ID: 1200235082

View in Genome Browser
Species Human (GRCh38)
Location X:154464251-154464273
Sequence TGAGGGGCAGAGCAGTTCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 1, 2: 2, 3: 37, 4: 265}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200235082_1200235095 13 Left 1200235082 X:154464251-154464273 CCGGTGAACTGCTCTGCCCCTCA 0: 1
1: 1
2: 2
3: 37
4: 265
Right 1200235095 X:154464287-154464309 AGCTCCGAGCTCTTACCAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 87
1200235082_1200235083 -10 Left 1200235082 X:154464251-154464273 CCGGTGAACTGCTCTGCCCCTCA 0: 1
1: 1
2: 2
3: 37
4: 265
Right 1200235083 X:154464264-154464286 CTGCCCCTCACCCTCCCTCCAGG 0: 1
1: 1
2: 5
3: 159
4: 1572
1200235082_1200235092 10 Left 1200235082 X:154464251-154464273 CCGGTGAACTGCTCTGCCCCTCA 0: 1
1: 1
2: 2
3: 37
4: 265
Right 1200235092 X:154464284-154464306 AGGAGCTCCGAGCTCTTACCAGG 0: 1
1: 0
2: 0
3: 13
4: 87
1200235082_1200235099 26 Left 1200235082 X:154464251-154464273 CCGGTGAACTGCTCTGCCCCTCA 0: 1
1: 1
2: 2
3: 37
4: 265
Right 1200235099 X:154464300-154464322 TACCAGGGGGCATGGTCAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1200235082_1200235093 11 Left 1200235082 X:154464251-154464273 CCGGTGAACTGCTCTGCCCCTCA 0: 1
1: 1
2: 2
3: 37
4: 265
Right 1200235093 X:154464285-154464307 GGAGCTCCGAGCTCTTACCAGGG 0: 1
1: 0
2: 0
3: 5
4: 87
1200235082_1200235094 12 Left 1200235082 X:154464251-154464273 CCGGTGAACTGCTCTGCCCCTCA 0: 1
1: 1
2: 2
3: 37
4: 265
Right 1200235094 X:154464286-154464308 GAGCTCCGAGCTCTTACCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1200235082_1200235098 25 Left 1200235082 X:154464251-154464273 CCGGTGAACTGCTCTGCCCCTCA 0: 1
1: 1
2: 2
3: 37
4: 265
Right 1200235098 X:154464299-154464321 TTACCAGGGGGCATGGTCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 167
1200235082_1200235097 18 Left 1200235082 X:154464251-154464273 CCGGTGAACTGCTCTGCCCCTCA 0: 1
1: 1
2: 2
3: 37
4: 265
Right 1200235097 X:154464292-154464314 CGAGCTCTTACCAGGGGGCATGG 0: 1
1: 0
2: 0
3: 2
4: 88
1200235082_1200235101 30 Left 1200235082 X:154464251-154464273 CCGGTGAACTGCTCTGCCCCTCA 0: 1
1: 1
2: 2
3: 37
4: 265
Right 1200235101 X:154464304-154464326 AGGGGGCATGGTCAGTGGGTTGG 0: 1
1: 1
2: 1
3: 40
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200235082 Original CRISPR TGAGGGGCAGAGCAGTTCAC CGG (reversed) Exonic
900074461 1:801817-801839 GGAGGGGCAGAGCAATGCCCAGG + Intergenic
900357625 1:2272391-2272413 AGAGGGGCAGAGCCCTCCACAGG + Intronic
900746257 1:4362658-4362680 TCTGGGGCAGAGCAGGTCAGTGG + Intergenic
901014085 1:6217830-6217852 TGAGGGGCAGACACGGTCACAGG - Intronic
903027281 1:20438355-20438377 TGATGGGGAGACCAGTACACAGG - Intergenic
903101822 1:21036291-21036313 TGAGTGTCAGAGCAGCTCAGAGG - Intronic
903262288 1:22137800-22137822 TGAGGGGCAGAGCAGCAGATCGG + Intronic
903353271 1:22730889-22730911 TGAGGGACAGAGCAGGGGACAGG + Intronic
903474059 1:23607332-23607354 GGCGGGGCAGAGCAGGTTACAGG + Intronic
906490687 1:46266225-46266247 AGAGTGTCAGAGAAGTTCACTGG + Intronic
907127877 1:52067754-52067776 TGGGGGGCAGAGGAGTTGAAGGG - Intronic
907612092 1:55881871-55881893 TGAGAGGCACTGCAGTTCACTGG - Intergenic
908683883 1:66692532-66692554 GGAGAGGAAGAGCAGTGCACAGG - Intronic
908783366 1:67712004-67712026 TGAGAGGCAGAGGTGTTTACAGG + Intronic
909492475 1:76240643-76240665 TGAGGGACAGATCAGCTGACTGG - Intronic
910205854 1:84748127-84748149 TGAGGGAAAGGGCAGTTCAAGGG - Intergenic
910401145 1:86839307-86839329 TTAGTGACAGAGCTGTTCACTGG + Intergenic
914436490 1:147664816-147664838 TGAAGGCCATAGCAGTTCAAAGG + Intronic
916627481 1:166573784-166573806 TGAGGGGCAGAGAATTTTAGGGG - Intergenic
921088127 1:211815690-211815712 TGAGGGGGAGAGGAGTTTAGTGG - Intronic
922141638 1:222893943-222893965 TGAGTGGCAGAACAGTTCTCAGG + Intronic
922270307 1:224026721-224026743 GGAGGGGCAGAGCAATGCCCAGG + Intergenic
922561829 1:226575181-226575203 TGAGGTGCAGAGCAGTGGTCAGG - Intronic
922577449 1:226671718-226671740 TGAGGGGCTGAGCCATACACAGG + Intronic
922579225 1:226684858-226684880 TGATGGGCAGAGCAGCTCAGTGG - Intronic
924450898 1:244178103-244178125 TGAGTGCCAGAGGGGTTCACAGG + Intergenic
924804670 1:247352830-247352852 TGGGGGACAGAGCAGGCCACAGG - Intergenic
1064097606 10:12435510-12435532 GGAGGGGACGAGCAGGTCACAGG - Intronic
1066748917 10:38632704-38632726 TGAGGGTCACTGAAGTTCACAGG + Intergenic
1066967746 10:42285081-42285103 TGAGGGTCACTGAAGTTCACAGG - Intergenic
1067055778 10:43049078-43049100 TGAGGCTGAGAGCAGGTCACGGG - Intergenic
1068226911 10:54117636-54117658 TGAGTGGCAGAACAGTTCTCAGG + Intronic
1068597818 10:58922381-58922403 TGAGGTGCACAGGAGATCACTGG - Intergenic
1068764223 10:60745540-60745562 TGAGAGGCAGAGGAGCTGACAGG - Intergenic
1070833263 10:79432925-79432947 TGAGGCCCAGAGTAGTTAACTGG - Intronic
1072716380 10:97755515-97755537 GGAGGGGCACGGCAGTTCTCTGG + Intronic
1072800651 10:98390349-98390371 AGAGGGGCAGAGCACTGCCCAGG - Intronic
1073117993 10:101103161-101103183 TGACAGGCAGTGCAGTTCAGTGG - Intronic
1073467510 10:103702866-103702888 TGAGGGGCAAAGCAGTCCTCTGG - Intronic
1073845125 10:107545455-107545477 TGAGCGGCAGAACAGCTCTCAGG - Intergenic
1074086653 10:110213187-110213209 TCAGGGTCACAGCTGTTCACAGG - Intronic
1076528799 10:131130541-131130563 AGAGGGTCAGAGCAGATCACAGG - Intronic
1077191288 11:1256883-1256905 GGTGGGGCAGAACAGGTCACGGG - Intronic
1077717892 11:4600009-4600031 TGAGGATCAGAGCAGTTCTAAGG - Exonic
1078893345 11:15577134-15577156 TGAGGGTCAGAGGAACTCACAGG - Intergenic
1079186717 11:18244956-18244978 TGAGGGACAGAGAAGGTAACAGG + Intronic
1079242340 11:18729592-18729614 TGAGGGGCAGGGCAGCCCAGCGG + Intronic
1079313877 11:19391068-19391090 TGAGGGGCCCAGCATTTCATGGG + Intronic
1079421908 11:20301023-20301045 TCAGGCCCAGAGGAGTTCACTGG - Intergenic
1081868665 11:46373121-46373143 TGGGGGGCAGGGCAGGTGACTGG + Intronic
1082822100 11:57551085-57551107 TGAGGCACAGAGCACTTCAGTGG - Intergenic
1083640505 11:64142769-64142791 TGAGGGGCAGAGTTGATCAGGGG - Intronic
1084175134 11:67418969-67418991 TGTGGGGCAGGTCAGGTCACGGG - Exonic
1084601939 11:70151000-70151022 GGAGAGGCACAGCAGCTCACAGG + Intronic
1084736302 11:71107884-71107906 AGAGGTGCAGAGCAGCTCAGAGG + Intronic
1084773845 11:71362539-71362561 TGAGTGGATGAGCAGTTAACTGG + Intergenic
1085534718 11:77211126-77211148 TCAGAGACAGAGCAGGTCACAGG - Intronic
1088123712 11:106398480-106398502 TGAGGGTAAGAGCATTTCTCTGG + Intergenic
1091267589 11:134282774-134282796 TGAGGTGCAGAGGTGCTCACTGG - Intronic
1097227741 12:57488453-57488475 GGAAGGGAAGAGCAGTTTACTGG - Intronic
1097747874 12:63318980-63319002 TGAGGGGCAGGGCAGGCCATAGG + Intergenic
1100332947 12:93602682-93602704 TTATGGTCAGGGCAGTTCACAGG + Intergenic
1102929477 12:116851382-116851404 TGAGGGGCAGAGCAGTGCGGAGG - Exonic
1104716695 12:131020403-131020425 TGAGGGGCAGAGCCCTGCCCTGG - Intronic
1107287679 13:38814434-38814456 TGAGATCCAGAGCAGTTCTCTGG + Intronic
1107381373 13:39860228-39860250 TGTGGGTCAGAGCAGGTAACTGG + Intergenic
1107955478 13:45507026-45507048 TGAGGAGCAGAGCAGGCCCCGGG - Intronic
1108249646 13:48551499-48551521 TGAGCAGCAGAACAGTTCTCAGG - Intergenic
1108572837 13:51767838-51767860 GGAGGGGAAGTGGAGTTCACAGG + Intergenic
1108633680 13:52311673-52311695 TGTAGGGTAGAGCAGTTTACAGG - Intergenic
1109705868 13:66092275-66092297 TGTGGGGCAGAGCAGGCCATTGG - Intergenic
1109988160 13:70017052-70017074 TGAGCGGCAGAACAGTTCTCAGG - Intronic
1111378842 13:87419116-87419138 TGAGAGACAGAGCATTTCAATGG + Intergenic
1114980474 14:28157946-28157968 TGAGAGGCAGAACAGTTCTGAGG + Intergenic
1115298233 14:31854763-31854785 AGAGGGGCAGAACAGTTCATTGG - Intronic
1116938896 14:50770762-50770784 GCAGGGGCAGAACAGTGCACTGG - Intronic
1117447311 14:55816437-55816459 TGAATGGCAGAGCAGTTTGCTGG - Intergenic
1118640472 14:67787700-67787722 TGAGGGGAAGAGCAGATCACTGG + Intronic
1118764008 14:68898079-68898101 TCTGGGGCAGAGCAGGGCACTGG + Intronic
1119466097 14:74859947-74859969 TGAGGCTCAGAGCAGTTAAGTGG - Intronic
1120757068 14:88254385-88254407 TGAAGGGAATAGCATTTCACGGG - Intronic
1121496054 14:94391816-94391838 TGAGAGTCAGTGCAGGTCACTGG + Intergenic
1121776445 14:96593815-96593837 AGAGGGGCAGAGCAGAGCAGGGG + Intergenic
1122128652 14:99592721-99592743 CAAGGGGCAGAGCAGTAGACAGG + Intronic
1122519530 14:102333776-102333798 TGAAAGGCAGAGGGGTTCACAGG - Intronic
1122774595 14:104111671-104111693 GGAGGGGCAGAGCAGTGAGCTGG - Intronic
1122799378 14:104222046-104222068 TGAGGGGTAGAGCAGCTCAAGGG - Intergenic
1122979735 14:105186045-105186067 TGTGGGGCACAGAAGTCCACTGG + Intergenic
1123986478 15:25650712-25650734 TGAGGGCCAGAGAAGATGACAGG - Intergenic
1124879833 15:33631710-33631732 AGAGAGGCAGAGCAGGACACAGG - Intronic
1125598892 15:40904855-40904877 TGTGGGGAGGAGCAGGTCACAGG - Intergenic
1125676083 15:41503257-41503279 CGCGGTGCAGGGCAGTTCACCGG + Exonic
1126063415 15:44806032-44806054 TGTGGGTCATAGCAGTTAACAGG - Intergenic
1126156831 15:45573873-45573895 TGAGGGTCAGAACAGCTCAGAGG + Intergenic
1127670071 15:61186757-61186779 TGAGGAGCAGCACAGTTAACTGG - Intronic
1127836949 15:62797712-62797734 TGTGGGCCAGAGCAGGGCACAGG + Intronic
1127889362 15:63235007-63235029 TGAGGGGCAGAGCAGGGAAGTGG - Intronic
1129512363 15:76133857-76133879 TGGGGGGCACAGCAGTTTAGTGG + Intronic
1130881213 15:88057681-88057703 CCAGGGGCAGAGCAGGGCACTGG - Intronic
1130943160 15:88528613-88528635 TGTTAGGCAGAGCAGATCACTGG - Intronic
1131403132 15:92142436-92142458 GGAGGGGCAAGGCAGTTCTCTGG + Intronic
1131931937 15:97452350-97452372 AGAAGGTCAGAGCAGTTCAGTGG + Intergenic
1132409428 15:101565509-101565531 TTAGGGGCAGAGCTGGGCACTGG - Intergenic
1133280778 16:4664003-4664025 TGAGGGGAAGTGCTGGTCACTGG - Intronic
1133647757 16:7780500-7780522 TGAGGCGCAGAGAGGTTAACTGG - Intergenic
1134207449 16:12249688-12249710 TGAGGTGGAGAGTATTTCACAGG + Intronic
1135253228 16:20918748-20918770 TGAGATTCAGAGCAGTTCATGGG - Intronic
1135764237 16:25163779-25163801 TGAGCTGCATAGCAGTTCATTGG + Intronic
1136176525 16:28520889-28520911 TGAGGGTCAAAGAAGTGCACTGG - Intergenic
1139015516 16:62684541-62684563 TGAGTGACAGAACAGTTCTCGGG - Intergenic
1139664842 16:68448276-68448298 TGAGGGGCTGGGGAGTTGACGGG - Intronic
1141502284 16:84452430-84452452 TGAGGGTCAGAGTGGTTCAATGG - Intronic
1144453842 17:15403151-15403173 TGAGGAGCAGGGCAGTGCACTGG - Intergenic
1144845035 17:18212796-18212818 TGAGGCCCAGAGAAGTTGACTGG + Intergenic
1144943908 17:18960164-18960186 TGAGGGGCAGAGCTGGGGACAGG - Intronic
1150300838 17:64045639-64045661 TGAGGAACAGAGCAGCTCACAGG - Intronic
1152233587 17:79126847-79126869 TGAGTGGCAGAGCTGTTCTGAGG - Intronic
1154023898 18:10688851-10688873 TAAGGAGCAGAGGAGTTGACAGG - Intronic
1155999894 18:32372899-32372921 AGAGGAGCAGAGCAGCTCCCAGG + Intronic
1158042663 18:53115175-53115197 TGTATGGCATAGCAGTTCACTGG + Intronic
1159846069 18:73461500-73461522 TGAGGGTCTGAGCAGCTTACAGG + Intergenic
1160673751 19:377805-377827 TGAGGGACAGAGCAGTCCTCGGG - Intergenic
1160986587 19:1841805-1841827 GGAGAGGCAGAGCAGCTCGCTGG - Intronic
1161524897 19:4748171-4748193 TTAGGGGCAGAGTAGCTCAAGGG - Intergenic
1161983784 19:7643484-7643506 TGAGGGGCAGAGCCTTGGACAGG + Intronic
1164763170 19:30743414-30743436 GGAGGGGCAAAGCAGTTCATGGG + Intergenic
1164960300 19:32422723-32422745 GAAGGGGCAGAGCAGTTTCCAGG + Intronic
1167593555 19:50416561-50416583 GGGGGGGCAGAGGAGATCACCGG + Intronic
1168301120 19:55405789-55405811 TGAGTGGGAGAGGCGTTCACTGG - Intronic
927019860 2:19005209-19005231 TGAGATGCAGAGCAGTGCACGGG - Intergenic
927418702 2:22906854-22906876 TTAGAGGCAGATCTGTTCACAGG - Intergenic
928085054 2:28340713-28340735 TGAGGGGACGACCAGTCCACAGG - Intergenic
928138572 2:28707733-28707755 TGAGAGGCTGAGCAGATCAGAGG - Intergenic
930046328 2:47176134-47176156 TGAGGGACAGCCCAGTGCACGGG - Intronic
931733822 2:65176819-65176841 TGAGCAGCAGAACAGTTCTCAGG + Intergenic
932356146 2:71069832-71069854 TGGGGGTCACAGTAGTTCACAGG - Intronic
934311909 2:91874831-91874853 TGAGGGTCACTGAAGTTCACAGG + Intergenic
935829400 2:106984945-106984967 TGAGGCTCAGGGCAGTTCAACGG + Intergenic
936951835 2:117985324-117985346 TGTGAGGCAGAGCAGCACACAGG + Intronic
937163979 2:119794879-119794901 TGAGCGACAGAGCAGCTCAGAGG + Intronic
941711087 2:168714124-168714146 GAAGGGGCAAAGCAGTTCTCTGG + Intronic
942036679 2:172016804-172016826 TGAGGGGCAGGCCAGTGGACAGG - Intronic
943928459 2:193819374-193819396 TGGGCAGCAGAGCAGTTCTCAGG + Intergenic
943932214 2:193868496-193868518 TGAGGGACAGAACAGCTCTCAGG - Intergenic
944022647 2:195125348-195125370 TGAGCAGCAGAACAGTTCTCAGG + Intergenic
945004802 2:205393252-205393274 ATAGGGGCAGAGAAGTTCATAGG - Intronic
945063764 2:205931114-205931136 TGAGAGGAAGAGCAATTTACAGG - Intergenic
945395087 2:209307136-209307158 TGAGCTGCAGAACAGTTCTCAGG + Intergenic
946311075 2:218883024-218883046 TTAGGGGAAGAGGAGTTGACAGG - Intronic
947416008 2:229897062-229897084 TGAGGGGTAGAGGAGTGTACAGG + Intronic
947967837 2:234296891-234296913 TGAGGGGCAGTGCAAATCTCAGG + Intergenic
948373571 2:237505627-237505649 AGAGGGGCAGAGCAGGGCACAGG + Intronic
948460997 2:238129952-238129974 AGACGGGCAGAGCAGGTCAGGGG + Intronic
948565741 2:238884938-238884960 TAAGGGGCAGAGCAGGCCAGGGG + Intronic
948741251 2:240047529-240047551 TGAGGGGCAGAGCAGGTCACTGG + Intergenic
948811862 2:240482443-240482465 GGAGGCGCAGGGCAGTCCACAGG + Intronic
1170884072 20:20323094-20323116 CGAGTGGCAGAGTAGCTCACAGG - Intronic
1171131615 20:22658858-22658880 TGTGGGGCAGAGAAGATCCCTGG + Intergenic
1173449126 20:43146967-43146989 TGGGAGTCAGAGAAGTTCACTGG - Intronic
1173897007 20:46558860-46558882 TGAGGGCCTGAGCTCTTCACTGG + Exonic
1174148090 20:48466421-48466443 GGAAGTGCAGAACAGTTCACTGG - Intergenic
1175898959 20:62352522-62352544 TGGGGGGCAGTGCAGTCCAACGG - Intronic
1176845404 21:13872630-13872652 TGAGGGTGCGAGCAGTTGACGGG + Intergenic
1177260533 21:18724557-18724579 AGAGAAGCAAAGCAGTTCACTGG + Intergenic
1177404375 21:20646186-20646208 TGAGTGGCAGAACAGTTCTCAGG - Intergenic
1178937466 21:36875652-36875674 TGAGTGGCAGAACAGCTCTCAGG - Intronic
1178947418 21:36959743-36959765 TGAGTGGCAGAACAGCTCTCAGG - Intronic
1180538667 22:16420654-16420676 TGAGGGTCACTGAAGTTCACAGG + Intergenic
1181048285 22:20226908-20226930 GGATGGGCAGAGCAGACCACTGG + Intergenic
1183420186 22:37707350-37707372 AGAGTGGCAGAGGAGTGCACAGG - Intronic
1183619554 22:38964656-38964678 TGAGGGACAGAGCAGGGCAGAGG - Intronic
1183835572 22:40449973-40449995 TGAGGAGCACAGAGGTTCACTGG + Intronic
1183857897 22:40648483-40648505 AGAGGGGCAGAGCAACTCAGTGG + Intergenic
1184275734 22:43408660-43408682 AGAAGGGCAGAGGAGTTCAGAGG - Intergenic
1184650508 22:45917466-45917488 AGAGGGGCAGAGCGGTGCACAGG - Intergenic
949243095 3:1894257-1894279 TTAGGGACAGAGCAGTGAACCGG + Intergenic
949895750 3:8766680-8766702 TGGGGGGCAGAGGAGTCCAAGGG - Intronic
950864314 3:16176553-16176575 TGATGGGCAGAGCTGTGCCCAGG + Intronic
950907985 3:16556532-16556554 GGAGTGGCTGAGCAGTTCCCTGG + Intergenic
951518986 3:23593710-23593732 TGAGATGCAGAGAAGTTCAGGGG - Intergenic
952113112 3:30147438-30147460 TGAGAGGCAGAGCAATGCACAGG + Intergenic
952523945 3:34189878-34189900 TGTGGGTCATAGCAGTTAACAGG + Intergenic
953364203 3:42328228-42328250 GAAGGGGCAGAGCAGCTCTCTGG - Intergenic
953683004 3:45053417-45053439 TGAAGGCCAGAGCAGCTCACAGG - Intergenic
954148580 3:48646420-48646442 TGAGGGGCTGAGCAGCTCCAGGG + Intronic
955863379 3:63355980-63356002 AAAGGGGCAGAGAAGATCACAGG - Intronic
957330208 3:78753679-78753701 TGAGGGGCAGAGAAGGGCAAGGG - Intronic
957863134 3:85985267-85985289 CAAGGGGCAGAGCAGCTCTCTGG + Intronic
958584426 3:96068789-96068811 TGAGTGGCAGAGCAGCTCTCAGG + Intergenic
960143285 3:114171928-114171950 TGTGGGGCAGAGAACTCCACAGG - Exonic
960230678 3:115222736-115222758 TGAAGGAAGGAGCAGTTCACAGG - Intergenic
961525850 3:127496877-127496899 TGAGTGGCAGAACAGCTCAGAGG - Intergenic
961709662 3:128818308-128818330 TTAAGGCCAGAGCAGTTCAAAGG - Intergenic
962794974 3:138842157-138842179 TGAGGCCCAGAGAAGTTAACAGG + Intergenic
964224038 3:154376772-154376794 TGAGAGGCAGTGCAGCTCAGTGG + Intronic
964821837 3:160779447-160779469 TGAGGGGCAGTGGAGTGCAGTGG + Intronic
966198478 3:177337045-177337067 TGAAGGGCAGAGCTGTTTTCTGG - Intergenic
969041700 4:4302674-4302696 TGTGGGGCAGAGTCATTCACAGG - Exonic
969380618 4:6794653-6794675 TGAGGAGCAGAGCATTTCGAGGG + Intronic
969533619 4:7742371-7742393 TAAGGGGGAGGGCAGTTCCCAGG - Exonic
972780450 4:42282808-42282830 TGAGAGGCAGAGCAGGTCTTGGG - Intergenic
974368999 4:60989399-60989421 TAAGGGGCAGAGAACCTCACAGG + Intergenic
974674090 4:65068915-65068937 TGAGTGGCACAACAGTTCTCAGG - Intergenic
975498361 4:75058225-75058247 TGAGAGGCAGAACAGCTCTCAGG - Intergenic
975908370 4:79242449-79242471 TGGGTGGCAGAGAAGTTCACTGG - Intronic
976848003 4:89512099-89512121 TGAGGGTCCGAGCAGCTTACAGG - Intergenic
977172389 4:93779483-93779505 TGGGTGGCAGAGCTGCTCACAGG - Intergenic
977516495 4:98026677-98026699 TGGGTGGCAAAGAAGTTCACTGG - Intronic
979207482 4:118057333-118057355 TGGGATGCAGAGCATTTCACAGG + Intronic
982233401 4:153230008-153230030 CGAGGGGGACAGGAGTTCACAGG + Intronic
982941206 4:161558967-161558989 TGAGAAGAAGAGCAGTTCACAGG - Intronic
984169395 4:176343037-176343059 TGAGGGACAGAGCAGCTCAGAGG + Intergenic
984375383 4:178922610-178922632 TGAGTGGCAGAGCAGTTCTCAGG - Intergenic
985850729 5:2387361-2387383 TGCGGTTCAGATCAGTTCACGGG + Intergenic
986495078 5:8333231-8333253 TGAGGAGCTGAGGAGCTCACTGG + Intergenic
988081122 5:26416554-26416576 TGAGTGACAGAGCAGCTCTCAGG + Intergenic
991230915 5:64331592-64331614 TGAGTGGTAGAACAGTTCTCAGG - Intronic
993414207 5:87605896-87605918 TGAGTAGCAGAGCAGTTTCCGGG + Intergenic
996014540 5:118518558-118518580 TGAGGGGCAGAGGGGTTCCTGGG - Intergenic
997562113 5:134855403-134855425 TGCATGGCAGAGCAGTTCATGGG + Exonic
1000962080 5:167611783-167611805 AAAGGGGCAAAGCAGTTCTCTGG + Intronic
1001713268 5:173794723-173794745 TGAGGGTCAGAGAAGTTGGCGGG - Intergenic
1004568655 6:16823591-16823613 GGAGGGGCAGTTCAGTGCACTGG - Intergenic
1005109019 6:22258206-22258228 TGCATGGCAGAGAAGTTCACTGG - Intergenic
1005110814 6:22280026-22280048 TGAGGGCCAGAGTATTTCCCAGG + Intergenic
1005283652 6:24301714-24301736 TGAGGAGCGGGGCTGTTCACAGG - Exonic
1007214825 6:40228807-40228829 TGAGCAGCAGAACAGTTCTCAGG - Intergenic
1007335390 6:41151668-41151690 TGAGGGGTAGAGCAGGTAAAAGG - Intronic
1007607902 6:43129680-43129702 TGAGGGGCAGAGCAGGGCAAAGG - Intronic
1008330610 6:50240468-50240490 TGAGCGGCAGAACAGCTCAGAGG + Intergenic
1011823789 6:91282707-91282729 TGAGGGGTAGAGCATGTCCCAGG + Intergenic
1012122417 6:95384710-95384732 TGAGTGGCAGAGCAGCTCAGAGG - Intergenic
1013857217 6:114588260-114588282 TGAGGGACAGAGCAGCTTAGAGG + Intergenic
1016200057 6:141395386-141395408 TGAGGGACAGAACAGCTCAGAGG - Intergenic
1017440733 6:154462294-154462316 TGAGGGTCAGACAGGTTCACCGG - Intronic
1017440842 6:154463062-154463084 TGAGGGTCAGACAGGTTCACCGG - Intronic
1017961066 6:159221092-159221114 TGAAGGGCACAGCATTCCACAGG + Intronic
1018730800 6:166649023-166649045 TGAAGGGCAGAGCAGTGGAGAGG - Intronic
1018990572 6:168670646-168670668 TGTGGGTCAGAGCAAGTCACAGG + Intronic
1019524254 7:1473713-1473735 TGCGGGGCAGAGCAGCTCGAGGG - Intronic
1019598153 7:1868001-1868023 TGTGGGGCAGGGCAGGGCACTGG - Intronic
1019746127 7:2701328-2701350 TGACTGGCAGAGCTGGTCACTGG + Intronic
1020554557 7:9654866-9654888 TGAATAGCAGAGAAGTTCACTGG + Intergenic
1021056819 7:16059606-16059628 TAAGGGGCAGTGCTGTTCAGAGG - Intergenic
1022036829 7:26542568-26542590 TGAAGGGCAGGGCAGGGCACTGG + Intergenic
1023184265 7:37516598-37516620 TGAGAGGCAAAGCATTTCAACGG - Intergenic
1023254197 7:38296704-38296726 TGAAGAGCTGAGCAGTTCCCAGG + Intergenic
1023575768 7:41624975-41624997 TGAGAGGCAGAGCAGAGCCCTGG + Intergenic
1024767465 7:52676766-52676788 TAAGGGGCAAAGAAGTTCTCTGG + Intergenic
1033071327 7:138205900-138205922 TTAGTGGCAAAGCAGATCACGGG - Intergenic
1033659499 7:143393803-143393825 AGAGGGGCAGGGCAGTCCACAGG + Exonic
1034439867 7:151081120-151081142 GGAGGGGCAGAGGAGTTCCCCGG - Exonic
1035541183 8:439662-439684 GGAGGGGCAGAGCAATGCCCAGG - Intronic
1036238233 8:7060983-7061005 TGAGAGGCAGAGCTGAGCACTGG + Intergenic
1036436066 8:8734593-8734615 GGAGGGGCAGGGCAGTTCTCTGG - Intergenic
1036619991 8:10418471-10418493 GGAGGGGCAGCTCAGTTCATAGG + Intronic
1037427427 8:18771163-18771185 TGGGGGGCAGAGCAGGCCATGGG + Intronic
1037493557 8:19418243-19418265 AGAGGGCCAGAGCAATTCCCTGG - Intronic
1037785169 8:21898639-21898661 TGAGGGGCAGTGGAGCTCCCTGG - Intergenic
1037933497 8:22898787-22898809 TGAGGGGCAGGGCAGGTTGCGGG + Intronic
1038406753 8:27327775-27327797 TGAGGGTCAGAGAAGCTCACCGG - Intronic
1041240989 8:55848918-55848940 TGAAGGGCAGAGCAGCCCCCTGG - Intergenic
1042113379 8:65405338-65405360 TGGAGGTCAGAGCAGTTCACAGG - Intergenic
1042609052 8:70577528-70577550 TGAGAGGCAGAACAGTTCTCAGG - Intronic
1043519127 8:81025633-81025655 GGAGGGGCAGGGCAGTACCCTGG + Intronic
1043702803 8:83312564-83312586 TGAGTGGCAGAACAGTTCTCAGG + Intergenic
1045679652 8:104645101-104645123 AGAGGCTCAGAGCAGCTCACAGG - Intronic
1047608608 8:126498676-126498698 AGAGGGGCATAGCACTTCAAGGG + Intergenic
1048194075 8:132317739-132317761 TTCGGGGCAAAGCACTTCACGGG - Intronic
1049193149 8:141300007-141300029 TGAGGAGAAGAGCAGTTCCACGG - Intronic
1050476465 9:6046023-6046045 TGGGGATCAGAGCAGTTCTCTGG + Intergenic
1051008349 9:12378250-12378272 TGAGGGCCAGGGCAGTTCTTAGG - Intergenic
1051276234 9:15401584-15401606 TGGGTGGTAGAGCAGTTCTCCGG + Intergenic
1051355245 9:16234559-16234581 TGAGTGGCAGAACAGTCCTCAGG - Intronic
1052116049 9:24649418-24649440 TGAGCAGCAGAACAGTTCTCAGG - Intergenic
1052378611 9:27745090-27745112 TGAAGAGCAGAGAACTTCACTGG - Intergenic
1052652342 9:31321099-31321121 TGAGGGACAGAACAGCTCAGAGG + Intergenic
1052704837 9:31982077-31982099 GGAGGGACAGAGCAGTACATTGG + Intergenic
1052865293 9:33461265-33461287 TGGGGGGCAGAGAAGCCCACTGG - Intergenic
1052978287 9:34428353-34428375 TCAGAGTCAGTGCAGTTCACAGG - Intronic
1053393001 9:37749540-37749562 TGAGGGGCAGAGTAGTAATCAGG + Intronic
1053581878 9:39413490-39413512 TGAGAGGCAAAGTAGCTCACAGG + Intergenic
1053586603 9:39465093-39465115 TGTGGGGCAGTGCAGTGCAGGGG + Intergenic
1054103457 9:60972222-60972244 TGAGAGGCAAAGTAGCTCACAGG + Intergenic
1054579704 9:66900133-66900155 TGTGGGGCAGTGCAGTGCAGGGG - Intronic
1057596239 9:96418075-96418097 TGAGGGGCAGAGCGGTGCTCAGG - Exonic
1057867785 9:98694917-98694939 TTAGAGGCAGGGCAGTTCAGTGG - Intronic
1060081049 9:120645657-120645679 TGAGGGCCAGAGCAATTAATTGG + Intronic
1060484211 9:124036986-124037008 TGAGGAGCAGCCCAGGTCACAGG + Intergenic
1060787370 9:126461075-126461097 TGGGTGGCAGAGCTATTCACAGG + Intronic
1060876218 9:127085428-127085450 TGGCAGGTAGAGCAGTTCACTGG + Intronic
1060890188 9:127183216-127183238 GGAGGGGCAAACCATTTCACAGG + Intronic
1061499822 9:130995418-130995440 AGAGGGGCAGGGCAGTGCCCAGG + Intergenic
1061928634 9:133820725-133820747 TGAGGGCCACAGCTGTCCACTGG + Intronic
1061970129 9:134040405-134040427 TGAGGGGCAGAGCAGGGCCCAGG - Intronic
1186223582 X:7374940-7374962 TGAGTGGCAGAACAGTTCTCAGG + Intergenic
1186724394 X:12341597-12341619 TGAGGCACAGAGCAGTTCAGTGG + Intronic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1189332403 X:40152069-40152091 TGGGGTGGAGAGAAGTTCACTGG + Intronic
1189592566 X:42530615-42530637 GGAGGGACAGAGCAATTAACAGG - Intergenic
1189723661 X:43946921-43946943 TGAGGGCAAGATCAGTTTACAGG + Intergenic
1194212250 X:91082923-91082945 TGAGCAGCAGAACAGTTCTCAGG - Intergenic
1200235082 X:154464251-154464273 TGAGGGGCAGAGCAGTTCACCGG - Exonic
1200785819 Y:7259487-7259509 TGAGGGGCAGACCAGCTAGCAGG + Intergenic
1201133124 Y:10969838-10969860 TGAGGTGCAGTGCAGTGCAGTGG - Intergenic
1201593109 Y:15637190-15637212 TGAGTGGCAGAACAGTTCTAGGG + Intergenic