ID: 1200224819

View in Genome Browser
Species Human (GRCh38)
Location X:154411668-154411690
Sequence GCTCCGGCCTGACCTGCGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 89}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200224806_1200224819 20 Left 1200224806 X:154411625-154411647 CCGGCGACCGCTCCCCAGTGACG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1200224819 X:154411668-154411690 GCTCCGGCCTGACCTGCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 89
1200224811_1200224819 8 Left 1200224811 X:154411637-154411659 CCCCAGTGACGAGAGAGCGGGGC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1200224819 X:154411668-154411690 GCTCCGGCCTGACCTGCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 89
1200224805_1200224819 21 Left 1200224805 X:154411624-154411646 CCCGGCGACCGCTCCCCAGTGAC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1200224819 X:154411668-154411690 GCTCCGGCCTGACCTGCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 89
1200224804_1200224819 22 Left 1200224804 X:154411623-154411645 CCCCGGCGACCGCTCCCCAGTGA 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1200224819 X:154411668-154411690 GCTCCGGCCTGACCTGCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 89
1200224813_1200224819 6 Left 1200224813 X:154411639-154411661 CCAGTGACGAGAGAGCGGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1200224819 X:154411668-154411690 GCTCCGGCCTGACCTGCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 89
1200224803_1200224819 29 Left 1200224803 X:154411616-154411638 CCTGTGACCCCGGCGACCGCTCC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1200224819 X:154411668-154411690 GCTCCGGCCTGACCTGCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 89
1200224812_1200224819 7 Left 1200224812 X:154411638-154411660 CCCAGTGACGAGAGAGCGGGGCC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1200224819 X:154411668-154411690 GCTCCGGCCTGACCTGCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 89
1200224807_1200224819 13 Left 1200224807 X:154411632-154411654 CCGCTCCCCAGTGACGAGAGAGC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 1200224819 X:154411668-154411690 GCTCCGGCCTGACCTGCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200224819 Original CRISPR GCTCCGGCCTGACCTGCGAA GGG Exonic
900205884 1:1431732-1431754 GCTCCGGCATGACGTGTGACAGG - Intergenic
902213976 1:14923473-14923495 GCTCTGGCCTCCCCTGCCAATGG + Intronic
906837403 1:49098768-49098790 GCTCCAGCCTCACCTGTGAAGGG - Intronic
907377181 1:54053450-54053472 GCCCCAGCCTGCCCCGCGAAGGG - Intronic
912511439 1:110192715-110192737 GTTCCTGCCTGTCCTGGGAAGGG - Intronic
920178363 1:204117305-204117327 ACTCAGGCCTGACCTGAGGAGGG + Intronic
1065102048 10:22340867-22340889 CCGCCGGCCTGAGCTGGGAAAGG - Intergenic
1073325857 10:102643770-102643792 GCTCCGGCCTGACCCCCGGGCGG - Intergenic
1075394162 10:122114486-122114508 CCTCCCGCCTGGCCTGAGAAGGG - Intronic
1077051421 11:568589-568611 GCGCCGGCCTCGCCCGCGAAGGG - Intergenic
1089734118 11:120538127-120538149 TTTCCGGCCTGACCTGCTCACGG + Intronic
1091386475 12:99193-99215 GCTCCGACCTGGCCTCCCAAAGG + Exonic
1095038415 12:37419008-37419030 GCTCCGGCCTGACCTTTCCACGG - Intergenic
1096898202 12:54846392-54846414 CCTGTGGCATGACCTGCGAAGGG + Intronic
1104858984 12:131915091-131915113 GGTGCTGCCTGACCTGCGGATGG - Exonic
1105008347 12:132737104-132737126 ACCCAGGCCTGACCTGCGGAGGG - Intronic
1106541672 13:30696319-30696341 ACTCCAGCCTGACTTGCAAAAGG - Intergenic
1113683770 13:112263369-112263391 GCTTTGGGCTGAGCTGCGAAGGG - Intergenic
1119438487 14:74612684-74612706 GCTCCGGCCGGCCCTGCGGAGGG - Intergenic
1122283793 14:100639183-100639205 GCTCCTGCCTGACCTGGGCCTGG + Intergenic
1126327980 15:47502509-47502531 CCTCCGGCCTGAAGTGCAAATGG + Intronic
1132546642 16:536226-536248 GCTCCGGCCAGACCTCGGCAGGG - Intronic
1132608532 16:803548-803570 GCTGCGGCCTCAACTCCGAATGG + Intergenic
1132771763 16:1567471-1567493 GCTCCGGCCAGGCCTGCTGAGGG - Intronic
1132993774 16:2812085-2812107 GCTCTGGCCTGAGCGGAGAAGGG + Intergenic
1136776871 16:32876654-32876676 GCTCCTCCCTGACCTGTGAGGGG + Intergenic
1136893746 16:33984859-33984881 GCTCCTCCCTGACCTGTGAGGGG - Intergenic
1203079287 16_KI270728v1_random:1138763-1138785 GCTCCTCCCTGACCTGTGAGGGG + Intergenic
1144495382 17:15742137-15742159 GCCACGGCCTGACCTGGGATGGG + Intronic
1145306561 17:21678710-21678732 GCTCCGGCCTGACCTCTTCATGG - Intergenic
1145379056 17:22377098-22377120 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145379535 17:22379468-22379490 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145380014 17:22381838-22381860 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145380494 17:22384213-22384235 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145380972 17:22386560-22386582 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145381454 17:22388935-22388957 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145382184 17:22392709-22392731 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145382660 17:22395074-22395096 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145382942 17:22396437-22396459 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145383514 17:22399260-22399282 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145384029 17:22401728-22401750 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145384465 17:22403930-22403952 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145384784 17:22405392-22405414 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145384911 17:22406022-22406044 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1145385961 17:22411610-22411632 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1151494849 17:74453271-74453293 CCTCAGGCCTGACCTGGCAAAGG - Intergenic
1154074784 18:11189164-11189186 GCTCCGGCCTGACCTCTCCAGGG - Intergenic
1155651590 18:28150209-28150231 GCTCCGGCCTGACCTGTCATGGG - Intronic
1158906487 18:62018183-62018205 GCTCCGGCCTGCCCTGGGAAGGG + Intergenic
1160804236 19:984769-984791 GCTCAGGCCTGAGCTGCTATGGG + Intronic
1161264551 19:3358437-3358459 GCTCCGACCTGACGGGTGAAAGG - Intergenic
1161741453 19:6023319-6023341 GCCCCCGCCTGACCTGCAGAAGG + Intronic
1165596155 19:37012454-37012476 GCTCCGGCCTGACCTCTCCAGGG + Intronic
1165601682 19:37059479-37059501 GCTCCGGCCTGACCTCTCCACGG + Intronic
1166763396 19:45238510-45238532 GCTCCGGACTCACCTGACAATGG + Intronic
1167101514 19:47406959-47406981 GCTGCACCCTGCCCTGCGAAGGG + Exonic
1167376389 19:49114508-49114530 GCACTGGCCTGACCCGGGAAGGG - Intronic
925834886 2:7934946-7934968 GGTCGGGCCTGAACTGGGAATGG - Intergenic
929924732 2:46198709-46198731 GCACCGTCCTGACCTGGGACTGG + Intergenic
931461122 2:62450868-62450890 GCTCCACCCTGACCTGCTCAGGG - Intergenic
935385827 2:102499172-102499194 GCTCAGGCCTTAGCTGAGAATGG + Intronic
1171533221 20:25865722-25865744 GCTCCGGCCTGACCTCTCCACGG - Intronic
1171533663 20:25868082-25868104 GCTCCGGCCTGACCTCTTCACGG - Intronic
1171837223 20:30168241-30168263 GCTCCGGCCTGACCTCTCCACGG - Intergenic
1171846726 20:30281855-30281877 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1172702986 20:36863858-36863880 GCGCCAGCCTGACCCTCGAAGGG - Intergenic
1175437986 20:58968075-58968097 GCTCCTGCCTTCCCTGAGAACGG - Intergenic
1175734577 20:61376403-61376425 GCTCTGGCCAGGCCTGGGAAGGG + Intronic
1176656514 21:9592718-9592740 GCTCCGGCCTGACCTCTCCACGG - Intergenic
1180049411 21:45324476-45324498 GCTCTGGCCTGAGCTAGGAAGGG + Intergenic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
965784105 3:172318269-172318291 GGCCTGGCCTGACCTGCTAATGG - Intronic
968521537 4:1036707-1036729 GCCCCGGCCTCACCAGGGAAGGG - Intergenic
973588866 4:52420368-52420390 GCTTCTGCCTGGCCTGAGAAGGG + Intergenic
989818520 5:45765583-45765605 GCTGCGGCCTGCCCTGCCCAAGG - Intergenic
998243416 5:140472229-140472251 CCTCCTGCTTGTCCTGCGAAAGG - Intronic
999439944 5:151593323-151593345 GCTCCAGCCTGTCCAGCGCAGGG + Intergenic
1002522640 5:179800125-179800147 GCGCCGCCCTGCCCTGCGATGGG - Intronic
1006472840 6:34237864-34237886 GCTCCGGCCTCATCTGCGGAGGG - Intronic
1006643445 6:35500208-35500230 GCTCAGGACTGACCGGAGAAGGG + Intronic
1017671912 6:156777538-156777560 GCTCCGGCGGGGCCTGCGGAGGG + Intergenic
1018800486 6:167218302-167218324 GCCCAGGGCTGACCTGCCAAAGG + Intergenic
1018809679 6:167289056-167289078 GCCCAGGGCTGACCTGCCAAAGG - Intronic
1019558002 7:1642101-1642123 GTTCCTGCCTGACTTGAGAAGGG - Intergenic
1020142887 7:5622159-5622181 GCAGCGGCCTGGCCTGGGAAAGG + Intronic
1049436438 8:142588276-142588298 GCTCTGACCTGACCTGAGCAGGG - Intergenic
1052840658 9:33289225-33289247 GCTCCAGCCAGACCCCCGAAAGG + Intergenic
1054160881 9:61671500-61671522 GCTCTGGCCTCACCTGCCACGGG - Intergenic
1054173146 9:61858066-61858088 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1054447999 9:65387108-65387130 GCTCCGGCCTGACCTCTCCACGG + Intergenic
1054664396 9:67722715-67722737 GCTCCGGCCTGACCTCTCCACGG - Intergenic
1062327118 9:136017703-136017725 GCTCCGCCCTCACCTGAGCAGGG - Intronic
1203634229 Un_KI270750v1:96200-96222 GCTCCGGCCTGACCTCTCCACGG - Intergenic
1200102988 X:153697390-153697412 GCTCCTCCCTGACCTGTGAGGGG - Intergenic
1200224819 X:154411668-154411690 GCTCCGGCCTGACCTGCGAAGGG + Exonic