ID: 1200226204

View in Genome Browser
Species Human (GRCh38)
Location X:154419294-154419316
Sequence TCCAGGGCCTGCATGGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 268}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200226204_1200226216 16 Left 1200226204 X:154419294-154419316 CCAAGTGCCATGCAGGCCCTGGA 0: 1
1: 0
2: 3
3: 23
4: 268
Right 1200226216 X:154419333-154419355 CGTCTGTGGATGGCGCAGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 92
1200226204_1200226219 22 Left 1200226204 X:154419294-154419316 CCAAGTGCCATGCAGGCCCTGGA 0: 1
1: 0
2: 3
3: 23
4: 268
Right 1200226219 X:154419339-154419361 TGGATGGCGCAGTGGGGGATGGG 0: 1
1: 0
2: 1
3: 17
4: 200
1200226204_1200226213 6 Left 1200226204 X:154419294-154419316 CCAAGTGCCATGCAGGCCCTGGA 0: 1
1: 0
2: 3
3: 23
4: 268
Right 1200226213 X:154419323-154419345 CATTGGAGGGCGTCTGTGGATGG 0: 1
1: 0
2: 0
3: 10
4: 151
1200226204_1200226214 14 Left 1200226204 X:154419294-154419316 CCAAGTGCCATGCAGGCCCTGGA 0: 1
1: 0
2: 3
3: 23
4: 268
Right 1200226214 X:154419331-154419353 GGCGTCTGTGGATGGCGCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 169
1200226204_1200226212 2 Left 1200226204 X:154419294-154419316 CCAAGTGCCATGCAGGCCCTGGA 0: 1
1: 0
2: 3
3: 23
4: 268
Right 1200226212 X:154419319-154419341 CGGTCATTGGAGGGCGTCTGTGG 0: 1
1: 0
2: 0
3: 2
4: 50
1200226204_1200226215 15 Left 1200226204 X:154419294-154419316 CCAAGTGCCATGCAGGCCCTGGA 0: 1
1: 0
2: 3
3: 23
4: 268
Right 1200226215 X:154419332-154419354 GCGTCTGTGGATGGCGCAGTGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1200226204_1200226218 21 Left 1200226204 X:154419294-154419316 CCAAGTGCCATGCAGGCCCTGGA 0: 1
1: 0
2: 3
3: 23
4: 268
Right 1200226218 X:154419338-154419360 GTGGATGGCGCAGTGGGGGATGG 0: 1
1: 1
2: 3
3: 24
4: 455
1200226204_1200226217 17 Left 1200226204 X:154419294-154419316 CCAAGTGCCATGCAGGCCCTGGA 0: 1
1: 0
2: 3
3: 23
4: 268
Right 1200226217 X:154419334-154419356 GTCTGTGGATGGCGCAGTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 225
1200226204_1200226210 -7 Left 1200226204 X:154419294-154419316 CCAAGTGCCATGCAGGCCCTGGA 0: 1
1: 0
2: 3
3: 23
4: 268
Right 1200226210 X:154419310-154419332 CCCTGGAGACGGTCATTGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 104
1200226204_1200226208 -8 Left 1200226204 X:154419294-154419316 CCAAGTGCCATGCAGGCCCTGGA 0: 1
1: 0
2: 3
3: 23
4: 268
Right 1200226208 X:154419309-154419331 GCCCTGGAGACGGTCATTGGAGG 0: 1
1: 0
2: 1
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200226204 Original CRISPR TCCAGGGCCTGCATGGCACT TGG (reversed) Intronic
901725164 1:11236036-11236058 TCCAGGTACTGCTGGGCACTGGG - Intronic
902337407 1:15761328-15761350 CCCAGGCCATCCATGGCACTCGG - Intronic
902530534 1:17087866-17087888 CCCAGGGCCTGCCCGGCACATGG + Intronic
903169193 1:21541642-21541664 ACCAAGGGCTTCATGGCACTGGG + Intronic
905170997 1:36109430-36109452 TCCAGGGGCTGCCTGGAACTAGG - Intronic
905206225 1:36344222-36344244 CCCAGGGCCCACATGTCACTGGG + Exonic
905277171 1:36825741-36825763 TCCAAGCCCTTCATGACACTTGG - Exonic
905313194 1:37064897-37064919 TCCAGAGCCTCCAAGGCAGTGGG - Intergenic
906702269 1:47868446-47868468 TCCATGGCCTGCGAGGAACTGGG + Intronic
912491571 1:110065373-110065395 TCCACAGCCTGCCTGGCCCTGGG - Intronic
913302763 1:117389516-117389538 TCCAGGGCCTGTTAGGAACTCGG - Intronic
915029267 1:152862160-152862182 CCCAGGGCATCCAGGGCACTGGG + Intergenic
915334262 1:155131529-155131551 TCCGGGCCATGCTTGGCACTGGG - Exonic
916681830 1:167111975-167111997 TCCATGGCCTGGCTGACACTGGG - Intronic
916688161 1:167166502-167166524 TCCAGGGTCTCCATGGCAACGGG + Intergenic
916851304 1:168706912-168706934 CCCTGGGCCTGCATGTCAGTGGG + Intronic
919368879 1:196700724-196700746 TCCAGTGCCCCCATGCCACTGGG + Intronic
919761951 1:201103674-201103696 TCCAGGACCTGCAGAGCACAGGG - Intronic
922565208 1:226597128-226597150 TCCCTGGGCTGCTTGGCACTGGG + Intronic
924528667 1:244874593-244874615 TCAAGGGCCTCCATGGCCATTGG + Intergenic
1063010004 10:2012394-2012416 TTCTGGGCATGCATGGCCCTGGG + Intergenic
1063053372 10:2477080-2477102 TCCAGGGCTTGCTTGGCCATGGG + Intergenic
1063885796 10:10577211-10577233 GACAGAGCCTGCATGGCAATGGG + Intergenic
1063920644 10:10928855-10928877 TCCAGGCACTGCTAGGCACTGGG - Intergenic
1065017948 10:21478788-21478810 TGCAGGGCCTGAACGGTACTTGG + Intergenic
1066183723 10:32988570-32988592 TCCAGTGCTTGCATGACACTTGG - Intronic
1067037722 10:42932313-42932335 CCCAGGGCTTGCAGAGCACTAGG + Intergenic
1067338043 10:45379976-45379998 GCCAGGCCCTGCATGCCACAGGG - Intronic
1067347507 10:45447116-45447138 TACAGGGCCAGCATGGCATAGGG + Intergenic
1067565017 10:47330209-47330231 TCCCTGGCCTCCATGTCACTGGG + Intergenic
1067751079 10:48971665-48971687 TCCATGCCCTGCATGGCACCAGG - Intronic
1067838046 10:49653699-49653721 TGCAGGACCTGCCTGGCATTTGG + Intronic
1070734756 10:78855849-78855871 ACCAGGGGCTGCAGGGAACTTGG + Intergenic
1070754831 10:78985508-78985530 TGCAGGGCCTCAAGGGCACTAGG + Intergenic
1076510783 10:131012394-131012416 TCCAGGGCCTGGCTGGCTCCTGG - Intergenic
1076823270 10:132952645-132952667 TCCAGGGCCTGCATTTCAGAGGG - Intergenic
1077533922 11:3110045-3110067 CCCCGGGCCTGCATGGGACCTGG + Intronic
1080128498 11:28766164-28766186 TCTAGGTCCAGCATAGCACTAGG - Intergenic
1081784029 11:45733731-45733753 CCCAGGCCCTGCATGACCCTGGG + Intergenic
1083604490 11:63969957-63969979 TCCTGGGCTTGTCTGGCACTGGG - Intergenic
1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG + Intergenic
1083926324 11:65809186-65809208 TCCAGGGCCAGCCTTGCACCTGG + Intergenic
1084658231 11:70531741-70531763 TCCTGGGCCTGCATGTCACTCGG + Intronic
1084797525 11:71518713-71518735 TCCAGGGACTGCGCGGCACCTGG + Intronic
1084949417 11:72656502-72656524 GCCAGGGCCAGCAAGGCATTAGG - Intronic
1085320177 11:75569188-75569210 TCCAAGGCCTGCAGGCCCCTAGG - Intronic
1088382842 11:109215866-109215888 ACCAGGGCCTGTCAGGCACTAGG - Intergenic
1088576224 11:111274217-111274239 TAAAGGGCCTGCATGGGGCTGGG - Intronic
1089273281 11:117315918-117315940 GCCAGGGCCTGCAGGGCCCTGGG + Exonic
1089735700 11:120548977-120548999 TCCTGGGCCTGCCTGGAGCTAGG - Intronic
1089938309 11:122388667-122388689 TCCTTAGCCTGCATGGGACTTGG - Intergenic
1091346281 11:134856513-134856535 TCCAGGCCCAGCAAGGCACAGGG + Intergenic
1091361755 11:134983598-134983620 TAAAGGGCCTGCCTGGCTCTAGG - Intergenic
1091639177 12:2221463-2221485 GCCAGGGCCTGCTGGGCAGTTGG + Intronic
1096187033 12:49588077-49588099 TCCAGAGCCTGCAGGTCACATGG + Intronic
1097541352 12:60947884-60947906 ACCAGTGCCTGCATCGCACAAGG + Intergenic
1099024428 12:77447855-77447877 TCCAAGCCCAGCATGGCTCTAGG - Intergenic
1101363029 12:104045449-104045471 TGCAGGGCAGGCAAGGCACTGGG + Intronic
1102709007 12:114908911-114908933 TGCAGGGCCTGGTTGGCATTTGG - Intergenic
1103701032 12:122848867-122848889 TCTAGGTCCTGCCTGGCATTCGG + Intronic
1104056295 12:125233413-125233435 TCCAGGGCCTGCCTGGAAGGTGG - Intronic
1104603754 12:130172106-130172128 TCAGGGGCGTGCATGTCACTCGG + Intergenic
1104658557 12:130592289-130592311 TCCACAGCCTCCCTGGCACTGGG - Intronic
1104803582 12:131570960-131570982 TCCAGGGCCCCCACGGCCCTGGG + Intergenic
1105318462 13:19291195-19291217 TCCAGGGCCTCCGAGGCCCTAGG + Intergenic
1105557527 13:21460390-21460412 TTCAGGGCCAGCATGGCAACAGG - Intergenic
1113335122 13:109370040-109370062 TCCTGAGCGTGAATGGCACTCGG + Intergenic
1113677385 13:112216013-112216035 TCCAGGGCCTGCAGGCCCTTCGG + Intergenic
1113769359 13:112898550-112898572 AGCAGGGCCTGCATGGCCGTGGG - Intronic
1115308568 14:31957036-31957058 TCCATGGCCTGTCTGGAACTGGG + Intergenic
1116932727 14:50705644-50705666 TCCCCGGCCTCCTTGGCACTGGG - Intergenic
1120467932 14:84885115-84885137 TCCAAGCCCTGCATAGCACCAGG - Intergenic
1121232134 14:92365639-92365661 CCCAGGGCCTGCGAGTCACTTGG + Intronic
1121408175 14:93732110-93732132 TCCAGTGGCTTCATGGCAATTGG + Intronic
1121680671 14:95790406-95790428 TCCAGGGGCTGCTTAGGACTGGG + Intergenic
1122003276 14:98682314-98682336 TCCAGGGAATGCTTGACACTTGG - Intergenic
1122272804 14:100575885-100575907 TCCAGGGCCTGGGTGGCACCAGG + Intronic
1127179981 15:56404967-56404989 ACCAGGGCCTGTCTGGCGCTAGG + Intronic
1127969289 15:63946097-63946119 CCCAGGGCCTGCCTGCCACCAGG + Intronic
1128085639 15:64884422-64884444 CCCACAGCCTGCTTGGCACTGGG - Intronic
1129154373 15:73708851-73708873 CCAGGGGCGTGCATGGCACTGGG + Intronic
1129405462 15:75313961-75313983 TCTAGGGCCTGCTTGGCAGGGGG - Intergenic
1129479127 15:75808883-75808905 TCTAGGGCCTGCTTGGCAGGGGG - Intergenic
1129746045 15:78021984-78022006 TCCAGGGCGTGCGTGACACTTGG - Intronic
1130838180 15:87672409-87672431 TCCTGGGCTTTCATAGCACTGGG - Intergenic
1130984750 15:88837498-88837520 GCCAGGGGCTGCATGGCTGTGGG - Intronic
1131049624 15:89337927-89337949 TCCAGGACCTGCCTGGAGCTTGG + Intergenic
1132634738 16:938223-938245 GCCATGGCCTGCCTGGCACAGGG + Intronic
1132652654 16:1028638-1028660 TCCTGCTCCTGCATGGCACCTGG + Intergenic
1132652753 16:1028981-1029003 TCCCGGGGCTGCACGGCGCTGGG - Intergenic
1132871859 16:2118905-2118927 TCCAGGGCCTGGTTGCCAGTGGG - Intronic
1133155570 16:3872894-3872916 CCCAGGGCCTGCCTCCCACTGGG + Intronic
1133171361 16:3984455-3984477 CCCAGGCCCTGCAAGGCTCTGGG + Intronic
1134227258 16:12400608-12400630 TCCAGGGCCTGCTTTGGTCTGGG - Intronic
1134520668 16:14917991-14918013 TCCAGGGCCTGGTTGCCAGTGGG + Intronic
1134550907 16:15137983-15138005 TCCAGGGCCTGGTTGCCAGTGGG - Intronic
1134708340 16:16316642-16316664 TCCAGGGCCTGGTTGCCAGTGGG + Intergenic
1134715555 16:16356675-16356697 TCCAGGGCCTGGTTGCCAGTGGG + Intergenic
1134951262 16:18352003-18352025 TCCAGGGCCTGGTTGCCAGTGGG - Intergenic
1134959202 16:18395484-18395506 TCCAGGGCCTGGTTGCCAGTGGG - Intergenic
1136994620 16:35181345-35181367 TCCAGGGCCTGGCAGGCACCAGG + Intergenic
1137371207 16:47907352-47907374 CCCGGGGGCTGCATGGCACAGGG + Intergenic
1137744518 16:50810780-50810802 TCTAGACCCTGAATGGCACTGGG + Intergenic
1139472475 16:67185525-67185547 GCCAAGGCCCGCATGGCCCTCGG + Intronic
1139955364 16:70690573-70690595 CCCAGGGCCTTGATGGCACTTGG + Intronic
1141993448 16:87622878-87622900 TCCAGGGCTGGCAAGGCATTGGG + Intronic
1143103612 17:4517307-4517329 CCCAGAGCCTGCATGGGACACGG + Intronic
1143188289 17:5023685-5023707 TGCAGGGACTGCAGGGCTCTGGG + Exonic
1144563852 17:16343960-16343982 TTCAGGGCCTGCTTGGGTCTGGG - Intronic
1144652640 17:17017164-17017186 GCCAGGGCCAGCAGGGCCCTTGG + Intergenic
1145882529 17:28362942-28362964 TCCAGGGACTGCTTGGCAGGAGG + Exonic
1145883758 17:28369177-28369199 ACCAGGTCCTGCAGGGCCCTGGG + Intronic
1146133517 17:30298046-30298068 TCCTGGCCTTGCTTGGCACTGGG - Intergenic
1147604210 17:41764798-41764820 CCCAGGGCCTGCATCCCACCTGG + Exonic
1148966328 17:51438913-51438935 TCCAGAGCCTGAATGTCACTGGG - Intergenic
1148979816 17:51562778-51562800 TCCATGGCCTGCTAGGAACTTGG - Intergenic
1149625697 17:58079087-58079109 ACCAGGGTCTGCATTGCAATGGG + Intergenic
1151468231 17:74301522-74301544 TCCTGGCCCTGCCTGGCACGGGG + Intronic
1151521818 17:74635664-74635686 TCTAGGGCCTGCATCGCAGGTGG - Intergenic
1152230336 17:79111149-79111171 TCCTGGGGCTGCAGGTCACTGGG + Intronic
1152276744 17:79362479-79362501 CGCTGGGCCTGGATGGCACTAGG + Intronic
1154493562 18:14939473-14939495 TAAAGGGCCTGCCTGGCTCTAGG + Intergenic
1156261341 18:35447123-35447145 TCCAGGGGCTGCATGGCACCGGG - Intronic
1157298787 18:46464792-46464814 CCCATGGCCTGCAGAGCACTGGG - Intergenic
1157305426 18:46513647-46513669 CCCAGAGCCTGCAGGGCACATGG + Intronic
1157500252 18:48185437-48185459 TCCAGGTGCTGCCTGGCACCTGG + Intronic
1157563090 18:48662268-48662290 TTCAGGGCCGCCATGGCCCTGGG - Intronic
1158213305 18:55073933-55073955 TGCATTGCCTGCATGGGACTAGG - Intergenic
1160795334 19:942657-942679 ACCAGGGCCTGCGGGGCAGTGGG - Intronic
1162780006 19:13002090-13002112 CCCAGGGCCTGCCTGGCTGTGGG - Intronic
1163205978 19:15803108-15803130 TCCAGCATCAGCATGGCACTTGG - Intergenic
1163712515 19:18855167-18855189 TCCAGGGCCCGCCAGGCACGGGG + Exonic
1163752506 19:19086010-19086032 TCCAGGTCCTCCACGGCACATGG - Intronic
1164556490 19:29256690-29256712 CCCAGGGCCAGGAGGGCACTGGG - Intergenic
1164709954 19:30348737-30348759 ACCTTGGTCTGCATGGCACTTGG - Intronic
1166434003 19:42751812-42751834 ACCAGGGCCCGCTTGGCAATGGG + Intronic
925104378 2:1277897-1277919 TCCAGGGTCTCCATGTCAGTGGG + Intronic
925724906 2:6863317-6863339 CCCAGGGCCTGCCTAGCACAGGG + Intronic
926012626 2:9421008-9421030 TCCAAGGCCTGCACGAAACTAGG + Intronic
927703352 2:25281999-25282021 CCCAGGAACTGCATGGCACGTGG + Intronic
928176367 2:29036895-29036917 CCCAGGGCCTCCAAGGCTCTTGG + Intronic
928221442 2:29406552-29406574 TGCAGAGCCTGCATGGAGCTGGG + Intronic
928539435 2:32270439-32270461 TCCATGGCCTGCTAGGAACTTGG + Intergenic
929883131 2:45854404-45854426 TCCAGGGCCTCAATAGCCCTGGG + Intronic
930818217 2:55620286-55620308 TCCAGGGCCTGTTAGGAACTGGG + Intergenic
930959130 2:57237450-57237472 TGCAGGGCTTGCCTGGCATTAGG - Intergenic
931812707 2:65870193-65870215 TCCAGTGCCTCCATGGCTCTCGG + Intergenic
932799165 2:74724157-74724179 TCCAGGGCCCTCTTGGCCCTGGG - Intergenic
933356563 2:81217605-81217627 GCCAGGGCCTGTATGGAAATGGG - Intergenic
934564534 2:95330967-95330989 GGCAGGGCCTGCAGGGCACATGG + Intronic
934870543 2:97861227-97861249 TCCAAGCCCAGCACGGCACTAGG - Intronic
938294909 2:130172091-130172113 TCCACGGCCTGCATGGGAATGGG - Intronic
938461718 2:131501744-131501766 TCCACGGCCTGCATGGGAATGGG + Intergenic
943156642 2:184187760-184187782 TCCATGGCCTGTTTGGAACTGGG - Intergenic
948908186 2:240989762-240989784 TCCAGGGCCTGCGTGGCCTGCGG - Intronic
1172039142 20:32031459-32031481 TCCAGGTACTGCATGGCCCCGGG - Exonic
1172481544 20:35274696-35274718 ACCAGGGCCAGCAGGGCCCTAGG + Exonic
1172606329 20:36216718-36216740 TCTAGGGCCCACATGCCACTGGG + Intronic
1172961560 20:38804211-38804233 TCCAAGGCTTGTGTGGCACTTGG - Intergenic
1174177201 20:48652606-48652628 TCCTGGGCCTGCTCGCCACTGGG + Exonic
1174660975 20:52212641-52212663 TCAAGGCCCTGCAGGACACTTGG + Intergenic
1174736374 20:52969599-52969621 TCCATGGCCTGTAAGGAACTAGG - Intergenic
1174878023 20:54248614-54248636 TCCAGGGCCCACATGGGACCTGG + Intergenic
1175440952 20:58990962-58990984 CCCAGGGCCTGCCAGGCTCTCGG + Exonic
1175705004 20:61170272-61170294 TCCTGGACATGCCTGGCACTGGG + Intergenic
1175736653 20:61391881-61391903 TCCGGGGCCTGCAGGGCTCTGGG + Intronic
1177902432 21:26933433-26933455 TGAAGGATCTGCATGGCACTGGG + Intronic
1178306262 21:31493137-31493159 TGCAGAGCCTGCATGGTACCTGG - Intronic
1179894122 21:44351828-44351850 CCCAGGGCCTGCTTGCCTCTGGG + Intronic
1180624642 22:17186086-17186108 GCCAGGGCCTGCATGGGGCAGGG + Intronic
1180954868 22:19737057-19737079 TGCAGGTCCTGCCTGGCACCCGG - Intergenic
1181114191 22:20621001-20621023 TCCACGGCCTGCATGGGAATGGG - Intergenic
1182791894 22:32960128-32960150 TCCAGGGCCAGCAAGGCCCAGGG - Intronic
1183101593 22:35587571-35587593 TGCAGGGCATGCATGCCACGCGG - Intergenic
1183343216 22:37293607-37293629 CTCAGGGCCAGCATGGGACTTGG - Intronic
1183903077 22:41021081-41021103 TCCAGGTCCTGCCCTGCACTTGG - Intergenic
1184602798 22:45553369-45553391 ACCAGGGCCTGCGTGGCAGGGGG + Intronic
1184841496 22:47054948-47054970 CCCAGGTCCAGCATGGCCCTGGG + Intronic
949922064 3:9010603-9010625 TCCAGGGCTAGGAGGGCACTGGG - Intronic
950121439 3:10484650-10484672 TGCAGGGCCCCCATGGCCCTGGG + Intronic
950361421 3:12452146-12452168 TGCAGGGCTTGCATGGTGCTGGG - Intergenic
950483492 3:13259182-13259204 CCCAGGGCCTGCATGGCAGAGGG - Intergenic
952035475 3:29195974-29195996 TTAAGGGCTTGCCTGGCACTGGG + Intergenic
953921548 3:46955419-46955441 TCCAAAGCCTGAATGCCACTGGG + Intronic
953933052 3:47016130-47016152 TCTAGGGCCTCTTTGGCACTAGG - Intergenic
954444103 3:50537396-50537418 TCCAGGTGCTGCCTGGCACAGGG - Intergenic
954654647 3:52186479-52186501 TCCAGCACCTCCTTGGCACTGGG + Intergenic
954688160 3:52381846-52381868 TCCAGGGCGTGCTGGGCAGTGGG + Intronic
954731389 3:52665518-52665540 TCCATGGCCTGTTTGGAACTGGG + Intronic
955334444 3:58073414-58073436 TCCAGGCCCTGCACGGAACTTGG - Intronic
956737064 3:72246132-72246154 CACAGGGCCTGCCTGGCACATGG - Intergenic
956774822 3:72556296-72556318 TTCAGGGCCAGCATAGCACCTGG - Intergenic
959156553 3:102673669-102673691 TCTAGTGGCTGCATGACACTCGG - Intergenic
961064153 3:123860308-123860330 TACAAGGCCTGCGTTGCACTGGG + Intronic
961767741 3:129225146-129225168 CCTAGGGCCAGCAGGGCACTGGG + Intergenic
961809004 3:129510699-129510721 TCCAGGACCTACATGGGACTAGG + Intronic
962827505 3:139110727-139110749 TCCAGGGCCTCCTTGTCCCTTGG + Intronic
964430788 3:156604156-156604178 TTAAGGGCCTGCTTGGCACATGG - Intergenic
964824662 3:160811936-160811958 CCCAGGGCTTGCCAGGCACTTGG + Intronic
966869766 3:184282664-184282686 GCCAGGGCCGCCATGGCCCTGGG + Intronic
968041973 3:195596290-195596312 TCCAGGGACAGCGTGGGACTAGG + Intergenic
970630849 4:17942809-17942831 TCCATGGCCTGTAAGGAACTGGG + Intronic
970694621 4:18662826-18662848 TCTAGTGCCTGTATTGCACTTGG + Intergenic
971298763 4:25424811-25424833 TCCAGGGCCTTCCTAGCTCTGGG + Intergenic
971449987 4:26791162-26791184 TCCAAACCCTGCATGGCCCTTGG + Intergenic
975565383 4:75748648-75748670 TTCAAGCCCTGCATGGTACTGGG + Intronic
977358902 4:95980304-95980326 TCCAGGGTCTGCCCTGCACTGGG + Intergenic
977751691 4:100617141-100617163 AACAGCGCCTCCATGGCACTGGG + Intronic
979337572 4:119480981-119481003 TCCAGGGACTGCAAGCAACTAGG + Intergenic
980461804 4:133125133-133125155 TCCAGGCCAGGTATGGCACTAGG + Intergenic
982435755 4:155382581-155382603 TGCAGTGCCTTCATGTCACTAGG - Intergenic
984942952 4:184950366-184950388 TCCAGGGCCTCCATGGAGTTTGG - Intergenic
984945997 4:184969220-184969242 TCAAGGCCCTTCAAGGCACTAGG + Intergenic
985580863 5:694436-694458 TCCAGGGCCTGCTGGACACCTGG - Intergenic
985595488 5:785768-785790 TCCAGGGCCTGCTGGACACCTGG - Intergenic
985964966 5:3332751-3332773 TCCAGGGCCTGTGTGGGACCCGG - Intergenic
987576368 5:19733682-19733704 TCCAGGACTAGCATGGCTCTGGG - Intronic
989196853 5:38724581-38724603 TCCAGGTCTTGCATGGTACAAGG - Intergenic
990202939 5:53398061-53398083 TCCATGCCCAGCATAGCACTGGG + Intergenic
990703635 5:58502331-58502353 TCCAGGGCCTGCTAGGCAGCAGG + Intergenic
995778739 5:115753772-115753794 TCCATGGCCTGTAAGGAACTGGG + Intergenic
996428522 5:123343089-123343111 TCCAGGGGCTGGAAGGAACTAGG - Intergenic
997411762 5:133696244-133696266 TTCAGGGCATGCAGGGGACTGGG + Intergenic
998133856 5:139664483-139664505 ACCAGGCGCTGCATGGCCCTGGG + Intronic
998254376 5:140573574-140573596 CCCAGGGCCTATGTGGCACTGGG + Intronic
999701553 5:154233215-154233237 TCCTGGGCCTGCTTGGCTGTTGG + Intronic
1000193740 5:158938283-158938305 GTCAGGGCCTGGAAGGCACTAGG - Intronic
1002818380 6:699067-699089 TCCAGGGCTAGCATTTCACTTGG - Intergenic
1003103461 6:3195164-3195186 CCCAGGGCCGGCATGACTCTGGG + Intergenic
1006920421 6:37624283-37624305 CCCAGGGCCTGTCTGGCACAGGG - Intergenic
1007243487 6:40443540-40443562 TCCAGGGCCTGGATTACACCTGG - Intronic
1012628268 6:101431030-101431052 TACAGGGACAGCATGGCCCTGGG + Intronic
1013515730 6:110884097-110884119 TCCAGGGCCAGCCTGGCCATTGG + Intronic
1016948836 6:149560953-149560975 TCCAGGGCCAGCAAGGCCCCAGG + Intergenic
1017705337 6:157117558-157117580 CCCAGGGCCTGCATGGCCCTCGG + Intronic
1018477432 6:164157614-164157636 TCCAGGAGCAGCATGGCACAAGG + Intergenic
1019078400 6:169410343-169410365 TCCTGGGCCTGCATGTCCCATGG + Intergenic
1019180778 6:170186340-170186362 TGCAGGGACTGCAGGGGACTTGG + Intergenic
1019335529 7:480876-480898 TTCAGGGCCTGGAGGGGACTGGG - Intergenic
1019447626 7:1079669-1079691 GCCAGGGCCTGCCTGCCACGGGG - Intronic
1019735241 7:2647137-2647159 TCCAGCGCCGGCATCGCAGTGGG + Exonic
1022015551 7:26345846-26345868 TCCAGGCCCTGCATGTCTCTGGG - Intronic
1024189836 7:46994695-46994717 TCCATGGGCTGCATGGCCCTGGG - Intergenic
1025169645 7:56744790-56744812 TCCAGGGCCATCATGGAACCTGG + Intergenic
1025702248 7:63830927-63830949 TCCAGGGCCATCATGGAACCTGG - Intergenic
1031497227 7:122465424-122465446 TCCATGGCCTGTTTGGAACTGGG + Intronic
1034163387 7:149008126-149008148 TCCAGGGCTGGCATGGCAGAGGG + Intronic
1035203546 7:157280759-157280781 TCCAGGTGCTGCAGGGCACAGGG + Intergenic
1035901548 8:3462358-3462380 TCCATGGCCTGCTAGGAACTGGG + Intronic
1036657992 8:10690281-10690303 CCCAGAGCATGCATGGCACAAGG + Intronic
1036659412 8:10698387-10698409 TCCAGAGCCGGCATGCCCCTAGG + Intronic
1045789465 8:105965356-105965378 TCCAGGTACTGAATGCCACTAGG + Intergenic
1045961010 8:107968293-107968315 TCCAGTGCATGGATGGAACTGGG + Intronic
1048005017 8:130412015-130412037 TACAGGGCCTGCGTGGTACCTGG - Intronic
1048360845 8:133696013-133696035 TCCAGGCCCTGCAAGGCACCAGG + Intergenic
1048383354 8:133888278-133888300 TCCATGGCCTGCTAGGAACTGGG - Intergenic
1048800768 8:138191946-138191968 TCCTGGGCTTGCATCACACTGGG + Intronic
1049382358 8:142323652-142323674 CCCAGGACCAGCAGGGCACTTGG + Intronic
1049540913 8:143208361-143208383 TCCAGGGACTGCAGGGCCCCAGG + Intergenic
1051544443 9:18258624-18258646 TCCAGGACCCTCATGGCACCAGG + Intergenic
1056097187 9:83267164-83267186 TCCTCGGCCTGCATGGCCCAGGG + Intronic
1056546039 9:87614810-87614832 CCCAGGGCCTGGAAGGGACTTGG - Intronic
1057328038 9:94084522-94084544 TCCTGCACCTGCATGGCACTGGG - Exonic
1057592446 9:96383841-96383863 TCCAGGGCCGGCAATGCGCTGGG + Intergenic
1060062375 9:120472417-120472439 CCCAGGGCCTGAGTGTCACTTGG + Intronic
1061072018 9:128316705-128316727 GCCAGGGCCTGCATGTGGCTGGG - Intronic
1061219441 9:129241818-129241840 GCCAGGGCCTGCATGGGCCAGGG - Intergenic
1062447940 9:136603539-136603561 TCCAGGGCCTGGCTGGGGCTGGG + Intergenic
1062532437 9:137007823-137007845 TCCAGGCCCTGGCAGGCACTGGG + Exonic
1186077337 X:5895006-5895028 TGCATGGCCTGCATGGCAGAAGG + Intronic
1186213413 X:7273860-7273882 TACAGGTCAGGCATGGCACTAGG + Intronic
1186820790 X:13285582-13285604 TCCAGGACCAGCATGGCTCTGGG - Intergenic
1187213679 X:17254134-17254156 TCCAGGGCCTTCATCCCCCTGGG + Intergenic
1187674693 X:21704116-21704138 TCCAGGACCTGCGGGACACTTGG - Intergenic
1190056571 X:47184749-47184771 ACCACAGCCTGCAAGGCACTTGG - Intronic
1190108189 X:47573704-47573726 TCCAGGGCCTCCCAGGCACCTGG - Intronic
1190603698 X:52118760-52118782 TTCAGTGCCTGCCTAGCACTGGG + Intergenic
1193257672 X:79368391-79368413 TCCAAAGCCTGCATTGTACTTGG - Intergenic
1197437465 X:126449063-126449085 ACAAGGGTCTGCCTGGCACTGGG + Intergenic
1198033520 X:132778813-132778835 TCCAAGGCCTTCTTGACACTTGG + Intronic
1198102949 X:133437583-133437605 TGCAGGGCCTGCCTGGCACCCGG - Intergenic
1199680932 X:150224118-150224140 GGCAGTGCCTGCATGGCACTTGG + Intergenic
1199979095 X:152911288-152911310 TCCAGGGACTCCAAGGCACATGG + Intergenic
1200039076 X:153353078-153353100 TCCAGTGCTTGCTGGGCACTTGG + Intronic
1200226204 X:154419294-154419316 TCCAGGGCCTGCATGGCACTTGG - Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic