ID: 1200235976

View in Genome Browser
Species Human (GRCh38)
Location X:154467882-154467904
Sequence GGCCACCAGCACGGCTGTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200235976_1200235980 2 Left 1200235976 X:154467882-154467904 CCATCACAGCCGTGCTGGTGGCC 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1200235980 X:154467907-154467929 CAAGCGCAAGACTCAGGACGCGG 0: 1
1: 0
2: 1
3: 8
4: 65
1200235976_1200235978 -4 Left 1200235976 X:154467882-154467904 CCATCACAGCCGTGCTGGTGGCC 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1200235978 X:154467901-154467923 GGCCTACAAGCGCAAGACTCAGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200235976 Original CRISPR GGCCACCAGCACGGCTGTGA TGG (reversed) Exonic
900162840 1:1232448-1232470 GGCCACCAGCACTGCCAGGAAGG - Exonic
900242447 1:1623522-1623544 GGCCAGCAGGACGGCGGCGAGGG + Exonic
900458238 1:2787568-2787590 GGCCACCAGCAGGGCCTTGTGGG + Exonic
900461267 1:2803100-2803122 GCCCATCGGCACTGCTGTGATGG - Intergenic
900507922 1:3038936-3038958 GGACCCAAGCACGGCTGTGGTGG - Intergenic
900526187 1:3129983-3130005 GGCGACCAGCTGGGCTGGGAGGG + Intronic
900753451 1:4415975-4415997 GGTCCCCAGCACAGCTGTGTGGG + Intergenic
901647096 1:10722693-10722715 AGCCACCACCACGGCTCTGCTGG - Intronic
901647607 1:10725059-10725081 AGCCACCTGCACGTCTGCGAGGG - Intronic
901762572 1:11480120-11480142 GGCCGGCAGCAGGGCTGGGAAGG + Intronic
906240997 1:44242240-44242262 GGCCACCTTCAGGGCTGGGAGGG - Intronic
906460058 1:46030081-46030103 GGCCACCAGCAGGGCTCTGAAGG + Intronic
908807622 1:67947265-67947287 AGCCGCCAGCAGGGCTGTGTAGG + Intergenic
913534357 1:119757174-119757196 GACCACCAGCACCCCTGTGGGGG - Intronic
915075592 1:153306134-153306156 GGCCCCCAGCACCCCTGGGATGG - Intronic
917830001 1:178872470-178872492 GGCCACAAGCACAGCTGAGAAGG - Intronic
920594832 1:207258911-207258933 GGCCACCATCACTACTGTGCTGG + Intergenic
923433695 1:233948931-233948953 GGCCCCCTGTAAGGCTGTGAGGG - Intronic
924432299 1:244007508-244007530 GACCACCTGCATGACTGTGAGGG + Intergenic
1065089750 10:22219978-22220000 GGGCACCAGCATCTCTGTGAAGG + Intergenic
1068663305 10:59646660-59646682 GCCCACCAGCACTGTTGTGTAGG + Intergenic
1069624142 10:69857043-69857065 GGCCTCCAGCACGGGTCAGAGGG - Intronic
1069994427 10:72333753-72333775 GCCCACCAGCGCTGCTGAGAGGG + Exonic
1071282393 10:84114456-84114478 GACCACCCCCACGGCTGTAAAGG + Intergenic
1071672893 10:87626608-87626630 GGCACCCAGGAAGGCTGTGAAGG - Intergenic
1073128516 10:101168942-101168964 GGCTAACAGCACTGCAGTGAAGG + Intergenic
1075091105 10:119444571-119444593 GGTCCCCAGCACAGCTGTGCTGG + Intronic
1075437853 10:122458841-122458863 AGCCACCAGCATGGCTCTCAGGG + Intergenic
1075465074 10:122645043-122645065 AGCCACCAACACGTCTGGGAAGG - Intergenic
1075721280 10:124589009-124589031 CCCCAGCAGCGCGGCTGTGAGGG + Intronic
1076726607 10:132416879-132416901 GGCCCACAGCCCGGCTGTGCTGG - Intronic
1076743133 10:132497990-132498012 GGCCATCAGCCAGGCGGTGATGG + Intergenic
1077234577 11:1473826-1473848 GCACAGCAGCACGGGTGTGAGGG - Intronic
1077606652 11:3616929-3616951 GGCCAACAGCACATCGGTGAGGG - Intergenic
1081259964 11:40947630-40947652 GGTCACCAGAACAGCTGAGAAGG + Intronic
1083326985 11:61877912-61877934 AGCTCCCAGCAGGGCTGTGATGG + Intronic
1083544648 11:63539133-63539155 GGCCAGGAGCAAGGCTGGGAAGG - Intronic
1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG + Intronic
1090233641 11:125129192-125129214 GGCGGCCAGCATGGCTGGGATGG - Intergenic
1091283223 11:134394070-134394092 GCCCCCCAGCAGGGCTGTGGTGG - Intronic
1091704569 12:2685221-2685243 GGTGAACAGCAGGGCTGTGAGGG - Intronic
1091711139 12:2741558-2741580 GGTGAACAGCAGGGCTGTGAGGG - Intergenic
1092855551 12:12670085-12670107 AGCCACCAGCATGACTGTGTGGG + Intronic
1095779923 12:46048384-46048406 AGCCAGCAGCATGGCTGTGCAGG + Intergenic
1096961487 12:55582342-55582364 AGCCGCCAGCACTGCTGTCAAGG + Intergenic
1098131149 12:67351822-67351844 GGACACCATCAAGGCTGTGCTGG + Intergenic
1101717903 12:107326960-107326982 TCCCACCAGCACAGCTGAGAGGG - Intronic
1104891381 12:132141791-132141813 GGCCACCTGCAGGGCTGAGCAGG + Intronic
1105417124 13:20223205-20223227 GGCCACCAGCAGCGCTGGGGTGG + Exonic
1105813225 13:24012073-24012095 GGGCCCCAGCAAGGATGTGAGGG + Intronic
1105814756 13:24024540-24024562 GGCCACCAGCAGGGCCCTGGTGG - Intronic
1105896143 13:24718664-24718686 GGCCTGCAGCGCGGCTGTGAGGG + Intergenic
1108595649 13:51946355-51946377 GGCCACGCCCACGGCTGTCATGG - Exonic
1109191362 13:59327781-59327803 GGCCACCATTATGACTGTGATGG + Intergenic
1110993162 13:82069662-82069684 ACCCAGCAGCATGGCTGTGAAGG - Intergenic
1119032137 14:71200980-71201002 GGACACCAGCAAGGATGAGAGGG + Intergenic
1119328216 14:73774855-73774877 GGCCACCTGAGGGGCTGTGAGGG - Intronic
1119597804 14:75952355-75952377 GCCCACCAGAATGGCTGTAATGG + Intronic
1122517765 14:102320306-102320328 AGCCCCCAGCAGGGCTGTGAAGG - Intronic
1123880565 15:24675320-24675342 GGTCACCAGCCAGGCCGTGAGGG - Intergenic
1124202785 15:27692809-27692831 GGCCACTAGCTCCGATGTGAAGG + Intergenic
1125721335 15:41846539-41846561 GCCCACCTGCAGGGCTGTGGGGG + Intronic
1125889665 15:43256255-43256277 GGGCATCATCACTGCTGTGATGG + Intronic
1127096131 15:55513844-55513866 GACCACCCCCACGGCTGTAAAGG - Intergenic
1127520626 15:59740009-59740031 GGTCACCAGGCCAGCTGTGAGGG + Intergenic
1128336497 15:66789224-66789246 TGCCACCAGCAGGGGTGTGGGGG - Intergenic
1129327664 15:74809690-74809712 GTCCACCAGTGTGGCTGTGAAGG + Intergenic
1132302731 15:100786586-100786608 AGCCTCCAGCACAGCTGTTAGGG + Intergenic
1132608297 16:802583-802605 GGCCACCAGGACAGGTGAGACGG + Intergenic
1132832011 16:1933045-1933067 GGCCCCCAGCAGGGCAGAGATGG + Intergenic
1132845708 16:1999937-1999959 GCCCACCAGGAAGGCTGGGAAGG - Exonic
1132943528 16:2520158-2520180 GGCCACGGGCCCGGCGGTGAGGG - Exonic
1136545643 16:30953255-30953277 AGCCACCAGCACGGTGGTGCAGG - Exonic
1137665372 16:50246296-50246318 GGCCACCCGCCCGCCTGTGTGGG - Intronic
1137757992 16:50917974-50917996 GGACACCAGCCAGGCTGGGAAGG - Intergenic
1139921555 16:70463719-70463741 AGCCACCAGCAGGGCGTTGAGGG - Exonic
1139962030 16:70723696-70723718 GGCAACCAGCAGGGCTGGTAGGG - Intronic
1141533025 16:84659803-84659825 GGCCACCAGCATGTCTTCGATGG - Exonic
1141774865 16:86116496-86116518 GGCCACAAGCCAGGGTGTGATGG + Intergenic
1142146469 16:88494877-88494899 AGCCACCAGCCCGGATGCGAAGG + Intronic
1142621857 17:1170309-1170331 CCCCACCAGCACCGCTGTGAAGG + Intronic
1147993473 17:44349190-44349212 AGCCACCAGCCCTGCTGTTAAGG - Exonic
1149567373 17:57649778-57649800 GGCCAGGAGGACGGCTGTGCAGG + Intronic
1149651684 17:58279920-58279942 AGCCACCAGGACGGCGGTGAGGG - Exonic
1149779109 17:59382224-59382246 GGCCACCAGGACAGCCCTGAGGG + Intronic
1149850775 17:60032345-60032367 TGCAACCAGGCCGGCTGTGAAGG - Intergenic
1149859391 17:60114179-60114201 TGCAACCAGGCCGGCTGTGAAGG + Intergenic
1150139607 17:62716987-62717009 GGCCACCAGCCTGGCCGTGGAGG - Intronic
1151297613 17:73197016-73197038 GGCCAGCAGGAAGTCTGTGAGGG - Exonic
1151679366 17:75615494-75615516 CGGCACCACCATGGCTGTGAGGG - Intergenic
1160149629 18:76389152-76389174 TGCCACCTGCAAGGCTGTCATGG - Intronic
1160753519 19:746618-746640 GACCACCAGCTCCGCCGTGATGG - Exonic
1160890770 19:1377697-1377719 TGTCACCAGCACTGCTGTGTAGG - Exonic
1161201813 19:3019392-3019414 GCCCACCAGCCCGGCTGGGCGGG + Exonic
1161771683 19:6234226-6234248 GGGCTCCAGCACAGCTGTGGTGG + Intronic
1162960805 19:14125252-14125274 AGACACCAGGACGGCTATGATGG - Intronic
1163012561 19:14434581-14434603 GGCCATCAGCAGGACTGGGAAGG - Intronic
1163340665 19:16704775-16704797 GGCCACTAGCTTGGCTGTGGAGG + Intergenic
1167581889 19:50349737-50349759 GACCACTCCCACGGCTGTGAAGG - Intronic
1168235520 19:55060684-55060706 GTGCACCACCACGCCTGTGAAGG - Intronic
1168645731 19:58057913-58057935 GGCCACCATCAGGGCTGAGCAGG + Intergenic
925018892 2:553371-553393 GGCCAGCAGGACAGATGTGAAGG - Intergenic
925634445 2:5929161-5929183 GGACACCACCATGGCTGTGCTGG - Intergenic
925859293 2:8159545-8159567 GCCCCCCAGCAAGGCTGGGAGGG - Intergenic
927153515 2:20209082-20209104 GGAGACCAGCATGGCTGAGATGG - Intronic
927797309 2:26061485-26061507 GGCAGCCAACACGGCTGTGGTGG - Intronic
929533133 2:42764585-42764607 GGCCACCAGCAGGGCGGTGGAGG - Intergenic
930396245 2:50828124-50828146 GGCCACCACCCCGTCTGGGAGGG - Intronic
931283606 2:60814631-60814653 GGCCAACAGCAAGGCTGTGCAGG - Intergenic
931788744 2:65644702-65644724 TGGTACCAGCACGGCAGTGATGG - Intergenic
932113303 2:69021526-69021548 TGCCACCATCAAGGCTGCGAGGG + Intronic
932276595 2:70456386-70456408 GACCACCACCAAGGCGGTGATGG + Exonic
933836748 2:86251968-86251990 GGCCGCCACAGCGGCTGTGATGG - Exonic
937218630 2:120328639-120328661 GGCCACCAGCAAGGGTATGGCGG - Intergenic
946888285 2:224246613-224246635 GGCCAAGATCAGGGCTGTGATGG - Intergenic
947739293 2:232477787-232477809 GGACATCAGCCTGGCTGTGAAGG - Intergenic
948865467 2:240772712-240772734 GGCCACAAGCAGGGTGGTGAAGG + Intronic
1170891376 20:20378887-20378909 GTCCACCAGCACCACTGTAAGGG - Intergenic
1171180069 20:23085360-23085382 TGCCACCAGGACTGCTTTGAAGG - Exonic
1171365034 20:24617696-24617718 GGCCAGGAGCACAGCTGAGAAGG - Intronic
1176059519 20:63166291-63166313 GGCCTCCACCAGGGCTGTGCGGG + Intergenic
1176089506 20:63312673-63312695 GGGCACCCGGACGGGTGTGATGG + Intronic
1176203520 20:63875530-63875552 GGGCAACAGCACTGCTGTGGGGG - Intronic
1176373741 21:6077269-6077291 GGTCAGCAGCACGGCAGTGGGGG - Intergenic
1178409365 21:32350848-32350870 TGCCTGCAGCAGGGCTGTGAAGG + Exonic
1178447884 21:32662041-32662063 GACCACCCCCACGGCTGTAAAGG + Intronic
1178861745 21:36295666-36295688 GGACACGAGCGCGGCTGGGAGGG - Intergenic
1179749736 21:43460974-43460996 GGTCAGCAGCACGGCAGTGGGGG + Intergenic
1179856028 21:44162819-44162841 GGCCGCAAGCACAGCTGTGTGGG - Intergenic
1180039697 21:45269263-45269285 GGCCACCACCCCGTCTGGGAGGG + Intronic
1180189006 21:46153892-46153914 GGCCACCTTCACGGCTGGGTGGG - Intronic
1181051664 22:20240951-20240973 GACCACCAGCAGCGGTGTGAGGG + Intergenic
1181055939 22:20260547-20260569 AGCTACCAGCACGGCTGTCGAGG - Intronic
1181265492 22:21628658-21628680 CGCCATCAGCTCGGCTGTCAGGG + Exonic
1181594053 22:23902944-23902966 GGCCTCCACCACAGTTGTGAGGG - Intergenic
1181693946 22:24583598-24583620 GACCACCAGCAAGGCTGTCGAGG - Intronic
1182776222 22:32833221-32833243 GGCCCCCAGCAAGACTGAGATGG + Intronic
1184054049 22:42032399-42032421 GACCAACAGCACAGCTGAGAGGG - Intronic
1184176383 22:42791871-42791893 GGCCCCCAGCCTGGCTGAGACGG - Intergenic
951165859 3:19484636-19484658 GACCACCCCCACGGCTGTAAAGG - Intronic
954274336 3:49532614-49532636 GGCCACAAGCATCACTGTGACGG + Exonic
954762574 3:52887357-52887379 GTCCACCAGCCAGGCTGTGCTGG - Intronic
955066442 3:55537209-55537231 GGCACCCAGCATGGCTGTGAGGG - Intronic
955627330 3:60932368-60932390 GACCACCAGCAGGGCAGAGAAGG - Intronic
958960087 3:100501451-100501473 GGACACCAGCTCACCTGTGAGGG - Intronic
960044834 3:113186657-113186679 GGATACCAGCATCGCTGTGAAGG + Intergenic
961490476 3:127253841-127253863 GGGCACCAGCAGGGTTGAGAAGG - Intergenic
961497801 3:127306850-127306872 GGCCAGCAGGACAGCTGTGGTGG + Intergenic
962241970 3:133757357-133757379 GCCCCTCAGCCCGGCTGTGAGGG + Intronic
964522233 3:157581928-157581950 GACCACCCCCACGGCTGTAAAGG - Intronic
967270925 3:187731773-187731795 GGGCAACATCATGGCTGTGATGG - Exonic
967788641 3:193523782-193523804 GACCCCCAGTACGGCTGTGTTGG + Intronic
968545207 4:1194686-1194708 GGCCACCAGCGAGGCTGGGGAGG - Intronic
968705463 4:2075510-2075532 GGCCACCAGCCTGGCAGGGAGGG + Exonic
968705484 4:2075570-2075592 GGCCACCAGCCTGGCAGGGAGGG + Intronic
969867708 4:10086369-10086391 GGGCAGCAGCACTGCTGAGAGGG - Intronic
985491156 5:180474-180496 GGCCACCAGCAGTGCCCTGAGGG + Intronic
985543397 5:497451-497473 GGGCACCGGGACTGCTGTGAAGG + Intronic
986416514 5:7534254-7534276 AGCCACCAGCATGGGTGTGATGG - Intronic
986706287 5:10457251-10457273 CGCCACCAGCACTGCTGGCATGG + Intronic
987193339 5:15500692-15500714 GGCAAACAGTACGGCAGTGAGGG + Exonic
997396289 5:133562599-133562621 GGCTTCTAGCAAGGCTGTGAGGG - Intronic
1001555000 5:172631158-172631180 TGACACCAGCTGGGCTGTGATGG + Intergenic
1002450818 5:179317582-179317604 GGCCAGCAGCACTGCAGTGTTGG + Intronic
1002468097 5:179417830-179417852 GGCCAGCAGCACGGGTGGCATGG + Intergenic
1003283566 6:4714546-4714568 GGCCAGCAGCAGTGCTGTGATGG - Intronic
1004536677 6:16509868-16509890 GGCCACCCGTATGCCTGTGATGG - Intronic
1005926726 6:30451301-30451323 GGCGAGCAGCTCGGCTCTGAGGG - Intergenic
1014546727 6:122744219-122744241 GACCACCCCCACGGCTGTAAAGG - Intergenic
1017385930 6:153883207-153883229 GGCACCCAGGATGGCTGTGAAGG - Intergenic
1018176164 6:161181184-161181206 GGGCCCCAGCAACGCTGTGAAGG + Intronic
1019602117 7:1889968-1889990 GCCCACCCACAGGGCTGTGAAGG + Intronic
1019653364 7:2172772-2172794 GGCAGCCAGCAGGGCTGGGATGG - Intronic
1020111567 7:5450918-5450940 AGCCCCCAGCAAGGCTGGGATGG + Intronic
1023937431 7:44749431-44749453 GCCCACCAGCACGGCGATGTGGG + Intronic
1028567268 7:92246426-92246448 GGTCACCAGCTCGGCTGTAGAGG + Exonic
1029732311 7:102446583-102446605 GGCCACCAGCACCGTGGTGCAGG - Exonic
1033664919 7:143431310-143431332 GGCCACCAGGAGGACTGTAAAGG - Intergenic
1037185321 8:16056041-16056063 TGTCACCAGCACAGCTTTGATGG + Intergenic
1037811732 8:22090405-22090427 GGTCAACAGCAGGGCTGGGAAGG - Intronic
1039311589 8:36322445-36322467 GGCCACCAGCCTGGCTGCGCAGG + Intergenic
1040096336 8:43446968-43446990 AGCCACCATCACAGCTGAGAAGG - Intergenic
1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG + Intergenic
1044941230 8:97345971-97345993 GGCCAGCAGCACAGCTGGGTGGG - Intergenic
1046012935 8:108572528-108572550 TGCCACCAGCACAGCGGTGCTGG + Intergenic
1048985392 8:139732189-139732211 GTCCACCAGCACATCTGTAAGGG + Exonic
1049707055 8:144047866-144047888 GGCAACGAGGCCGGCTGTGATGG + Intergenic
1049772731 8:144391253-144391275 TGGCACCAGCGTGGCTGTGAAGG + Exonic
1050409494 9:5348044-5348066 GGCCACCAGCATTGGGGTGAGGG + Intergenic
1051499476 9:17761445-17761467 TGTCACCAGCAGGGCTGTGATGG + Exonic
1051834634 9:21321673-21321695 GGACTCCAGCCTGGCTGTGAAGG + Intergenic
1056571900 9:87824354-87824376 GGCCACCAGCCCCGCTACGAAGG - Intergenic
1057849643 9:98555490-98555512 TGTCACCTGCACAGCTGTGAGGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060545778 9:124458246-124458268 CGCCACCTGGAGGGCTGTGAGGG + Intronic
1061726270 9:132583552-132583574 GTCCACCAGCACTGCTGGAAGGG - Intronic
1062462056 9:136666189-136666211 AGCCAGCAGCGCGGCTGGGAGGG + Intronic
1062524506 9:136972796-136972818 GGGCACCAGCGAGGCTGGGATGG - Intergenic
1062599224 9:137312503-137312525 GGCCACCAGCCAGGCTGTCCTGG + Intronic
1062707836 9:137955018-137955040 GGTCACCATGACGGCTGTGAAGG + Intronic
1187332949 X:18356736-18356758 GGGCACCAGCAGGGCTGAGGAGG + Intergenic
1190947904 X:55113843-55113865 GGACACCAGCACTAATGTGAAGG + Intronic
1194384550 X:93236915-93236937 GACCACCCCCACGGCTGTAAAGG + Intergenic
1195697758 X:107679298-107679320 GGCCAGCAGCAGGGCTGAGATGG + Intergenic
1198029533 X:132741578-132741600 GGCCAACAGCATGGGTTTGAGGG + Intronic
1200235976 X:154467882-154467904 GGCCACCAGCACGGCTGTGATGG - Exonic
1200239389 X:154486010-154486032 GGCCACCCCCACGGCGGTGGAGG - Intronic
1201018173 Y:9625391-9625413 GGGCACCATCGCGGCTGTGGTGG - Intergenic
1201297240 Y:12474362-12474384 GACCACCCCCACGGCTGTAAAGG - Intergenic