ID: 1200234461

View in Genome Browser
Species Human (GRCh38)
Location X:154461600-154461622
Sequence AGCTCCTTGTTCAGCAGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200234461_1200234466 19 Left 1200234461 X:154461600-154461622 CCCTGGCTGCTGAACAAGGAGCT 0: 1
1: 1
2: 1
3: 12
4: 175
Right 1200234466 X:154461642-154461664 AGCCCCTCATCACCCCACACTGG 0: 1
1: 0
2: 2
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200234461 Original CRISPR AGCTCCTTGTTCAGCAGCCA GGG (reversed) Exonic