ID: 1200234464

View in Genome Browser
Species Human (GRCh38)
Location X:154461625-154461647
Sequence GGGGCTCACGGTGTTGATGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200234464_1200234473 13 Left 1200234464 X:154461625-154461647 CCTGCATCAACACCGTGAGCCCC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1200234473 X:154461661-154461683 CTGGTCCTCTGCCCTGTCCCAGG 0: 1
1: 0
2: 7
3: 49
4: 500
1200234464_1200234466 -6 Left 1200234464 X:154461625-154461647 CCTGCATCAACACCGTGAGCCCC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1200234466 X:154461642-154461664 AGCCCCTCATCACCCCACACTGG 0: 1
1: 0
2: 2
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200234464 Original CRISPR GGGGCTCACGGTGTTGATGC AGG (reversed) Exonic