ID: 1200234466

View in Genome Browser
Species Human (GRCh38)
Location X:154461642-154461664
Sequence AGCCCCTCATCACCCCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200234464_1200234466 -6 Left 1200234464 X:154461625-154461647 CCTGCATCAACACCGTGAGCCCC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1200234466 X:154461642-154461664 AGCCCCTCATCACCCCACACTGG 0: 1
1: 0
2: 2
3: 25
4: 244
1200234461_1200234466 19 Left 1200234461 X:154461600-154461622 CCCTGGCTGCTGAACAAGGAGCT 0: 1
1: 1
2: 1
3: 12
4: 175
Right 1200234466 X:154461642-154461664 AGCCCCTCATCACCCCACACTGG 0: 1
1: 0
2: 2
3: 25
4: 244
1200234463_1200234466 -5 Left 1200234463 X:154461624-154461646 CCCTGCATCAACACCGTGAGCCC 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1200234466 X:154461642-154461664 AGCCCCTCATCACCCCACACTGG 0: 1
1: 0
2: 2
3: 25
4: 244
1200234462_1200234466 18 Left 1200234462 X:154461601-154461623 CCTGGCTGCTGAACAAGGAGCTG 0: 1
1: 0
2: 2
3: 35
4: 327
Right 1200234466 X:154461642-154461664 AGCCCCTCATCACCCCACACTGG 0: 1
1: 0
2: 2
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200234466 Original CRISPR AGCCCCTCATCACCCCACAC TGG Intronic