ID: 1200232023

View in Genome Browser
Species Human (GRCh38)
Location X:154448854-154448876
Sequence CAGTGGGGCTGGAGACCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 367}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200232021_1200232023 -10 Left 1200232021 X:154448841-154448863 CCAAGGCTGCTCTCAGTGGGGCT 0: 1
1: 1
2: 1
3: 21
4: 270
Right 1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG 0: 1
1: 0
2: 4
3: 39
4: 367
1200232013_1200232023 19 Left 1200232013 X:154448812-154448834 CCACAGTCTCCTGGGTGGTGCGC 0: 1
1: 0
2: 1
3: 26
4: 250
Right 1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG 0: 1
1: 0
2: 4
3: 39
4: 367
1200232011_1200232023 24 Left 1200232011 X:154448807-154448829 CCTGTCCACAGTCTCCTGGGTGG 0: 1
1: 0
2: 5
3: 39
4: 318
Right 1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG 0: 1
1: 0
2: 4
3: 39
4: 367
1200232010_1200232023 25 Left 1200232010 X:154448806-154448828 CCCTGTCCACAGTCTCCTGGGTG 0: 1
1: 0
2: 2
3: 21
4: 295
Right 1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG 0: 1
1: 0
2: 4
3: 39
4: 367
1200232020_1200232023 -9 Left 1200232020 X:154448840-154448862 CCCAAGGCTGCTCTCAGTGGGGC 0: 1
1: 0
2: 1
3: 11
4: 184
Right 1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG 0: 1
1: 0
2: 4
3: 39
4: 367
1200232014_1200232023 10 Left 1200232014 X:154448821-154448843 CCTGGGTGGTGCGCTGAGCCCCA 0: 1
1: 0
2: 1
3: 20
4: 187
Right 1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG 0: 1
1: 0
2: 4
3: 39
4: 367
1200232018_1200232023 -8 Left 1200232018 X:154448839-154448861 CCCCAAGGCTGCTCTCAGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 242
Right 1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG 0: 1
1: 0
2: 4
3: 39
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200232023 Original CRISPR CAGTGGGGCTGGAGACCAAG AGG Intronic
900516574 1:3085041-3085063 AGGTGCGGCTGGGGACCAAGGGG - Intronic
901155627 1:7136022-7136044 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901155812 1:7137450-7137472 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901195278 1:7436781-7436803 CAGTGGGGCTGGGGTCCCAGCGG + Intronic
901425697 1:9181397-9181419 CAGTGGGGAAGGAGACTGAGGGG - Intergenic
901477167 1:9497725-9497747 CAGTGGGGATGTGGACCAACAGG - Intergenic
901873486 1:12152434-12152456 CAGGGGAACTGGAGCCCAAGGGG + Intergenic
902070982 1:13737415-13737437 CAGTGGTGATGGAGACCATATGG + Intronic
902205535 1:14865633-14865655 CAGGATGGCTGGAGAGCAAGGGG - Intronic
902559237 1:17266722-17266744 CAGTGGGTCTGGGGGCCCAGTGG + Exonic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
903046302 1:20566563-20566585 GAGTGGGGATGGGGACCTAGAGG + Intergenic
903736866 1:25535431-25535453 CAACGGGGCTGGAGGCCTAGGGG + Intergenic
903768048 1:25747289-25747311 CTGCAAGGCTGGAGACCAAGAGG - Intronic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
903983029 1:27203657-27203679 CAGGGGGGCTGGAAACCATCTGG - Intergenic
904804189 1:33119408-33119430 CCATGGGGATGGAGACCATGGGG + Intronic
905309082 1:37037196-37037218 CAGTGGGTGTGGAGAGCAAGAGG - Intergenic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
907093684 1:51754067-51754089 CAGTGGAGCTGGGGAGTAAGGGG + Intronic
911475515 1:98367642-98367664 CAGTGGGGTTGGGGAACACGTGG - Intergenic
911656644 1:100451300-100451322 CAGTGGGGTTGGAAAACATGTGG - Intronic
911981139 1:104568572-104568594 CAGTGGGGTATGGGACCAAGTGG + Intergenic
912278773 1:108290462-108290484 CAGTGGGGGTGGTGTCCCAGTGG + Intergenic
912289453 1:108403895-108403917 CAGTGGGGGTGGTGTCCCAGTGG - Intronic
912503847 1:110142054-110142076 CAGAGGCCCTGGAGGCCAAGAGG - Intergenic
917135445 1:171784438-171784460 CAGTGGGGCTGTCCACCACGTGG - Exonic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919510602 1:198459176-198459198 CAGTAGGGCTGAGGACCAATGGG + Intergenic
919879703 1:201893548-201893570 CAGTGGGGCTGGAGTACCTGTGG - Intergenic
919990094 1:202703557-202703579 GAGTGGTGATGGAGGCCAAGAGG - Intronic
920686675 1:208114182-208114204 AAGTGTTGCTGGGGACCAAGAGG - Intronic
920711865 1:208302893-208302915 CAGTGGGGCTGGAGAGGTAGTGG + Intergenic
921752142 1:218807939-218807961 CAGTGGGGTGGGAGATTAAGTGG - Intergenic
922004422 1:221514948-221514970 CACTGGAGCTTCAGACCAAGAGG + Intergenic
922986539 1:229870289-229870311 CAGTCAGGCAGGAGACCCAGAGG + Intergenic
923229497 1:231971550-231971572 CAGGGTGGCTGGAGAGGAAGGGG - Intronic
924133735 1:240940372-240940394 CTGTGGATCTGGAGACCAGGTGG - Intronic
1063667207 10:8070017-8070039 CAGGGGGTCTGGAAACTAAGAGG + Intronic
1064222887 10:13456439-13456461 CAGTGGGACTGGGGAGCGAGAGG + Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1064987507 10:21225859-21225881 CAGTGGGGCAGGGTACTAAGTGG - Intergenic
1067033567 10:42897356-42897378 GAGAGGGGCAGGAGAGCAAGAGG + Intergenic
1067452196 10:46388672-46388694 CAGTGTGGCTGGATCCCAAGGGG + Intronic
1067585041 10:47471083-47471105 CAGTGTGGCTGGATCCCAAGGGG - Intronic
1067783410 10:49225649-49225671 CAGTGGTGCTGGAGACAGAGTGG - Intergenic
1067941901 10:50663597-50663619 AAGTGGGGGTGGGGGCCAAGGGG + Intergenic
1068632768 10:59314679-59314701 AAGTGGGGGTGGGGTCCAAGGGG - Intronic
1069745677 10:70713449-70713471 CAGTGGGGCAGGAGCCCCAGGGG + Intronic
1069986915 10:72290898-72290920 GAGGGAGGCTGGAGTCCAAGAGG + Intergenic
1070104544 10:73418770-73418792 CAGTAGGTATGGAGAGCAAGAGG - Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070863144 10:79688548-79688570 AAGTGGGGGTGGGGGCCAAGGGG + Intergenic
1071003591 10:80858370-80858392 GAATGTGGCTGGAGAGCAAGAGG - Intergenic
1071220144 10:83456144-83456166 CTGTGGGGTGGGAGACGAAGAGG + Intergenic
1071514972 10:86291281-86291303 CAGTGGGGATGGAGGTCAATGGG - Intronic
1071573011 10:86708260-86708282 GAGTGGGGCTGGAGCAGAAGGGG + Intronic
1071766080 10:88667010-88667032 CAGTATGGCTTGAAACCAAGTGG + Intronic
1072009178 10:91288526-91288548 GAGTGGGGCAGAAGACCAAAAGG - Intergenic
1072899008 10:99391105-99391127 CAGAGGGGCTGGCCCCCAAGGGG + Intronic
1075600133 10:123761635-123761657 AACTGGGGCTGGAGACCCAAAGG - Intronic
1076066527 10:127452783-127452805 CTGTGGGGCTGCAGATCATGTGG + Intergenic
1076696498 10:132249750-132249772 CAGTGGAACTGGAGACCCAGTGG + Intronic
1076820277 10:132935250-132935272 CAGTGGGTTTGGATACCAAGGGG - Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078492623 11:11783551-11783573 CAGTTGGGCTCCAGTCCAAGTGG - Intergenic
1079161831 11:18002223-18002245 CAGTTGGGATGGAGAGTAAGAGG - Intronic
1079283327 11:19107412-19107434 CAGTTGGTGTGGAAACCAAGTGG - Intergenic
1079293146 11:19206910-19206932 CAGTGTGGCTCCAGACTAAGGGG - Intronic
1080411394 11:32028629-32028651 CAGTGTGGCTGGAAACAAGGAGG - Intronic
1080925424 11:36751354-36751376 CAGCTGGGCTGGGGGCCAAGGGG - Intergenic
1081049175 11:38316034-38316056 CAGTGGGGAAGAAAACCAAGTGG + Intergenic
1082735056 11:56846113-56846135 CAGTGGGGAAGGGGACCCAGCGG - Intergenic
1082767581 11:57181444-57181466 CTGGTGGGCTGGAGTCCAAGGGG - Intergenic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083991815 11:66250817-66250839 CAGTGCAGCTGGAGACCATGGGG + Intergenic
1084014144 11:66368858-66368880 CTGTGGGGCTGTTGACCAGGAGG + Intronic
1084039310 11:66532165-66532187 CAGTGGGGGTGGTGAGGAAGCGG - Exonic
1084145486 11:67262981-67263003 CAGAGAGGCTGGAGACTAAGAGG + Intergenic
1084209635 11:67615046-67615068 GAGTGGGGCTGGAGCACAGGTGG - Intergenic
1084597250 11:70124312-70124334 CAGTGGGGTTGGTGACAATGTGG - Intronic
1084870851 11:72097745-72097767 CAGTGAGGCTGGGGGCCAAGGGG + Exonic
1085178455 11:74511290-74511312 CAGTGGGGTAGAACACCAAGCGG + Intronic
1085345390 11:75765231-75765253 CATGGCGGCTGGAGGCCAAGGGG + Intronic
1087635609 11:100697864-100697886 CGGTGGGAGTGGAGAGCAAGGGG + Intronic
1087807622 11:102572170-102572192 CAGTGTGGCTGGAGACAGTGAGG - Intergenic
1088698732 11:112392642-112392664 CAGTGTGGCTGGATCCCATGAGG - Intergenic
1088944454 11:114495488-114495510 CAGTGGGGCAGAGCACCAAGTGG - Intergenic
1089762156 11:120735799-120735821 CAGTGGTGGTGGAGGCCATGAGG - Intronic
1090520970 11:127478844-127478866 CAGTGGGGTTGAAGAGCATGAGG + Intergenic
1092106038 12:5922358-5922380 CAGGGGGCCTGCAGACCAACTGG + Intronic
1092209554 12:6637521-6637543 GAGTGTGGCTGGAGCCCAGGAGG + Intergenic
1093910195 12:24738665-24738687 CAGTGGCCCTGGATACCAAGTGG + Intergenic
1094016200 12:25866983-25867005 CAGTGTTGGTGGAGACCAAGTGG + Intergenic
1094380712 12:29840397-29840419 CTGTGGTGATGGTGACCAAGGGG - Intergenic
1094525780 12:31229718-31229740 CAGTGGGGCTGGAGAGGCGGTGG - Intergenic
1096521608 12:52187711-52187733 CAGTAGGGATGGAGGTCAAGAGG + Intronic
1096762745 12:53856263-53856285 CAGTGGGGCAGCAGAGCATGGGG + Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1098461431 12:70736982-70737004 CAGTGGGGCAGGAGAGGATGGGG - Intronic
1102173604 12:110860283-110860305 CAGTGGGTCTGGGGGGCAAGTGG + Intronic
1103321093 12:120093313-120093335 CGGTGGGGATGGAGACCTAGAGG + Exonic
1103673060 12:122634037-122634059 CAGTGCTTCTGTAGACCAAGGGG - Intergenic
1103821523 12:123702525-123702547 CCGTGGGGGTGGAGTCCAACAGG - Intronic
1105818591 13:24059408-24059430 CAGTGAGACTGGAAATCAAGTGG - Intronic
1105866178 13:24461657-24461679 GAGCAGGGCAGGAGACCAAGGGG + Intronic
1108691461 13:52862868-52862890 CAGAGGGGCAGGAGAGAAAGGGG + Intergenic
1110305537 13:73983271-73983293 CAGCAGGGCTGGAAAGCAAGTGG - Intronic
1110481806 13:75986848-75986870 CAGTGCAGCTGGAGCCCATGAGG - Intergenic
1112461100 13:99604543-99604565 GAGTGGGGCTGGAGATAAATTGG + Intergenic
1113868834 13:113545960-113545982 CAGTGGGGCTGGAGATGAAGGGG + Intronic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1114472575 14:22974009-22974031 CAGCGGTGCTGGAGAAGAAGTGG - Intronic
1115203266 14:30875182-30875204 CGGTAGGGCTGAAGCCCAAGGGG - Intronic
1116063619 14:39954858-39954880 GACTTGGGGTGGAGACCAAGAGG + Intergenic
1117605897 14:57428871-57428893 CAGTGGGGCCGGGGCCAAAGAGG - Intergenic
1118282774 14:64444362-64444384 CAGTGGGGTTGGAAGTCAAGGGG - Intronic
1118375249 14:65171151-65171173 CAGTGGGGCTGGGGGACATGAGG + Intergenic
1118895400 14:69941496-69941518 CAGTGGGGATGGAAAAGAAGGGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119319531 14:73721435-73721457 AAGAGAGGCTGGAGCCCAAGAGG - Exonic
1120022346 14:79545106-79545128 CAATGGGGCTTGAAAACAAGTGG - Intronic
1121728308 14:96168870-96168892 CAGTGGGGATGAAGACCATGTGG - Intergenic
1121908742 14:97770065-97770087 AAGATGGGCTGGAGGCCAAGGGG + Intergenic
1122122010 14:99559754-99559776 CAGGGTGGCTGCAGACTAAGAGG + Intronic
1125929387 15:43589757-43589779 GGGTGGGGCTGGAGTCCAGGAGG - Intronic
1125942554 15:43689589-43689611 GGGTGGGGCTGGAGTCCAGGAGG - Intergenic
1126344418 15:47677347-47677369 CACTGGGGCTGGGTTCCAAGAGG + Intronic
1126957632 15:53951889-53951911 CAGTGGATCTGGAGACCAGCTGG + Intergenic
1128140910 15:65300457-65300479 CAGTGAGGCCGGAAACCAACTGG - Intronic
1128239723 15:66093750-66093772 CTGTGGGGCTGGCCACCAAGAGG - Intronic
1128301681 15:66570066-66570088 CAGTGGGGCTGAAGTCCCTGAGG + Intergenic
1128546642 15:68573040-68573062 CAGAGGGGGTCGGGACCAAGAGG + Intergenic
1128914767 15:71549777-71549799 ACGTGGGGCTGGAAGCCAAGCGG + Intronic
1129183056 15:73888960-73888982 CAGTGGGTCTGGGCACCCAGAGG + Intronic
1129192584 15:73946302-73946324 GAGTGGGGCTGCAGAACCAGTGG + Intronic
1129702161 15:77774291-77774313 GAGTCTGGCTGGGGACCAAGTGG - Intronic
1130130228 15:81134684-81134706 TAGTGGGGCTCTAGACTAAGCGG - Intronic
1130274440 15:82469180-82469202 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130333760 15:82941575-82941597 CAGTGGGCTTGGAGAGGAAGAGG - Intronic
1130466787 15:84196554-84196576 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130497477 15:84476982-84477004 CAGTGGGGTTGGAGCCCTGGTGG - Intergenic
1130589082 15:85201147-85201169 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132500686 16:283383-283405 CAGTGGGGCTGGGGACCGGCGGG + Intronic
1133048104 16:3100269-3100291 AAGTGGGCCTGAAGGCCAAGGGG + Intergenic
1133321837 16:4918957-4918979 CAGTGGGGCTGATGGCCCAGGGG - Intronic
1133905874 16:10021764-10021786 CAGTGGGGCTGGAGCAAATGAGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134147776 16:11780881-11780903 AAGGGGGACTGGATACCAAGAGG - Intronic
1134349937 16:13427658-13427680 CAGTGTGGCTGGAGAGAGAGAGG + Intergenic
1134491546 16:14699580-14699602 CAGTGGCACTGGGGACCAAAAGG - Intergenic
1134496927 16:14738698-14738720 CAGTGGCACTGGGGACCAAAAGG - Intronic
1134502170 16:14777779-14777801 CCCTGGGGCTGGAAACCATGCGG - Intronic
1134578390 16:15351114-15351136 CCCTGGGGCTGGAAACCATGTGG + Intergenic
1134724199 16:16406430-16406452 CCCTGGGGCTGGAAACCATGTGG - Intergenic
1134943231 16:18305439-18305461 CCCTGGGGCTGGAAACCATGTGG + Intergenic
1137425833 16:48380002-48380024 CTGTAAGGCTGGAGACCAAAAGG + Intronic
1137518881 16:49174705-49174727 CAGCTGGGATGGAGACCAAATGG - Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1137633738 16:49967436-49967458 CAGTGGGGCAGGATGCCCAGAGG + Intergenic
1137934052 16:52616967-52616989 CAGTGGTGCTGGAGAACATATGG - Intergenic
1138540303 16:57683824-57683846 CAGTGGGGGTGGAGAGCCATAGG + Intronic
1140040156 16:71402200-71402222 CAGCAGGGCAGGGGACCAAGGGG - Intergenic
1140457203 16:75112413-75112435 CCGTGGGCGTGGAGACCATGCGG - Exonic
1140475770 16:75238621-75238643 CAGGCGTGCTGGAGACCTAGTGG - Intronic
1141506912 16:84483848-84483870 CAGTGGGGCTTGAGAGCATCGGG + Intronic
1141831667 16:86512607-86512629 AAGTGGTGAGGGAGACCAAGTGG - Intronic
1141964790 16:87434599-87434621 CGGTGGTGCAGGAGACCAGGCGG - Intronic
1142599551 17:1046989-1047011 CAGTGGGGCAGGAGTCTCAGCGG - Intronic
1142599744 17:1047847-1047869 CAATGGGGCTGAAGTCCAGGTGG + Intronic
1142604638 17:1074688-1074710 CAGGGAGGCTGGAGGCCAGGAGG + Intronic
1143363594 17:6390796-6390818 CACTGAGGCTGGAGTACAAGTGG - Intergenic
1143571042 17:7758793-7758815 CAGTCTAGCTGGAGAACAAGTGG + Intronic
1143593133 17:7897948-7897970 CTGTGGGGCAGGAGGCCATGGGG - Intronic
1144068441 17:11645372-11645394 CACTGGTGGTGGAGACAAAGAGG - Intronic
1144801001 17:17927209-17927231 CAATGGGGGTGGAGTCCAAAGGG + Intronic
1144832831 17:18141068-18141090 CAGGGGTGCTGGAGACCGTGAGG + Exonic
1145288343 17:21522977-21522999 CTTTGGGGCAGGAGAACAAGAGG - Intergenic
1146011899 17:29201272-29201294 CAGTGGGGCTGGACAGGCAGAGG - Intergenic
1146499750 17:33354304-33354326 TAGTGGGGATGGAGAGCATGAGG - Intronic
1146659061 17:34652552-34652574 CAGTGAGGCCTGAGAACAAGAGG - Intergenic
1147370477 17:39989229-39989251 CAGTGGGGCTGAGGAGCAGGAGG - Intronic
1148215679 17:45833030-45833052 GACTGGGGCTGGAGGCCAAGAGG - Intronic
1148350831 17:46940835-46940857 CAGTGTGTCTGGACACCCAGGGG + Intronic
1149407805 17:56372406-56372428 CAGCAGGGCTGGAGAGCAATGGG + Intronic
1150284873 17:63949007-63949029 CACTGGGGCTGGGGGCCAGGAGG - Intronic
1150292511 17:63989592-63989614 CAGTGAGGCTGGAGCCCAAGTGG - Intergenic
1151247683 17:72807666-72807688 CAGTGGGCCTGGAGAGGAAATGG + Intronic
1152012445 17:77726851-77726873 CAAGGGGGCTGAAAACCAAGAGG + Intergenic
1152652689 17:81502961-81502983 CATAGAGGATGGAGACCAAGGGG - Intergenic
1155246935 18:23919720-23919742 CTGCGGGGCTGGAGAGCCAGAGG + Intronic
1157719691 18:49914210-49914232 CTGTGGGGCTAGAGCCCAAAAGG + Intronic
1158499424 18:57986850-57986872 GAGTGGGACTGGAGAAAAAGGGG - Intergenic
1158658779 18:59365907-59365929 CGGTGGGGGTGGGGAGCAAGGGG - Intergenic
1158781128 18:60653240-60653262 CAGCAGGTCTGGAGTCCAAGAGG + Intergenic
1159310633 18:66703051-66703073 CAGTGGGGCGGGAGTCAAATAGG - Intergenic
1159442830 18:68504029-68504051 AAGAGGAGCTGGAAACCAAGAGG + Intergenic
1161783593 19:6309800-6309822 CAGTGGTGATGAAGACCAGGCGG + Exonic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1163112712 19:15170964-15170986 CAGTGGGGTTGGATGCCAGGTGG - Intronic
1163530851 19:17848035-17848057 CAGTGGCTCAGGAAACCAAGGGG - Intronic
1163578555 19:18124522-18124544 CAGCGGGAGTGGAGACCCAGTGG + Intronic
1164866128 19:31605869-31605891 GAGAGGGGCTGGAGTCCTAGTGG + Intergenic
1165106055 19:33470221-33470243 CAGGTGGGCTGGAGGCCTAGAGG - Intronic
1165139692 19:33691188-33691210 CAGGTGGGCTGGGGACCCAGGGG + Intronic
1165436198 19:35796875-35796897 CAGTGGAGCTGGGCTCCAAGAGG - Intergenic
1165474615 19:36023362-36023384 CAGTAGGTATGGAGACCCAGAGG - Intronic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166098262 19:40555007-40555029 CGGTGGGGCTGGAGACCTCCTGG + Intronic
1166637693 19:44465589-44465611 CAGAGGGGCAAGAGAGCAAGTGG + Intergenic
1167479256 19:49719509-49719531 GGGTGGGGCTGGAGACGACGAGG - Intergenic
1167773891 19:51542488-51542510 CTCTGGTGCTGGAGAACAAGGGG - Intergenic
927993325 2:27463849-27463871 CAGTGTGGTTGGAGACTAATGGG + Intronic
928412012 2:31061611-31061633 CAGAGAGTTTGGAGACCAAGTGG - Intronic
929602489 2:43213065-43213087 CAGAGGAGCTAGAGACAAAGGGG + Intergenic
929946403 2:46375750-46375772 ACGTGTGGCTGGAGACCCAGGGG + Exonic
930019686 2:46994058-46994080 GAGTGGGGCTGGGCTCCAAGGGG + Intronic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
933891000 2:86769815-86769837 CAGTGGGCCTGGGGAAGAAGGGG + Intronic
933893401 2:86790467-86790489 CCGAGGGGCTGGACACCCAGCGG - Exonic
934581623 2:95445522-95445544 CTGCTGGGCTGGAAACCAAGAGG + Intergenic
934597827 2:95631192-95631214 CTGCTGGGCTGGAAACCAAGAGG - Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938262811 2:129907339-129907361 CACTGGGGCAGGAGGCAAAGTGG + Intergenic
938378472 2:130823686-130823708 ATGTGGTGCTAGAGACCAAGGGG - Intergenic
940043678 2:149387041-149387063 CAGTGGCCATTGAGACCAAGTGG + Intronic
940551316 2:155160572-155160594 CAGTGATGCTGGAGATGAAGGGG + Intergenic
940559817 2:155281144-155281166 CAATGGGGCAGAATACCAAGTGG - Intergenic
940638692 2:156327352-156327374 CAGTGGGGTGGGGGATCAAGTGG - Intronic
940886260 2:158991802-158991824 CAGGTGAGCTGGAAACCAAGTGG + Intronic
941951601 2:171161210-171161232 CAGCGGCGCTGGAGCCCGAGCGG - Intronic
942293501 2:174495774-174495796 CATTGAGGCTGGCGACCAATGGG + Intergenic
942433163 2:175938093-175938115 CAGTGGGGTTTGAGAACAACTGG + Intronic
943435979 2:187866606-187866628 TTGTGGAGCTGGAGACCCAGGGG - Intergenic
943436168 2:187867952-187867974 TCATGGAGCTGGAGACCAAGGGG - Intergenic
944189212 2:196983367-196983389 CAGTGTGGCTGGAGACTCAAGGG - Intronic
946179191 2:217939819-217939841 CTGTGGAGCTGGAGCCCATGTGG - Intronic
946310669 2:218880930-218880952 CAGTGGGACTGGAGAGCCAGGGG - Exonic
947670198 2:231930868-231930890 CAGTGGGGTTGGAGGCCATCTGG - Intergenic
948315682 2:237026812-237026834 CATTGGGAATGGAGACCAGGTGG + Intergenic
1169640285 20:7743642-7743664 CAGTGGTGCTAGAGACCAACAGG - Intergenic
1170053345 20:12171555-12171577 GAGTGGGGCTGGACCCCATGAGG - Intergenic
1170737567 20:19025018-19025040 CTGTGGGGGTGGGGCCCAAGTGG - Intergenic
1171387697 20:24781205-24781227 CAGTGAGGCTGCAAGCCAAGGGG - Intergenic
1172773499 20:37394729-37394751 CAGAGGGGCTGGAGAGAAAGGGG - Intronic
1174528457 20:51192102-51192124 GAGTTGGGCTGGAGAGGAAGAGG + Intergenic
1174578685 20:51555657-51555679 CAGTGGGGCTGGATCAGAAGGGG - Intronic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175843042 20:62042552-62042574 CTGTGGGGCGGGAGCCCAAAAGG + Intronic
1178996619 21:37406989-37407011 CAATGGGCCTGGAGAGCTAGGGG - Intronic
1179025444 21:37675517-37675539 CAGGGGTGCTGGGGACCGAGGGG - Intronic
1180148644 21:45936219-45936241 CAGTGGAGCAGGAGAAAAAGAGG + Intronic
1180635270 22:17258670-17258692 CAGTGGGGCTCTGGGCCAAGGGG - Intergenic
1180640078 22:17291253-17291275 CAGAGGGGCTGAAGACAATGTGG + Intergenic
1181266860 22:21635544-21635566 CAGTGAGGCGGGAGATGAAGAGG - Intronic
1181692416 22:24571416-24571438 CAGGGGGGATGGAGACGGAGGGG - Intronic
1181933146 22:26418954-26418976 CACTGGAGCTGGAGAGCAAGAGG + Intergenic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183792846 22:40087768-40087790 TAGTGAGGCTGGAGACTGAGAGG + Intronic
1184478988 22:44736364-44736386 CACTGGAGCTGGTGTCCAAGGGG - Intronic
1184492037 22:44815356-44815378 AGGAGGGGCTGGAGACCGAGTGG - Intronic
1185312355 22:50163093-50163115 CAGGGTGGCAGGAGACCAGGCGG + Intergenic
1185360402 22:50403462-50403484 CAGAGGGGCTGGCCAGCAAGTGG - Intronic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950267840 3:11588425-11588447 CAGTTGGGCTGCAGCCCAGGGGG + Intronic
951805683 3:26641304-26641326 AACTGGGGGTGGAGACCCAGGGG + Intronic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
954145898 3:48634156-48634178 CCCTGGGGCTGGAGGCCCAGGGG - Intronic
954369676 3:50163640-50163662 GGGTGGGGCTGGAGAGCTAGAGG + Intronic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
960036085 3:113104483-113104505 CAGGGAGGGTGGAGACAAAGGGG + Intergenic
960293225 3:115912386-115912408 CAGTGGGGTTGGTGTCAAAGAGG - Intronic
960556389 3:119034943-119034965 CGGTTGCCCTGGAGACCAAGCGG - Intronic
961359188 3:126356840-126356862 CGGAGGGGCTGGAGACGGAGGGG - Intronic
961391651 3:126555839-126555861 CAGTGGGGCTGGGGAGCCTGCGG - Intronic
961514879 3:127426301-127426323 CAGGAGGCCTGGAGAACAAGTGG + Intergenic
961697244 3:128713954-128713976 AAGTGGGGTTGGGGACCAAGAGG + Intergenic
962379227 3:134883788-134883810 CAGTGAGGCCGGAGACTCAGAGG + Intronic
964686779 3:159404304-159404326 CAGTGGGGTAGAGGACCAAGTGG + Intronic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966347748 3:178997819-178997841 CCGTGGGGTTGGAGCCCAAAAGG + Intergenic
966669344 3:182509337-182509359 TTGTGGGGCTGGAGAGCAAAGGG + Intergenic
967154180 3:186677506-186677528 CAGTGGGGATGGTGTCCATGGGG - Exonic
967630264 3:191737285-191737307 CAGTGGGGCAGAGCACCAAGTGG - Intergenic
968049882 3:195647247-195647269 CCGTGCAGCTGGAGACCCAGTGG - Intergenic
968050084 3:195648217-195648239 CCGTGCGGCTGGAGACCTGGTGG + Intergenic
968050229 3:195648905-195648927 CAGTGCAGCTGGAGACCCGGCGG + Intergenic
968097178 3:195940277-195940299 CCGTGGAGCTGGAGACCCGGCGG - Intergenic
968105599 3:195999354-195999376 CAGTGCAGCTGGAGACCCGGCGG - Intergenic
968105745 3:196000067-196000089 CGGTGCAGCTGGAGACCCAGCGG - Intergenic
968105838 3:196000496-196000518 CGGTGTAGCTGGAGACCCAGGGG - Intergenic
968303877 3:197636936-197636958 CAGTGCAGCTGGAGACCCGGCGG - Intergenic
968428328 4:537574-537596 CTGTGGGGCTGGATACCAAGTGG + Intronic
968697541 4:2040554-2040576 CAGTGGGGCGGGAGCCGTAGAGG - Intronic
968770304 4:2501413-2501435 CAGGGAGGCTGGAGCCCAGGAGG + Intronic
969054122 4:4390945-4390967 ATGTGGGGGTGGAGACAAAGAGG + Intronic
970371058 4:15407077-15407099 CCTTGGAGCAGGAGACCAAGCGG + Intronic
970689811 4:18609944-18609966 CAGTGGGCCTGGAGAGCAAATGG + Intergenic
972296623 4:37745479-37745501 CAGTGGGGCTGGTGGGCAACTGG - Intergenic
972902360 4:43700551-43700573 CAGTGGGGCAGAGCACCAAGTGG - Intergenic
975731995 4:77346564-77346586 CAGTGGGGTTGGACAACAGGAGG - Intronic
979013486 4:115400893-115400915 GAGTGGGGTTGGAGACCTAGAGG - Intergenic
981423242 4:144575365-144575387 AAGTGAGGCTGGAGCCCAGGAGG + Intergenic
983274091 4:165596564-165596586 CAGTGGAGTTGGGGAACAAGAGG + Intergenic
985506612 5:285170-285192 CCGTGCAGCTGGAGACCCAGAGG + Intronic
985506756 5:285882-285904 CTGTGCAGCTGGAGACCCAGGGG + Intronic
985506834 5:286262-286284 CTGTGCAGCTGGAGACCCAGCGG + Intronic
985741114 5:1618033-1618055 CCGTGGAGCTGGAGACCCGGGGG - Intergenic
985741443 5:1619548-1619570 CCGTGCAGCTGGAGACCCAGCGG - Intergenic
985995996 5:3597172-3597194 CACTGGGACGGGAGACTAAGAGG - Intronic
987254430 5:16135674-16135696 CAGTAGGCCTGGAGACCATCTGG - Intronic
989640863 5:43581735-43581757 AAGTGTGGCTGGTGACAAAGTGG - Intergenic
991663630 5:68974602-68974624 CAGTGGGGTAGAACACCAAGTGG + Intergenic
992763107 5:79969186-79969208 GAGTAAGGCTGGAGACCAGGAGG - Intergenic
992963714 5:81980829-81980851 CAGTGGAGCTAGAAACCAGGAGG + Intronic
997361601 5:133298842-133298864 AACCGGGGCTGGAGACCAGGAGG + Intronic
999598860 5:153237803-153237825 CTCTGGGGCTGGAGAGAAAGGGG - Intergenic
999858581 5:155621129-155621151 CTGCGGGGCTGGAGACCAAGGGG - Intergenic
1000181768 5:158818349-158818371 CAATGGTGCTGGACACCCAGGGG + Intronic
1002644207 5:180645274-180645296 CCGTGGGGGTGGAGACCAGGAGG + Intronic
1003147527 6:3521186-3521208 CAGTGGGACTGCAGACCACGCGG + Intergenic
1004321302 6:14633668-14633690 CAGGGAGTCTGGAGACCAGGAGG - Intergenic
1005392442 6:25347353-25347375 CAGTGGGGCAGGAGATCAATGGG - Intronic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1006616021 6:35327484-35327506 AAGTGGGGCTGGAGTACAAGAGG + Intergenic
1007938955 6:45758916-45758938 CCGAGGGGCTGGCGACCAACGGG - Intergenic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1011271090 6:85580508-85580530 CAGTGGGGTAGAGGACCAAGAGG + Intronic
1012824106 6:104125987-104126009 CAGTGGGGTAGAACACCAAGTGG - Intergenic
1013799138 6:113920487-113920509 GAGTGAGGCTGGGGACCAACAGG - Intergenic
1014852725 6:126361684-126361706 GAGTGGTGCTAGTGACCAAGGGG - Intergenic
1017014391 6:150088523-150088545 CACTCAGGCTGGAGAGCAAGTGG - Intergenic
1017550680 6:155503887-155503909 CAGTGAGGCAGAAGACTAAGAGG - Intergenic
1017760789 6:157566596-157566618 CTGGCGGGCTGGACACCAAGCGG + Intronic
1018717819 6:166547456-166547478 CAGTGGTGCTGGTGCCCAACTGG + Intronic
1019417242 7:933470-933492 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417253 7:933500-933522 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417269 7:933537-933559 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417300 7:933627-933649 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417311 7:933657-933679 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417322 7:933687-933709 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417353 7:933777-933799 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417394 7:933897-933919 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417415 7:933957-933979 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417426 7:933987-934009 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417465 7:934107-934129 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417486 7:934167-934189 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417497 7:934197-934219 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417535 7:934317-934339 CAGTGGTGCTGGAGAACCAGGGG + Intronic
1019706724 7:2500373-2500395 CCGAGGGGCTGGGGACCACGGGG - Intergenic
1022091950 7:27113755-27113777 CAGGCGGGCTGGAGACCCCGAGG + Intronic
1022506036 7:30909091-30909113 CATTGGGGCAGGAGGCCAGGGGG - Intergenic
1024261327 7:47576265-47576287 CACTGGGCCTGGAGCCCAAAAGG + Intronic
1024692678 7:51819888-51819910 CAATGCTGCTGCAGACCAAGGGG - Intergenic
1029346358 7:99981328-99981350 CAGTGGGTCTGGAAAGCGAGTGG + Intergenic
1029421863 7:100476117-100476139 CAGGGAAGCTGGAGGCCAAGGGG + Intronic
1033129688 7:138735239-138735261 GAGTGGGAGTGGAGACCATGGGG - Intronic
1034971175 7:155420248-155420270 CAGTTGTGCTGGGGCCCAAGAGG - Intergenic
1035386738 7:158478032-158478054 CTGTGGGGCAGGAAACCGAGTGG + Intronic
1035472579 7:159119733-159119755 CAGGTGGGCTGAAGGCCAAGAGG + Intronic
1036603204 8:10282522-10282544 TAATAGGGCTGGACACCAAGGGG - Intronic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037905743 8:22715159-22715181 CAGGGGGGCTGGAAAACAAGGGG + Intronic
1037948230 8:23002756-23002778 CAGTTGCCCTGGAGACCATGAGG + Intronic
1038397600 8:27258605-27258627 CTGTGGAGCTGGAGAACCAGAGG + Intergenic
1038939594 8:32289329-32289351 CTGAGGAGCTGGAGAACAAGAGG - Intronic
1039385721 8:37134033-37134055 CAGTGGGGCAGCAGAGCAAGTGG - Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1040871621 8:52105575-52105597 CAGTGGGGCAAGAGGCTAAGAGG + Intergenic
1040982425 8:53257253-53257275 AAGTGGGTCTGGAGGACAAGTGG + Intergenic
1042099138 8:65255418-65255440 CTGTGGGACTGGAGAAAAAGAGG - Intergenic
1042482932 8:69324088-69324110 TTGTGGAGCTGGAGACCCAGGGG + Intergenic
1043165948 8:76902684-76902706 CAGTTGGGGTGGGGGCCAAGAGG - Intergenic
1045041306 8:98227227-98227249 CAGTGGGGTAGAGGACCAAGAGG - Intronic
1046970977 8:120223112-120223134 CAGTGTGGCTGGAACCCAAAAGG + Intronic
1047025929 8:120824641-120824663 CATTGGGGTTGGTGACTAAGAGG - Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1048713244 8:137235371-137235393 GGGTGGGGCTGGAGGCAAAGGGG - Intergenic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049056369 8:140240442-140240464 CAGGTGAGCTGGAGAGCAAGAGG - Intronic
1049476740 8:142800387-142800409 CAGTGGGGCTGGAGACAGGGGGG - Intergenic
1049661750 8:143822621-143822643 AGGTGGGCCTGGGGACCAAGAGG + Intronic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1049693306 8:143972173-143972195 CAGGAGGGCTGGAGCCCAGGTGG + Intronic
1050154234 9:2649065-2649087 AAGAGGGGCTGAAGGCCAAGGGG - Intronic
1051186219 9:14464062-14464084 CGGTAGGGCTGGAGAGAAAGTGG - Intergenic
1051334923 9:16057645-16057667 CTTTGGGGCTGGGGACCCAGTGG - Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1054878863 9:70124126-70124148 CAGGGAGGCTGGAGAACATGGGG + Intronic
1059819450 9:117956069-117956091 CAGTGGGGCAGGAGAATAGGGGG + Intergenic
1060304501 9:122398572-122398594 CAGTGGGGCAGAGCACCAAGTGG + Intergenic
1060416882 9:123437047-123437069 AAGTGGGCCTGGAGATGAAGAGG + Intronic
1060754718 9:126204285-126204307 CTGTGGGGGTAGGGACCAAGGGG - Intergenic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061492101 9:130951009-130951031 CACTGGGGCTGGAGACCCCAAGG - Intergenic
1062414721 9:136442483-136442505 CAATGGGGCTGAATCCCAAGAGG + Intronic
1062429922 9:136522503-136522525 CAGTGGGGCTGGGGCCGGAGAGG - Intronic
1062545662 9:137062749-137062771 GAGTGGCCCTGGAGACCACGAGG - Exonic
1062628135 9:137452185-137452207 GCGTGGGGGTGGAGACCAAGGGG - Intronic
1187654883 X:21460674-21460696 CAGTGGGGGTGGAGGAGAAGTGG - Intronic
1187857934 X:23655056-23655078 CAGTTGTGCTGGAGGACAAGGGG - Intergenic
1189658939 X:43277729-43277751 CTGGGGGGCTGGGGACAAAGAGG + Intergenic
1191949384 X:66571994-66572016 CAGTGGGGTAGAACACCAAGTGG - Intergenic
1192561419 X:72130487-72130509 CAGTGAAGATGAAGACCAAGAGG - Exonic
1194522079 X:94931542-94931564 CAGTGGGGTAGAAAACCAAGTGG - Intergenic
1195667043 X:107440986-107441008 TGGTGGGGCTGGAGCCTAAGGGG + Intergenic
1197318461 X:124997737-124997759 CAGTGGCTCTGGACACCAAAAGG + Intergenic
1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG + Intronic
1201939461 Y:19444107-19444129 CAGTGGGGCTACAGAACCAGTGG - Intergenic