ID: 1200234473

View in Genome Browser
Species Human (GRCh38)
Location X:154461661-154461683
Sequence CTGGTCCTCTGCCCTGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 7, 3: 49, 4: 500}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200234463_1200234473 14 Left 1200234463 X:154461624-154461646 CCCTGCATCAACACCGTGAGCCC 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1200234473 X:154461661-154461683 CTGGTCCTCTGCCCTGTCCCAGG 0: 1
1: 0
2: 7
3: 49
4: 500
1200234467_1200234473 -6 Left 1200234467 X:154461644-154461666 CCCCTCATCACCCCACACTGGTC 0: 1
1: 0
2: 2
3: 15
4: 240
Right 1200234473 X:154461661-154461683 CTGGTCCTCTGCCCTGTCCCAGG 0: 1
1: 0
2: 7
3: 49
4: 500
1200234464_1200234473 13 Left 1200234464 X:154461625-154461647 CCTGCATCAACACCGTGAGCCCC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1200234473 X:154461661-154461683 CTGGTCCTCTGCCCTGTCCCAGG 0: 1
1: 0
2: 7
3: 49
4: 500
1200234465_1200234473 1 Left 1200234465 X:154461637-154461659 CCGTGAGCCCCTCATCACCCCAC 0: 1
1: 0
2: 1
3: 40
4: 375
Right 1200234473 X:154461661-154461683 CTGGTCCTCTGCCCTGTCCCAGG 0: 1
1: 0
2: 7
3: 49
4: 500
1200234469_1200234473 -8 Left 1200234469 X:154461646-154461668 CCTCATCACCCCACACTGGTCCT 0: 1
1: 1
2: 2
3: 23
4: 369
Right 1200234473 X:154461661-154461683 CTGGTCCTCTGCCCTGTCCCAGG 0: 1
1: 0
2: 7
3: 49
4: 500
1200234468_1200234473 -7 Left 1200234468 X:154461645-154461667 CCCTCATCACCCCACACTGGTCC 0: 1
1: 1
2: 0
3: 28
4: 280
Right 1200234473 X:154461661-154461683 CTGGTCCTCTGCCCTGTCCCAGG 0: 1
1: 0
2: 7
3: 49
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200234473 Original CRISPR CTGGTCCTCTGCCCTGTCCC AGG Intronic