 GGCCTCCTCCTATTTCCCACTGG + Intergenic
1153389857 18:4544350-4544372 GCCATCCTGCTGTGTCCTACTGG + Intergenic
1157540838 18:48505438-48505460 GGGTGTCTCCTGGGTCCTACAGG - Intergenic
1158648064 18:59264891-59264913 GGGCGCCTCCGCGGTCCTACGGG + Intergenic
1159454161 18:68639257-68639279 GGCCGTCTCCTGGGTCCTACAGG + Intergenic
1159702975 18:71653101-71653123 GGCTAGCTCCTGTGTCCTTCTGG + Intergenic
1159786966 18:72726505-72726527 GGATGTCTCCTGGGTCCTACAGG - Intergenic
1165316829 19:35060859-35060881 GGTCCCCTCCTCTGTCCTCCTGG - Intronic
1166262802 19:41653164-41653186 GGCTGTCTCCTGGGTCCTGCCGG - Intronic
1167145938 19:47680901-47680923 GGCCGCCACCACTGTCCTCCAGG + Exonic
927824842 2:26301164-26301186 GTCCGCCTCCAGTGGCCTTCTGG - Intergenic
930093924 2:47552272-47552294 GGCAGCCCCCTGTGCCCTGCAGG - Intronic
947457222 2:230265798-230265820 GGCGGTCTCCTGGGTCCTGCAGG + Intronic
947650308 2:231781017-231781039 GGCCGCCTCCCAAGTCCTCCCGG + Intronic
1169145995 20:3252716-3252738 GGCAGCCTCCCTTGTCCTCCAGG - Intronic
1171449011 20:25223297-25223319 GGAGGCCTCCTGTGACCTGCAGG + Intronic
1173249796 20:41358417-41358439 GGGCCCCTCCTGTCTCCCACAGG + Exonic
1174708194 20:52678276-52678298 GGCCGCCTCCAGCTTCCTGCTGG + Intergenic
1175552797 20:59827885-59827907 GCCTGCCTCCTGTGTCCTGAGGG - Intronic
1178952792 21:36998883-36998905 GGCCACATCCTGTGTACTACAGG + Intergenic
1180762310 22:18219919-18219941 GCCCGCCTCCTGCGTCCTGGGGG - Intergenic
1180773357 22:18404689-18404711 GCCCGCCTCCTGCGTCCTGGGGG + Intergenic
1180804710 22:18654238-18654260 GCCCGCCTCCTGCGTCCTGGGGG + Intergenic
1180806036 22:18715172-18715194 GCCCGCCTCCTGCGTCCTGGGGG - Intergenic
1181192453 22:21151622-21151644 GCCCGCCTCCTGCGTCCTGGGGG + Intergenic
1181216986 22:21340953-21340975 GCCCGCCTCCTGCGTCCTGGGGG - Intergenic
1182682861 22:32096013-32096035 GGCTGTCTCCTGGGTCCTGCAGG + Intronic
1203235187 22_KI270731v1_random:145671-145693 GCCCGCCTCCTGCGTCCTGGGGG + Intergenic
950063906 3:10095595-10095617 AGCCACCTCCTGTCTCCTGCAGG - Intronic
954317196 3:49807550-49807572 GGCTGCTTCCTGTGTCTGACAGG + Intronic
959295636 3:104531085-104531107 GGCAGCCTCGTGTGCCCTAGGGG + Intergenic
962285664 3:134084080-134084102 GGCAGCCTCCTGTGCCCTCCTGG + Intronic
962999403 3:140664188-140664210 GGCTGTCTCCTGGGTCCTGCAGG - Intergenic
966992139 3:185243211-185243233 GGATGTCTCCTGTGTCCTGCAGG + Intronic
968513375 4:1004903-1004925 GGCCACCTCCTGGGTCGCACAGG - Intergenic
968874428 4:3257865-3257887 GCCCGCATCCTCTGTCCTCCTGG - Intronic
968962650 4:3753236-3753258 GGCTGCCTCTTGTGCCCTCCGGG - Intergenic
973951138 4:56015483-56015505 GGCCCCACCCTGTGTCCCACAGG - Intronic
974508600 4:62808061-62808083 GGCAGCTTCCTGTGTCCCTCTGG + Intergenic
975020077 4:69475058-69475080 GGCTGTCTCCTGGGTCCTGCTGG + Intergenic
975533895 4:75428566-75428588 TGCAGCCTCCTGTGTCCTCAGGG - Intergenic
981460977 4:145013725-145013747 GGCTGTCTCCTGGGTCCTGCAGG - Intronic
985562175 5:593730-593752 GGCCTGCTCCTGAGTCCCACTGG - Intergenic
985926378 5:3022846-3022868 GGCCTCCTGCTGTGGCCCACAGG - Intergenic
987062825 5:14258700-14258722 GGCCTCCTCCTGCTTGCTACTGG - Intronic
993424786 5:87749544-87749566 GGCCTCCTTCTGAGCCCTACTGG + Intergenic
999394852 5:151220925-151220947 GGCCTTCTCCTGAGTCCTCCTGG + Intronic
1003535174 6:6970123-6970145 AGGCGCCTCCTATGTCCTACGGG + Intergenic
1006332900 6:33405083-33405105 GGCCTCCTCCTGTTTCCCTCTGG + Exonic
1010633837 6:78232126-78232148 GGCTGTCTCCTGGGTCCTCCAGG + Intergenic
1010830064 6:80516346-80516368 AGCTGCCTCCTATGTCTTACTGG + Intergenic
1013221444 6:108080993-108081015 GGTTGTCTCCAGTGTCCTACAGG + Intronic
1013852759 6:114535279-114535301 GGGTGTCTCCTGTGTCCTGCAGG + Intergenic
1015849930 6:137560827-137560849 GGGTGCCTCCTGGGTCCTGCAGG + Intergenic
1016384833 6:143520396-143520418 GGCTGTCTCCTGGGTCCTGCAGG - Intergenic
1018369046 6:163150343-163150365 GGCGGCCTGGTGTGTCCTGCTGG - Intronic
1018790010 6:167140989-167141011 CACCTCCTTCTGTGTCCTACAGG - Intergenic
1019492059 7:1318892-1318914 GGCTGCCTTCTGAGTCCCACAGG - Intergenic
1023989909 7:45122465-45122487 GCCTGCCTCCTATGTCCTGCCGG + Intergenic
1024416986 7:49119031-49119053 GGCCACTCCCTGTGTCCCACTGG + Intergenic
1024917351 7:54515888-54515910 GGGTGCCTCCTGGGTCCTGCAGG + Intergenic
1026853415 7:73738442-73738464 GGCCGCTTCCGCTTTCCTACAGG - Exonic
1028231613 7:88312230-88312252 GGCCGCCTCCAGATTCCTATTGG - Intergenic
1028962287 7:96762094-96762116 GGGTGTCTCCTGGGTCCTACAGG + Intergenic
1029993530 7:104984237-104984259 AGCCGCCTTCTGTGTCATATGGG - Intergenic
1030935861 7:115584692-115584714 GGGTGTCTCCTGGGTCCTACAGG - Intergenic
1031761372 7:125716661-125716683 GGGTGCCTCCTGGGTCCTGCAGG + Intergenic
1031827853 7:126588770-126588792 GGCTGTCTCCTGGGTCCTGCAGG - Intronic
1033622784 7:143077351-143077373 GGCTGTCTCCTGGGTCCTGCAGG - Intergenic
1035150976 7:156872903-156872925 GACTGCCTCCTGGGTCCTGCAGG - Intronic
1047646322 8:126874156-126874178 GGCAGCCTCCAGTGCCCCACTGG - Intergenic
1049345976 8:142138843-142138865 TCCCTCCTCCTGTGTCCTAGGGG - Intergenic
1052822226 9:33146459-33146481 GGCAGCCACCTGTGTCCTCTGGG + Intronic
1055986948 9:82062268-82062290 GGCCTCCCCCTCTGCCCTACTGG + Intergenic
1058540648 9:106009055-106009077 GGTTGTCTCCTGGGTCCTACAGG + Intergenic
1060729298 9:126027184-126027206 TGGCGCCTCCTGGGTCCCACCGG - Intergenic
1060780494 9:126408703-126408725 GGCCGTGTCCTGAGTCCTTCGGG + Intronic
1061875406 9:133541075-133541097 TGCAGCCTCCTGTGTACCACTGG + Intronic
1062070609 9:134553247-134553269 GGCCTCCTCCTGGGTCCCAAGGG + Intergenic
1062672319 9:137718584-137718606 GGCCGGCTCTTCTGTCCTCCTGG + Intronic
1189668202 X:43380416-43380438 GGCTGTCTCCTGTGTCCTGCAGG - Intergenic
1190895604 X:54614768-54614790 GGGCGTCTCCTGGGTCCTGCAGG + Intergenic
1195985252 X:110622173-110622195 GGCTGTCTCCTGGGTCCTGCAGG + Intergenic
1196235402 X:113274215-113274237 GGGTGTCTCCTGGGTCCTACAGG - Intergenic
1198212443 X:134528950-134528972 GGAAGCCTCCTGTTTCCTACAGG - Intergenic
1199028431 X:142968239-142968261 CTCAGCATCCTGTGTCCTACTGG + Intergenic
1200222650 X:154398906-154398928 GGCCGCCTCCTGTGTCCTACAGG + Intronic
1200414944 Y:2899822-2899844 GGGTGTCTCCTGGGTCCTACAGG - Intronic