ID: 1200231437

View in Genome Browser
Species Human (GRCh38)
Location X:154445737-154445759
Sequence GTGGCCCGGGGCCCGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200231437_1200231453 30 Left 1200231437 X:154445737-154445759 CCCTCACCCGGGCCCCGGGCCAC 0: 1
1: 0
2: 2
3: 24
4: 332
Right 1200231453 X:154445790-154445812 CTTGTGCCTCCTTGCTTCAAAGG 0: 1
1: 0
2: 2
3: 64
4: 1029

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200231437 Original CRISPR GTGGCCCGGGGCCCGGGTGA GGG (reversed) Intronic
900121817 1:1051532-1051554 GTGGCCTGAGGCCCGGGTGCAGG - Exonic
900214683 1:1475179-1475201 GTGGAGCGGGGCCCGGGGCAGGG + Intronic
900221892 1:1513528-1513550 GTGGAGCGGGGCCCGGGGCAGGG + Intronic
900245064 1:1632817-1632839 TGGGCCCGGGACCCGGGTGGGGG - Exonic
900256295 1:1699976-1699998 TGGGCCCGGGACCCGGGTGGGGG - Intronic
900291249 1:1924443-1924465 CTGGCCCCGGCCCCGGGTGCTGG + Exonic
900302986 1:1987147-1987169 GAGACCCCTGGCCCGGGTGAGGG - Intronic
900344902 1:2205871-2205893 GTGGGCCGGGGCCCGGGTAGGGG - Intronic
900349681 1:2228536-2228558 GTGGCGCCGGGCCCGGGCGGCGG + Intergenic
900423699 1:2566696-2566718 GTGTCCCTGGGCCCAGGTCATGG - Intergenic
900535457 1:3174839-3174861 GTGGGCCAGGTCCCGGGTGCAGG + Intronic
900585604 1:3431020-3431042 GCGGCCTGGGGCTCGGGTGCGGG - Exonic
900991527 1:6100408-6100430 ATGGCCCTGGGCCCAGGTGGGGG + Exonic
901242406 1:7703298-7703320 GTGACCCGGGGGGCGGGCGAGGG + Intronic
901922963 1:12549115-12549137 GAGGCCTGGGGCCCGGGCGCCGG + Intergenic
902379982 1:16048305-16048327 TGGGCCCAGGGCCCAGGTGAGGG - Intronic
903790497 1:25889769-25889791 GTAGCCTGGGGCCAGGGCGAGGG - Intronic
903809714 1:26028591-26028613 GTGGCCCTGGGCTAGGGTGGTGG + Intronic
903986963 1:27235138-27235160 GTGGTCCGGGGGCGGGGTGGGGG + Intronic
904001166 1:27339580-27339602 GAGGCCAGGGGCCAGGATGATGG + Intergenic
905091351 1:35433615-35433637 GTGGAACAGGGCCAGGGTGAGGG + Exonic
906288394 1:44603362-44603384 GTAGCCCGGGGCCAAGGTGGGGG - Intronic
906317842 1:44799857-44799879 CTGGGCCGGGCCCCGGGCGAGGG + Intergenic
906805547 1:48776526-48776548 GGGGCCGGGGGCCCGGGCGGAGG - Intronic
909873166 1:80769591-80769613 GAGGCCCGGGGTCCTGGTGGAGG - Intergenic
911047784 1:93642810-93642832 GTTGCCCAGTGCCTGGGTGATGG + Intronic
915082932 1:153364490-153364512 GTGGTCTGGGGCCTGGGTGGTGG + Intergenic
915325590 1:155079975-155079997 GTGGCGCGGTGGCCGGGTGCTGG + Intronic
916147093 1:161749808-161749830 GAGGCTCCGGGCCCGAGTGATGG + Exonic
916651675 1:166839641-166839663 GCCGCCCGGGACCCGGGGGAGGG - Intronic
920205882 1:204291761-204291783 GTTGCCTGGGGCCAGGGTGGAGG + Intronic
920665945 1:207963244-207963266 GAGGCCCGGAGCCTGGGAGAGGG - Intergenic
922549683 1:226484819-226484841 GGGGCCTGGGCCCCTGGTGATGG + Intergenic
922580042 1:226690281-226690303 GTTGCCCGGTGCCTGGCTGATGG - Intronic
922850594 1:228730364-228730386 GGGGCCCAGGGGCTGGGTGAGGG + Intergenic
922983942 1:229851449-229851471 GTGGAGCGGTGCCCTGGTGAAGG - Intergenic
1062874349 10:932312-932334 GGGGCCTGGGTCCCGGGTGTGGG - Intergenic
1062920250 10:1273874-1273896 CTGGCTCTGGGACCGGGTGACGG + Intronic
1062971380 10:1651806-1651828 GGGGCCCTGGGCCTGTGTGATGG - Intronic
1064237129 10:13586891-13586913 GTGGCCCGGGGCGCCTGTGGTGG - Intergenic
1065189979 10:23199531-23199553 GTGGCCCGGGGCGCAGGTTGTGG + Intergenic
1065488131 10:26254489-26254511 CTGGTCCGTGGCCCGGGTAATGG + Intronic
1065878586 10:30019600-30019622 GTTGCCAGGGGCTGGGGTGAAGG + Intronic
1066047120 10:31603710-31603732 GTGGGCGGGGCCCCGGGCGACGG - Intergenic
1067032313 10:42886035-42886057 TGGGCCAGGGGCCCGTGTGAGGG + Intergenic
1067040558 10:42951243-42951265 CTGTCCCGAGGCCCAGGTGAAGG + Intergenic
1069657821 10:70103150-70103172 GTGGCCCTGGGCTTGGGTGAGGG - Intronic
1069687138 10:70325490-70325512 GTGGCCCTGGGTGAGGGTGAGGG - Intronic
1069996000 10:72342516-72342538 GTGTCCCGGGGCCCTGGAGGAGG - Intronic
1072738755 10:97896902-97896924 GAGGGCCGGGGCACAGGTGAGGG - Exonic
1073208567 10:101781226-101781248 GTGGCCCTGGGCCTGGGGGAGGG - Intergenic
1073454108 10:103626297-103626319 GTGGCCCGAGCACCGGGTGGTGG + Intronic
1075335905 10:121608847-121608869 GCCGCCCGGGGCGTGGGTGACGG + Intergenic
1075650787 10:124127498-124127520 AAGGCCCGGGGCCCAGGAGAAGG - Intergenic
1075658260 10:124175773-124175795 GTGGCCTGGGGCCGGGGGAAGGG - Intergenic
1075833845 10:125436220-125436242 GTGGCCAGGGGCCAGGGTTAGGG + Intergenic
1075856815 10:125636932-125636954 GTGACCTGGGGCCTGGGGGAGGG - Intronic
1076401724 10:130189632-130189654 GTGCCCCAGGGCCCCGGGGAAGG - Intergenic
1076614957 10:131749126-131749148 TTGGCCCTCGGCTCGGGTGAAGG - Intergenic
1077254017 11:1572582-1572604 GCGGCCGGGGGCCCGGGTGACGG - Intergenic
1077610702 11:3641879-3641901 AGGGCCAGGGGTCCGGGTGAGGG + Exonic
1077891135 11:6418994-6419016 GAGGCCCCGGGCCCAGATGACGG + Exonic
1078660096 11:13278713-13278735 GTCGCCCGGAGCCCGGGTGCGGG + Intronic
1079333490 11:19552094-19552116 GTGGCCTGGGCCCCTGGAGAAGG + Intronic
1079456711 11:20642768-20642790 GTGGGCCAGGGCCTGGGTGCTGG + Intronic
1080272095 11:30461195-30461217 GTTGCTAGGGGCTCGGGTGAAGG + Intronic
1083454760 11:62771379-62771401 GGGGCCGGGGCCCCGGGAGAGGG + Exonic
1083624489 11:64065154-64065176 GTGGCCCAGGGAACGGGTGCAGG + Intronic
1083667856 11:64285309-64285331 GAGGGCCGGGGACCCGGTGAGGG + Intronic
1083766678 11:64844731-64844753 GGGGCGCGGCGCCCAGGTGAGGG - Intergenic
1083880557 11:65546412-65546434 GAGGCCCGGGGCGGGGGTGCTGG + Intronic
1084898949 11:72295396-72295418 GGGGCCCTGGGCCCAGGTGAAGG - Intronic
1088663895 11:112074731-112074753 GTGGCCTGGGCCACAGGTGAGGG + Exonic
1090326871 11:125895401-125895423 GTGGGCCAGAGCCCAGGTGAGGG - Exonic
1091750175 12:3017489-3017511 GCGGCCGGGGCCCCGGGCGAGGG - Exonic
1092013749 12:5139216-5139238 GAGGCCCAGGGCCTTGGTGAGGG + Intergenic
1092399695 12:8164244-8164266 GTTGCCAGGGGCCCTGGTGCTGG - Intronic
1094607298 12:31959646-31959668 GGGGCCCGAGGCCCGGGTTCCGG - Intronic
1096782179 12:53997833-53997855 CTGGCCCCGGGCCCCGCTGAGGG + Intronic
1098253977 12:68597912-68597934 GTGGTCAGGGGCTGGGGTGAGGG - Intergenic
1101426115 12:104590103-104590125 GAGGCCAGGGGCCTGGGTGTAGG - Intronic
1103474691 12:121210007-121210029 GGGGCCCGGGGCCCGGGGGAGGG - Intronic
1103800477 12:123534105-123534127 GGCGGCCGGGGCACGGGTGAGGG - Intergenic
1103845648 12:123900454-123900476 GTGGCCTGGGCACCGGGGGAGGG - Intronic
1106735790 13:32586777-32586799 GTGGCCCGGGGCGGGGGTCGCGG + Intronic
1107598863 13:41992136-41992158 GTGACCAGGGGCTGGGGTGAAGG - Intergenic
1113082525 13:106534404-106534426 GTGGTCCGGGGCCCGCGGGCGGG - Intronic
1113766421 13:112883426-112883448 GTGGCGCGGGGCGGGCGTGAGGG - Exonic
1115754990 14:36520637-36520659 GTGGCTCTGGGCTCGGGTGCTGG - Intronic
1117542546 14:56762266-56762288 GTGGGCCGGGGCCCAGCTGCAGG + Intergenic
1119438174 14:74611529-74611551 GCGGCCCGGGTCCGGGGTGCTGG + Exonic
1119921896 14:78454446-78454468 GTGGACTGGGGCCCTGATGATGG - Intronic
1121051182 14:90819912-90819934 GTGGCCCGGGCCATGGATGAGGG - Intergenic
1121489089 14:94345042-94345064 GTGGCCAGGGGCTGGGGAGAGGG + Intergenic
1122143094 14:99674028-99674050 GGGGCCAGGGGCCAGGGTGCAGG + Intronic
1122408047 14:101512089-101512111 GTGGACCTGGGCCGGGGTGGGGG - Intergenic
1122551203 14:102550950-102550972 GTGGGCCTGGGCACTGGTGATGG + Intergenic
1122603505 14:102932781-102932803 GTGGGCCGGGGCCAGTGTGCAGG + Exonic
1123017136 14:105380866-105380888 GTGGCCTCTGGCTCGGGTGAGGG - Intronic
1123042629 14:105496586-105496608 GTGACCCTGGGCCCGGGGCAAGG - Intronic
1124249296 15:28096771-28096793 GAGGGGCGGGGCCCGGGAGAGGG + Intronic
1124603329 15:31152154-31152176 GGGGCCCAGGGCCTGAGTGATGG - Intronic
1125509058 15:40283095-40283117 GTGGCCCGGCCCCCGCGAGAGGG - Intronic
1125728513 15:41880323-41880345 GTGGCCCAAGGCTGGGGTGAGGG + Intronic
1125731443 15:41894626-41894648 GTGGCCCGGGGCTCGGAGGCAGG + Intergenic
1128145250 15:65329299-65329321 GAGGCCCGTGGCCAAGGTGAAGG + Intronic
1129192887 15:73947682-73947704 GTTGCCCTGGGCCAGGGTCAGGG + Intronic
1130998371 15:88918268-88918290 GTTGCCAGGGGCTGGGGTGAGGG + Intergenic
1131049033 15:89334452-89334474 GTGGGCCGTGGTCCGGGTGTGGG - Intronic
1131117332 15:89803365-89803387 GTGGGCAGAGGCCCGGGTCAAGG + Intronic
1132552692 16:559999-560021 GCGGCGCGGGGCGCGGGAGAGGG - Intergenic
1133024210 16:2980612-2980634 CTGGCCCGGGGCGTGGGTGGCGG + Intergenic
1133212702 16:4272228-4272250 GGGGCCCGGGGCGCGCGTGGGGG - Intronic
1133267690 16:4594674-4594696 ATGGCCCAGGTCCCGGGTTAGGG - Intronic
1133286366 16:4692671-4692693 GTGGCCCTGGGCCCTGCTGCTGG + Intergenic
1133620382 16:7520431-7520453 GTTGCCAGGGGCCGGGGAGAGGG - Intronic
1134232190 16:12437853-12437875 GTGGCCCTGGGCTGGGGGGAAGG - Intronic
1134551587 16:15141254-15141276 GGGGCCCGGGGCCAGGGCAAGGG + Intergenic
1135691399 16:24540161-24540183 GTGACCCAGGCCCCGGGAGAAGG - Intronic
1136226418 16:28863528-28863550 GAGTCCCAGGGCCCGGCTGAGGG - Intronic
1136382369 16:29901483-29901505 GTGGCCCAGGCCCTGGGAGAGGG + Exonic
1136428676 16:30184990-30185012 GTGGCCTGGGGCCAGGGAGAAGG + Intronic
1136707051 16:32200131-32200153 GGGGCCAGGGGCCGGGGGGAGGG + Intergenic
1136760859 16:32729286-32729308 GGGGCCAGGGGCCGGGGGGAGGG - Intergenic
1136807244 16:33141100-33141122 GGGGCCAGGGGCCGGGGGGAGGG + Intergenic
1137654996 16:50152610-50152632 GTGGCCTCAGGCCGGGGTGAGGG + Intergenic
1139649525 16:68355368-68355390 GTGGCCCGGGGCCCACCTGTCGG + Intronic
1140357912 16:74321659-74321681 GTGGCACATGGCCCAGGTGATGG - Intergenic
1140475714 16:75238442-75238464 GGGGCACTGGGCCCGGGGGAGGG - Intronic
1141639965 16:85335311-85335333 GCAGCCCCGGGCCCGGGTGGAGG + Intergenic
1141754834 16:85984023-85984045 GTGGCCCCGAGCCCGGGTCCTGG + Intergenic
1142429540 16:90018984-90019006 GTGACCCGGGGAGCGGGGGAGGG - Intronic
1203063011 16_KI270728v1_random:989600-989622 GGGGCCAGGGGCCGGGGGGAGGG - Intergenic
1143390389 17:6556340-6556362 CAGGGCCGGGGCCCGGGGGAGGG - Intronic
1144705048 17:17362705-17362727 GTGGCGCAGGGCCTGGGGGAGGG - Intergenic
1144771371 17:17761495-17761517 GTGGCCAGTGCCCCGGGGGATGG + Intronic
1145166998 17:20621579-20621601 GTGGCCCTGGGCTCGGGGGATGG - Intergenic
1146022820 17:29293530-29293552 CTGGCCCCGGCCCCGGCTGAAGG - Intronic
1146445481 17:32929393-32929415 GAGGCCTGGGGACCGGGGGAGGG + Intronic
1147325428 17:39667547-39667569 GCGGCGCCGGACCCGGGTGAGGG - Intergenic
1147353229 17:39868416-39868438 GAGGCCTGGGGACCGGGTGGAGG - Intronic
1147668840 17:42165246-42165268 ACGGCCAGGGGCCTGGGTGATGG + Intronic
1147843541 17:43389275-43389297 TTGGCCCGGGGCAGGCGTGAAGG + Intergenic
1147946420 17:44082788-44082810 GTGTCCTGGGGGCCGGATGATGG + Exonic
1148636932 17:49156173-49156195 GTTGCCAGGGGCCAGGGAGAGGG - Intronic
1151559518 17:74862875-74862897 GTGGCCCGGGGCCAGGGCACGGG - Exonic
1151665121 17:75541306-75541328 TTGGCCTGGGCCCCGGGTGGGGG + Intronic
1152103694 17:78316808-78316830 GTGGCCCTGTGCCTGGGTCATGG + Intergenic
1152183565 17:78840456-78840478 CCGGCCCGGAGCCCGGGGGACGG + Exonic
1152358014 17:79815860-79815882 GTGGCGCGGGGCCCGGCCGAGGG + Intergenic
1152456767 17:80421447-80421469 GTGGACCGGGTCCGGGGTGGGGG + Intronic
1152469944 17:80485513-80485535 GTGGCCCAGAGCCGGGGTGAGGG - Intergenic
1152486461 17:80597416-80597438 GTAGCCTGGGGACCAGGTGAAGG + Intronic
1152645479 17:81466703-81466725 GCGGCCCACGGCCCGGGTGTGGG + Intergenic
1153382261 18:4454055-4454077 GTGGCCCGTGGCTCGGCTGCCGG - Intronic
1153489203 18:5630297-5630319 GTGGGCAGGGGCGCGGGTGCGGG - Intronic
1155849950 18:30761643-30761665 ATGGCCCAGGGCACAGGTGATGG - Intergenic
1157441040 18:47711863-47711885 GTGGCCTGGGGACCTGGGGAAGG - Intergenic
1160514574 18:79471308-79471330 GTGGCCTGGGGCTTGTGTGAGGG + Intronic
1160577445 18:79864435-79864457 GTGGGCCGGGGCCGGGCTGGAGG + Intronic
1161022157 19:2015584-2015606 GTTGCCGGGGGCCGGGGTGGCGG + Exonic
1161408082 19:4101575-4101597 GTGGCCCATGGCCCGGGAGTAGG + Intronic
1161638676 19:5405845-5405867 GTGGCTGGGGGCCAGGCTGAAGG + Intergenic
1161857379 19:6773460-6773482 GGGGCCCAGGGCCCGGGAGGAGG - Intronic
1162925921 19:13930515-13930537 GGGGCTGGGGGCCCGGATGAGGG - Exonic
1163000398 19:14363378-14363400 GGGGCCCGGGGGCGGGGTGAGGG - Intergenic
1163720400 19:18895795-18895817 GTGGCCGGGGGCCGGGACGAGGG - Intronic
1163776224 19:19219336-19219358 GGGGCCGGGGGCCGGGGAGAGGG + Intronic
1163843868 19:19628037-19628059 GCGGGCCTGGGCCCGGGGGAAGG - Intronic
1165922348 19:39307244-39307266 GTCACCCGGGGCCGGGGCGAGGG - Exonic
1165922350 19:39307246-39307268 CTCGCCCCGGCCCCGGGTGACGG + Exonic
1165940469 19:39412685-39412707 GTGTCACGGGGCTCGTGTGACGG - Exonic
1167240657 19:48341279-48341301 GTGGCCCAGGGGCCAGGTGGAGG - Intronic
1167310590 19:48735454-48735476 CTGGCCCGGGGACCGGATCAGGG - Exonic
1167367291 19:49061530-49061552 GTGGCCCGGGGGCAGGTGGAGGG - Exonic
1168100390 19:54138235-54138257 GGGGCCCGGGGTCCGGGTCGCGG - Intronic
1168275569 19:55276266-55276288 GTTGCCAGGGGACCGGGGGAGGG + Intronic
925055246 2:852228-852250 GTGGCGGGAGGCCCAGGTGAGGG + Intergenic
925100834 2:1244019-1244041 CTGGCCTGGGGCCAGGGTGGTGG + Intronic
926326174 2:11786359-11786381 GTGGCTCTGGGCCAGGGAGATGG + Intronic
926635139 2:15170439-15170461 GTGGGCCGGGGCCAAGGGGAAGG - Intronic
927806874 2:26155813-26155835 GTGGCCAGGGGCTGGGGGGAAGG + Intergenic
930136350 2:47906523-47906545 CTGGCCGGGGGCGCGGGGGAGGG + Intergenic
931252858 2:60549620-60549642 GGGGCCCGGGGGCCCGGAGACGG + Intronic
931639547 2:64369834-64369856 GTGGCCTGGGGCCTGTGGGAGGG + Intergenic
932563707 2:72892770-72892792 ATGGCCAGGGGCCAGGGTGCTGG - Intergenic
932761300 2:74440626-74440648 GAGGCCCGGGACCAGGGGGAGGG - Intronic
934515597 2:94984521-94984543 GTTGCCAGGGGCTCGGGGGAGGG + Intergenic
936063368 2:109312537-109312559 GTGGCCTGGGGCCAGGAAGAAGG - Intronic
936080435 2:109429216-109429238 GTGGGCCTTGGCCCGGGTGGGGG - Intronic
936531149 2:113277865-113277887 GTGGTCCCGGGCCCGGGAGCCGG - Intronic
937273551 2:120670416-120670438 GTGCCCCGTGGCCCGGGACATGG - Intergenic
937299339 2:120829698-120829720 GTGGGCCCGGGCCTGGGAGAAGG + Intronic
937914253 2:127091257-127091279 ATGCCCCGGGGCTGGGGTGAGGG - Intronic
940009462 2:149038747-149038769 CTGGGCCGGGAGCCGGGTGAGGG + Exonic
940640744 2:156342359-156342381 GGGGGCCGGGGGCCGGGGGAGGG - Intergenic
941808705 2:169734406-169734428 GTGGGCCGGGGCCCAGGCGCGGG + Intronic
942674377 2:178412210-178412232 TTGGCATGGGGCCCAGGTGATGG + Intergenic
946176156 2:217922988-217923010 GTGGCCAGGGGCCAGGGTGCCGG - Intronic
946391469 2:219419129-219419151 GGGTCCCGGGCCCCGGGAGAAGG - Intronic
946405109 2:219488351-219488373 GTGGCCCTGAGCCCAGGGGATGG + Intronic
946908967 2:224442314-224442336 CCGGCCCGGGGTCCGGGCGATGG - Intergenic
947617733 2:231569131-231569153 GGGGACCAGGGCCCTGGTGAGGG + Intergenic
947971854 2:234331510-234331532 GGGGCCCTGGGCTTGGGTGAAGG - Intergenic
948401819 2:237691044-237691066 GAAGCCCTGGGCCCGGGTCACGG + Intronic
948953891 2:241272608-241272630 GCAGCCTGGGGCCCGGGTGGGGG + Intronic
1168795899 20:610070-610092 GCGGCCCGGGCCCCGGGGGCGGG - Exonic
1170156622 20:13274676-13274698 GAGGCCCGGGGGCCGGGCGCGGG - Intronic
1172438922 20:34951764-34951786 GTGGACCGGGCCCTGGCTGAGGG - Exonic
1172441447 20:34969222-34969244 GTGGTGAGGGGCCTGGGTGAGGG - Intergenic
1173642640 20:44614749-44614771 CTAGCCCGGGGCCCGGCAGAGGG - Intronic
1174456461 20:50652166-50652188 GTGGCCCTGGGCCCAGGAAAAGG + Intronic
1174541741 20:51295199-51295221 GTGGCCAGAGGCTGGGGTGAGGG + Intergenic
1175530206 20:59669634-59669656 GTGGCCAGGGGCCGGGGGAAAGG - Intronic
1176081010 20:63273017-63273039 GTGGAGCGGGGTCCGGGTGGAGG - Intronic
1176135345 20:63520042-63520064 GGGCCCTGGGGCCCGGGGGACGG - Intergenic
1176135484 20:63520471-63520493 GGGGGCCTGGGCCCGGGAGAGGG + Intergenic
1176205355 20:63885231-63885253 GTGCCCTGGGGCATGGGTGATGG + Intronic
1176246858 20:64101716-64101738 GTGCCCTTGGGCCCGGGAGATGG + Intergenic
1178397944 21:32259219-32259241 GTGGCCAGGGGCTCGAGGGAAGG + Intergenic
1178521630 21:33292154-33292176 GTGGTCAGGGGCCCTGGGGAAGG - Intronic
1178951491 21:36989792-36989814 GCGGCCAGGGGCCCGTGGGAGGG + Intronic
1179530936 21:42019223-42019245 GTGCACCTGGCCCCGGGTGAGGG + Intergenic
1179562117 21:42222087-42222109 GTGGCCCGGTGCGGGGGTGGGGG + Intronic
1179889399 21:44328005-44328027 GTGGCCTAGGGACCTGGTGAAGG + Intergenic
1180042500 21:45287587-45287609 GTGGTCCGGGGCCAGGGAGATGG - Intronic
1180056350 21:45361145-45361167 GTGTCCCTGGGGCAGGGTGAGGG + Intergenic
1181032444 22:20155021-20155043 GTGCCCAGGGGCGAGGGTGACGG - Intergenic
1181636701 22:24177934-24177956 GGGGCCTGGGGCAGGGGTGAGGG + Intronic
1181636716 22:24177964-24177986 GGGGCCTGGGGCAGGGGTGAAGG + Intronic
1182237070 22:28884075-28884097 GCGGCGCGGGGCCCGGGCGGCGG - Intronic
1183184477 22:36284282-36284304 GTGGCCCGTGGCCCCGGTTAGGG + Intronic
1183392408 22:37552913-37552935 GTAGCCTGGGTGCCGGGTGATGG - Intergenic
1183433583 22:37780703-37780725 GTGGCCCAGGGCCGGGATTAGGG + Intergenic
1183649724 22:39146938-39146960 GGGGCTCGGGGCCCGGGACAGGG - Intronic
1183665698 22:39244577-39244599 CTGGCGCGGGGCCCGGGCGGCGG + Exonic
1184151760 22:42643643-42643665 GTGGCCCTGGGCATGGGTGAGGG - Intronic
1184193038 22:42907789-42907811 TTAGCCCAGGGCCCGGGTCATGG + Intronic
1184556701 22:45237069-45237091 GAGGCCCAGGGCCCAGGAGAAGG + Intronic
1184860306 22:47169698-47169720 GTGCCCCAGGGACCGGGGGAGGG + Intronic
1185149803 22:49157756-49157778 GTGGCCCTGGGCACGGAGGAGGG + Intergenic
1185274147 22:49943179-49943201 GTAGGCTGGGGCCCGGGGGAAGG + Intergenic
1185316166 22:50180131-50180153 GCGGCGGGGGGCCCGGGTGGGGG - Exonic
1185349623 22:50327600-50327622 GGGGCCCGGGGCCCTCGCGAGGG - Intergenic
949559231 3:5187484-5187506 TTGGGGCGGGGCCCGGGTGAGGG + Intergenic
950262969 3:11555286-11555308 GGGGCCCTGGGCATGGGTGAGGG + Exonic
950550125 3:13661303-13661325 GAGCCCCGGGGCCGGGGTGGTGG + Intergenic
951576453 3:24119659-24119681 GTCGCCCGGGGCACAGGTGAGGG + Exonic
952970609 3:38648504-38648526 ATGGCCCGGGGCTGGGCTGAAGG + Intronic
953742221 3:45547694-45547716 GTGGCCTGGTGCTGGGGTGAAGG + Exonic
953983630 3:47425643-47425665 GTGGGCCGGGGGCTGGGGGAGGG - Intronic
954137519 3:48588869-48588891 CTGGCCTGGGGCCGGAGTGAAGG - Exonic
954229831 3:49208246-49208268 CTGGTCCGGGGCCTGGGTGTTGG - Intronic
955408230 3:58639437-58639459 GTGGCCTGGGGCCAGGTTTATGG - Intronic
955523349 3:59796263-59796285 GTGGCCCAGAGCCAGGGTAAGGG - Intronic
961081668 3:124033440-124033462 GGGGCCCGGGGCCGGGGTGCGGG - Intergenic
961389156 3:126542193-126542215 GTGGCCGCGGGCCCGGGCGTCGG - Exonic
962222397 3:133574301-133574323 GCGGCCCGGGCCCCGAGTGCCGG - Intronic
966390842 3:179451228-179451250 GCGGAACGGGGCCCGGGTGACGG - Intronic
967037872 3:185661688-185661710 TTGACCCGGGTCCCGGGTGCTGG + Intronic
967087297 3:186107666-186107688 GGCGCCCGGGGCGCGGGTGGTGG - Intronic
968073260 3:195801430-195801452 GAGCCCCGGGGCCCCGGGGAGGG - Intronic
968452446 4:681761-681783 GGGGCCCGGGTGCGGGGTGAGGG - Intronic
968551645 4:1226428-1226450 GGGTCCCGGGGGCCGGGAGAGGG + Intronic
968569424 4:1331685-1331707 GTGCACAGGGGCCCGTGTGAGGG + Intronic
968654541 4:1772843-1772865 GTGGGCCAGGGCCCAGGGGAGGG - Intergenic
968934201 4:3601482-3601504 GAGGCCCTGGGCCCGGCTGCTGG + Intergenic
969597679 4:8158323-8158345 GGGGCCTGGGGTCCGGGCGAAGG - Intronic
970428107 4:15963804-15963826 GTGGCCTGTGGCCACGGTGATGG - Intronic
981527725 4:145723096-145723118 GTGGGCAGGGGCAGGGGTGATGG - Intronic
983077427 4:163343676-163343698 GGGACCCGAGGCCAGGGTGAAGG + Intronic
984758205 4:183342978-183343000 GGAGCCCAGGGCCTGGGTGAGGG - Intergenic
985641801 5:1066918-1066940 GTGGCCCGGGGCTGCTGTGATGG - Intronic
985894979 5:2743513-2743535 GCGGCCCGGCGCCCGCGTGGTGG - Intergenic
988197282 5:28020586-28020608 GTGGCAGGGTGCCAGGGTGAAGG + Intergenic
989475636 5:41870140-41870162 GTGGCGCGGTGCCCTGGTCACGG - Intronic
990981731 5:61607547-61607569 GTGGCACCGGGCCAGCGTGAAGG + Intergenic
991371565 5:65925582-65925604 GCGGGCCGGGGGCCGGGGGAGGG - Intergenic
993116111 5:83722079-83722101 GGGGCCCGCGGCCAGGGTGGAGG + Intergenic
994366997 5:98928426-98928448 GCGGCCCAGCGGCCGGGTGAAGG - Intronic
995402399 5:111757627-111757649 GGCGCCCGGGGCGCGGGTGCGGG - Intronic
996899402 5:128526711-128526733 GTTGCCCGGGGCAGGGGAGAGGG + Intronic
997496480 5:134331446-134331468 GTGGGTGGGGGCCCGGGGGAGGG - Intronic
998957550 5:147453411-147453433 GAGACCCGGGGTCCGGGTGGCGG - Intronic
999981671 5:156963668-156963690 GAGGCCAGGGGACAGGGTGAGGG - Intergenic
1001155774 5:169271491-169271513 GTGGCCTGGGGCCACGGTGCTGG + Intronic
1001450509 5:171820894-171820916 GTGGGCCGGGGCCAGGAGGAGGG - Intergenic
1002316959 5:178349746-178349768 GGAGCCTGGGGCCCAGGTGAGGG - Intronic
1003290834 6:4776815-4776837 GCGGCCCGAGGCCGGGGGGAGGG - Intronic
1003456829 6:6291242-6291264 GAGGACAGGGGCACGGGTGAGGG - Intronic
1004311953 6:14553806-14553828 GTGGCCCGTGGCCCAGGGGTTGG + Intergenic
1004395692 6:15245244-15245266 GGGGGCCGGGGCCCGGGGGGCGG + Intergenic
1004455721 6:15789804-15789826 TTGGACTGGGGCCCAGGTGATGG - Intergenic
1006374823 6:33666006-33666028 GGGGCCGGGTGCCCGGGAGAGGG + Intronic
1006517636 6:34553636-34553658 GGGGCCCTGGGCACAGGTGAGGG + Intronic
1007257360 6:40538333-40538355 GTGGCAGGGGGCCCTGGAGAAGG - Intronic
1011258666 6:85450020-85450042 GAGGGGCGGGGCCCGGGTCAAGG - Intronic
1011734288 6:90296450-90296472 GGGGCCCGGGGCCCGGGGCCCGG + Intronic
1012400065 6:98835353-98835375 ATGCCCCGGGTCCCGGGTGGTGG - Exonic
1012550520 6:100461067-100461089 GGGGTCCGGGGCTCGGGGGAAGG + Intronic
1013576042 6:111483817-111483839 GTGGCCCGGGGGCGGTGCGAAGG + Intergenic
1014778067 6:125533535-125533557 GTGGCCTGGGGCAGGGGTGGTGG - Intergenic
1014802275 6:125790730-125790752 GGGGTCCCGGGCCCGGCTGAAGG - Intronic
1015965402 6:138692449-138692471 GTGGCCGGCGGGCCGGGGGAGGG - Intronic
1017132029 6:151115625-151115647 GAGGCCAGGGGCCCGGCTGAGGG - Intergenic
1019540677 7:1549786-1549808 GTCCCCCGGGGCCCGGGAGTGGG - Intronic
1019566095 7:1679746-1679768 GTGGCCAGGGGGCAGGGGGAAGG - Intergenic
1019612705 7:1945012-1945034 GTGGCCGACGGCCCAGGTGAGGG - Intronic
1019706616 7:2500003-2500025 GTGGCCAGGGGGCCAGGTGCTGG - Intergenic
1019786117 7:2978611-2978633 GTGGCGCGGGCACCGGGTGCAGG + Intronic
1020162162 7:5781193-5781215 GCGGCCTCGGGCCCGGGGGAGGG + Intronic
1022410439 7:30135409-30135431 GGGGCGCGGGGCGCGGGTTACGG - Intronic
1023700620 7:42888695-42888717 GTGACCTGGGGCCTGGGTGGTGG + Intergenic
1023779695 7:43644171-43644193 GTGGCTCGAGGCCTGGGAGATGG - Intronic
1025208231 7:57005587-57005609 GTGGCCAGGAGCCCGGGGCATGG - Intergenic
1025663723 7:63571291-63571313 GTGGCCAGGAGCCCGGGGCATGG + Intergenic
1026776348 7:73233410-73233432 CTGGCCCCGGGCCCGGCTGCAGG - Intergenic
1027017200 7:74786779-74786801 CTGGCCCCGGGCCCGGCTGCAGG - Intronic
1027070823 7:75159153-75159175 CTGGCCCCGGGCCCGGCTGCAGG + Intergenic
1031447673 7:121873792-121873814 GTGCCCCGGGCCCCAGGAGACGG + Intronic
1034422384 7:150996470-150996492 GGGGCCGGGGGGCCGGGGGAGGG - Exonic
1034980187 7:155470912-155470934 GTGGCCAGGAGCTGGGGTGAAGG + Intergenic
1035246612 7:157566506-157566528 GTGGCCTGGGACCCGGGTCAGGG + Intronic
1036343700 8:7940598-7940620 GTTGCCAGGGGCCCTGGTGCTGG - Intronic
1036664555 8:10730320-10730342 GTCCCCCGGGGGCCGGGGGACGG + Intronic
1036871409 8:12436915-12436937 GGGGCCCAGGGCCCGGGAGGCGG + Intergenic
1039158714 8:34592934-34592956 GTTGCCAGGGGCCGGGGTGGGGG + Intergenic
1039473986 8:37829773-37829795 GTGGCCTGGGGCCCCAGGGAGGG - Intronic
1047259237 8:123241185-123241207 GAGGCCTGGGGCCCGGGATAAGG + Intronic
1049229790 8:141475987-141476009 GTGGCCCGTGGCTCGGGAGCGGG - Intergenic
1049418382 8:142505805-142505827 GTAGCCAGGGGCACGGGTGGTGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1052362170 9:27573236-27573258 GAAGCCCGGGGCCCGGATGCAGG + Intronic
1055477869 9:76681270-76681292 GTTGCCAGGGGCCGGGGAGATGG + Intronic
1057186160 9:93058654-93058676 CTGGGCCTGGGCCTGGGTGAGGG - Intergenic
1057555431 9:96083898-96083920 GTGGGCGGGGGCCCAGGAGAGGG + Intergenic
1057757295 9:97848521-97848543 GTGGCCCGGGGCGAAGGTGGCGG - Intergenic
1061248620 9:129414017-129414039 GTGGTTCGGGGGCCGGGGGAAGG + Intergenic
1061559528 9:131393921-131393943 TCGGCCCGGGGGCCGGGCGAGGG - Intergenic
1061848197 9:133399994-133400016 GTGGGCTGGGGACTGGGTGAGGG - Intronic
1062065472 9:134524190-134524212 GTGGACCGGATCCCAGGTGATGG - Intergenic
1062090982 9:134678768-134678790 GTGGGCCGGGCCCTGGGTGAAGG + Intronic
1062278585 9:135742066-135742088 GTTGCCTGGGGCCAGGCTGAAGG + Intronic
1062341207 9:136094744-136094766 CTGGCCCGGGGCCAGGGCGGAGG - Intronic
1062554404 9:137107448-137107470 GTGGGCCTGGGCCTGGGTCAGGG + Intronic
1062577305 9:137214724-137214746 GGGGCCCAGGGCACGGGAGAGGG - Intronic
1062641240 9:137519669-137519691 GTGACCTGGGGCACGTGTGAGGG + Intronic
1185445961 X:258174-258196 CTGGCCAGGGGCCAGGGTTAGGG - Intergenic
1186356933 X:8799911-8799933 GTTGCCTGGGGCCTGGGTCAGGG - Intronic
1186357256 X:8801026-8801048 GTTGCCTGGGGCCTGGGTCAGGG - Intronic
1186378589 X:9033720-9033742 GTCGCCTGGGGCCTGGGTCAGGG - Intronic
1186430625 X:9501397-9501419 GTGGCACGGGGCTGTGGTGAGGG + Intronic
1186795640 X:13044406-13044428 GTCGCCTGGGGCCTGGGTCAGGG - Intronic
1190430797 X:50376215-50376237 CTGGCCTGGGGCACTGGTGAGGG + Intronic
1190709998 X:53060675-53060697 GGGGCGCGGGGCAGGGGTGAAGG - Intronic
1190844910 X:54182841-54182863 GCTGCCCGGGGCCCGGGTGCTGG - Exonic
1192603029 X:72485056-72485078 GTGGCCCGGGGATGGGGTGGTGG + Intronic
1198158629 X:133985787-133985809 GCGGCGCGGGGACCGGGCGAAGG + Intronic
1200231437 X:154445737-154445759 GTGGCCCGGGGCCCGGGTGAGGG - Intronic