ID: 1200234462

View in Genome Browser
Species Human (GRCh38)
Location X:154461601-154461623
Sequence CAGCTCCTTGTTCAGCAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200234462_1200234466 18 Left 1200234462 X:154461601-154461623 CCTGGCTGCTGAACAAGGAGCTG 0: 1
1: 0
2: 2
3: 35
4: 327
Right 1200234466 X:154461642-154461664 AGCCCCTCATCACCCCACACTGG 0: 1
1: 0
2: 2
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200234462 Original CRISPR CAGCTCCTTGTTCAGCAGCC AGG (reversed) Exonic