ID: 1200235859

View in Genome Browser
Species Human (GRCh38)
Location X:154467450-154467472
Sequence GGGCTCCCACGTGGTGCTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 147}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200235851_1200235859 12 Left 1200235851 X:154467415-154467437 CCGCTGGGGCCCTCTGGCGTGCT 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1200235859 X:154467450-154467472 GGGCTCCCACGTGGTGCTGAAGG 0: 1
1: 0
2: 2
3: 17
4: 147
1200235844_1200235859 30 Left 1200235844 X:154467397-154467419 CCTGATCCCAGCTTTGAGCCGCT 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1200235859 X:154467450-154467472 GGGCTCCCACGTGGTGCTGAAGG 0: 1
1: 0
2: 2
3: 17
4: 147
1200235848_1200235859 24 Left 1200235848 X:154467403-154467425 CCCAGCTTTGAGCCGCTGGGGCC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1200235859 X:154467450-154467472 GGGCTCCCACGTGGTGCTGAAGG 0: 1
1: 0
2: 2
3: 17
4: 147
1200235853_1200235859 3 Left 1200235853 X:154467424-154467446 CCCTCTGGCGTGCTGGACGTCAA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1200235859 X:154467450-154467472 GGGCTCCCACGTGGTGCTGAAGG 0: 1
1: 0
2: 2
3: 17
4: 147
1200235849_1200235859 23 Left 1200235849 X:154467404-154467426 CCAGCTTTGAGCCGCTGGGGCCC 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1200235859 X:154467450-154467472 GGGCTCCCACGTGGTGCTGAAGG 0: 1
1: 0
2: 2
3: 17
4: 147
1200235854_1200235859 2 Left 1200235854 X:154467425-154467447 CCTCTGGCGTGCTGGACGTCAAA 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1200235859 X:154467450-154467472 GGGCTCCCACGTGGTGCTGAAGG 0: 1
1: 0
2: 2
3: 17
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200235859 Original CRISPR GGGCTCCCACGTGGTGCTGA AGG Exonic