ID: 1200233542

View in Genome Browser
Species Human (GRCh38)
Location X:154457987-154458009
Sequence GCGGGCGCGCGCGGGTTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200233536_1200233542 -7 Left 1200233536 X:154457971-154457993 CCCGAGGGGGTGTGGCGCGGGCG No data
Right 1200233542 X:154457987-154458009 GCGGGCGCGCGCGGGTTCCGGGG No data
1200233524_1200233542 26 Left 1200233524 X:154457938-154457960 CCAGGGTGGGGCGAGGCGGACGC No data
Right 1200233542 X:154457987-154458009 GCGGGCGCGCGCGGGTTCCGGGG No data
1200233537_1200233542 -8 Left 1200233537 X:154457972-154457994 CCGAGGGGGTGTGGCGCGGGCGC No data
Right 1200233542 X:154457987-154458009 GCGGGCGCGCGCGGGTTCCGGGG No data
1200233532_1200233542 -1 Left 1200233532 X:154457965-154457987 CCCAGGCCCGAGGGGGTGTGGCG No data
Right 1200233542 X:154457987-154458009 GCGGGCGCGCGCGGGTTCCGGGG No data
1200233531_1200233542 0 Left 1200233531 X:154457964-154457986 CCCCAGGCCCGAGGGGGTGTGGC No data
Right 1200233542 X:154457987-154458009 GCGGGCGCGCGCGGGTTCCGGGG No data
1200233533_1200233542 -2 Left 1200233533 X:154457966-154457988 CCAGGCCCGAGGGGGTGTGGCGC No data
Right 1200233542 X:154457987-154458009 GCGGGCGCGCGCGGGTTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200233542 Original CRISPR GCGGGCGCGCGCGGGTTCCG GGG Intergenic