ID: 1200238080

View in Genome Browser
Species Human (GRCh38)
Location X:154478759-154478781
Sequence GGGCAGAGACGCCGCGTCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 91}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200238080_1200238092 23 Left 1200238080 X:154478759-154478781 CCGCAGACGCGGCGTCTCTGCCC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1200238092 X:154478805-154478827 AGCTCCACCGGCCGGAGCTGCGG 0: 1
1: 0
2: 1
3: 6
4: 131
1200238080_1200238090 11 Left 1200238080 X:154478759-154478781 CCGCAGACGCGGCGTCTCTGCCC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1200238090 X:154478793-154478815 GTGCGCTGGGGGAGCTCCACCGG 0: 1
1: 0
2: 1
3: 15
4: 125
1200238080_1200238087 -1 Left 1200238080 X:154478759-154478781 CCGCAGACGCGGCGTCTCTGCCC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1200238087 X:154478781-154478803 CGGACCTGGCGCGTGCGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 66
1200238080_1200238086 -2 Left 1200238080 X:154478759-154478781 CCGCAGACGCGGCGTCTCTGCCC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1200238086 X:154478780-154478802 CCGGACCTGGCGCGTGCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 48
1200238080_1200238084 -3 Left 1200238080 X:154478759-154478781 CCGCAGACGCGGCGTCTCTGCCC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1200238084 X:154478779-154478801 CCCGGACCTGGCGCGTGCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 107
1200238080_1200238088 0 Left 1200238080 X:154478759-154478781 CCGCAGACGCGGCGTCTCTGCCC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1200238088 X:154478782-154478804 GGACCTGGCGCGTGCGCTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 159
1200238080_1200238091 15 Left 1200238080 X:154478759-154478781 CCGCAGACGCGGCGTCTCTGCCC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1200238091 X:154478797-154478819 GCTGGGGGAGCTCCACCGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200238080 Original CRISPR GGGCAGAGACGCCGCGTCTG CGG (reversed) Exonic
900160990 1:1223734-1223756 GGGCAGACAGGCCCTGTCTGAGG - Intronic
900515607 1:3080836-3080858 GGTCGGAGACGCCGAGTCTCTGG - Intronic
900525283 1:3125492-3125514 GGGCAGAGTCGCCGGCTCAGCGG + Intronic
906422949 1:45686436-45686458 GGGACTAGACGCTGCGTCTGAGG + Exonic
907278089 1:53327956-53327978 GGGCTGAGACGCGGCGGCGGCGG - Exonic
917456883 1:175193079-175193101 GGGGAGGGAGGGCGCGTCTGGGG - Intergenic
919949427 1:202348883-202348905 GGGCAGAGTCGGCGCGAATGCGG + Exonic
920399796 1:205669721-205669743 GGGGAGAGGAGCCGCTTCTGAGG - Intronic
922815670 1:228447096-228447118 GTGCGAAGACGCCGCGTCTAAGG + Intergenic
1069615961 10:69806319-69806341 GGGCAGAGACTGCGTGTATGAGG + Intronic
1069892835 10:71662626-71662648 GGGGACAGACACCGTGTCTGAGG - Intronic
1071802590 10:89080335-89080357 GGCCAGAGATGCTGCTTCTGTGG - Intergenic
1074182618 10:111077421-111077443 GGCCAGAACCGCAGCGTCTGGGG + Exonic
1074618488 10:115093482-115093504 GGTCCGGGACGCCGCGGCTGTGG + Intronic
1076798187 10:132808888-132808910 GGTCTGAGAAGCCTCGTCTGTGG + Exonic
1092187771 12:6493747-6493769 GGCCAGAGACGTCGCGTCCCTGG - Exonic
1092727597 12:11500324-11500346 TGGCAGTGACGCGGCGCCTGCGG + Intronic
1096786577 12:54020246-54020268 GGGCAGAGACACTGAATCTGTGG + Intronic
1103702757 12:122856217-122856239 GGGCAGTGATGCCCCGTGTGGGG - Intronic
1104917559 12:132273788-132273810 GGGCAGAGGCGACGCAGCTGGGG + Intronic
1113594833 13:111523796-111523818 GGGGAGAGATGCTGCTTCTGTGG - Intergenic
1114499029 14:23154410-23154432 GGGCAGGGAAGCCGGGCCTGTGG + Intronic
1121779062 14:96610142-96610164 GAGCAGAAACGCTGGGTCTGAGG + Intergenic
1122873189 14:104650751-104650773 GGGCAGAGCCGCTGGGTCTGGGG + Intergenic
1130979277 15:88802093-88802115 GGGCAGTGAAGCCCCGTCGGAGG - Intergenic
1131060304 15:89400188-89400210 GGGCACAGGCGCCGCGCCGGCGG - Intergenic
1131108750 15:89751231-89751253 TGGCAGCGGCGGCGCGTCTGGGG + Exonic
1132498823 16:275852-275874 GGGCGCAGATGCCGCATCTGAGG - Exonic
1132679099 16:1132449-1132471 GGGCAGAACCGCCGGGTCTGGGG + Intergenic
1132700809 16:1221263-1221285 CAGGAGAGAAGCCGCGTCTGTGG + Exonic
1133131776 16:3680571-3680593 GGGCACAGACGCCTCTCCTGCGG + Intronic
1133138139 16:3726264-3726286 GGGAAGAAGCGCCGCCTCTGGGG + Exonic
1133306307 16:4811842-4811864 GGACAGAGAAGCCCTGTCTGTGG - Intronic
1136498427 16:30658125-30658147 GGGCGGAGACGCGGGGCCTGAGG - Intergenic
1142225695 16:88876648-88876670 GGGCAGAGCCGCCGCGCCTGCGG + Exonic
1142671290 17:1488421-1488443 TGGGAAAGACGCCGCGGCTGAGG + Intronic
1148779309 17:50112602-50112624 GGGCAGAGAGGCCAGGGCTGAGG - Intronic
1148857252 17:50585536-50585558 GGGCAGAGAGGCAGTGACTGTGG + Intronic
1151348806 17:73519433-73519455 GGGCAGACAGGCCCCGTCTGGGG - Intronic
1152879881 17:82808684-82808706 GGGCAGAGAGGCCCCTGCTGTGG + Intronic
1153457673 18:5296935-5296957 AGGCACAGCCGCCGCGTCAGAGG - Intronic
1153911432 18:9708831-9708853 GGGCAGTGGCGGCGAGTCTGGGG + Intronic
1160828300 19:1090849-1090871 CGGCAGAGATGCAGCGTTTGTGG - Intronic
1160834813 19:1119660-1119682 GGGCCCAGAGGCCGCGTCAGGGG + Intronic
1160914092 19:1488470-1488492 CGGCAGCAACGACGCGTCTGTGG - Intronic
1160921721 19:1523928-1523950 CGGCGGGGACGCCGCGGCTGGGG - Intergenic
1160930949 19:1569071-1569093 GGGCACAGAGACCGGGTCTGTGG - Intergenic
1164780001 19:30884475-30884497 GGGGAAAGAGGCCGCCTCTGGGG + Intergenic
1165850918 19:38849922-38849944 GGGCGGAGAAGCGGCGTCGGCGG - Exonic
1166827111 19:45616542-45616564 GGCCAGGTACGCCCCGTCTGGGG + Exonic
1167426567 19:49432690-49432712 GGGCAGAGACGCCGAGCCGGCGG - Intronic
1168719057 19:58544888-58544910 GGGCGACGACGCCGCGGCTGAGG - Exonic
927808708 2:26170209-26170231 GGACAGAGACGCCACATCTACGG - Intergenic
932305141 2:70696553-70696575 GGGCACAGACGTCGATTCTGTGG - Intronic
937314641 2:120923895-120923917 GGGCAGAGAGGCAGCCTCAGTGG + Intronic
938074003 2:128322439-128322461 GGGAAGACCTGCCGCGTCTGCGG - Intergenic
942947319 2:181684299-181684321 GGGCGGAGGCGCCGCGTCGGCGG - Intergenic
946188181 2:217993453-217993475 GAGAACAGACGCCGCTTCTGCGG + Intronic
946310464 2:218880229-218880251 TGGCAGAGACGCAGCTGCTGGGG - Intergenic
946327460 2:218992275-218992297 GGGCAGAGAGGGTGCGGCTGGGG - Intronic
947533228 2:230925805-230925827 GGACAGAGAAGCCGAGGCTGGGG - Intronic
949000491 2:241610299-241610321 GGGCGGAGATGCGGCGCCTGAGG - Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1175247292 20:57589788-57589810 GGGCAGAGGTACCACGTCTGGGG + Intergenic
1175783732 20:61699290-61699312 GGGCAGAGAGGCAGGGTCTGTGG + Intronic
1176163594 20:63661381-63661403 GGGCAGAGATGCCGTCTCGGAGG - Exonic
1176705827 21:10119593-10119615 TGGCGGCGACGCCGCGGCTGCGG + Intergenic
1180025942 21:45162176-45162198 GGGCAGTGACGCCCCCTTTGGGG + Intronic
1180949546 22:19714931-19714953 GGGCAGTGCCGCCGCGCCTGGGG + Intronic
1181521855 22:23452818-23452840 GGGCACAGAGGCCGGGGCTGTGG - Intergenic
1182698176 22:32210144-32210166 GGACAGAGACGCAAGGTCTGGGG + Intergenic
1184612406 22:45613146-45613168 GGGCAGAGACACCGTTTCCGTGG + Intergenic
1185367927 22:50445482-50445504 GGGCAGAGACTCGGCCTCTGGGG - Exonic
950583418 3:13877911-13877933 GGGTAGAGCCGTCACGTCTGGGG + Intronic
951168635 3:19512113-19512135 GAGCAGAGAAGCCATGTCTGGGG + Intronic
953055336 3:39383460-39383482 GAGCAGAGCCGCGGAGTCTGCGG + Exonic
961081800 3:124033857-124033879 TGTCCGAGACGCCGCGTCCGAGG - Intergenic
961517717 3:127448636-127448658 GGGCTGAGACTCCGGGTGTGTGG - Intergenic
961723174 3:128909247-128909269 AGGCAGAGATGCCCCATCTGGGG - Intronic
969541544 4:7793743-7793765 GTGCAGAGCCTCCGGGTCTGTGG + Exonic
980354556 4:131724951-131724973 TGGCGGAGACGCGGCGGCTGCGG - Intergenic
985108419 4:186521425-186521447 GGGCAGAGAAGCGGGGTATGTGG - Intronic
1005069963 6:21852549-21852571 AGGCAGAGACGCTCCGGCTGAGG + Intergenic
1018963611 6:168466436-168466458 GGGCAGATCAGCCGCTTCTGTGG + Intronic
1019347823 7:539276-539298 GGGCAGAGGCACCACCTCTGGGG + Intergenic
1019589482 7:1823667-1823689 GGGCACAGAGGCCGGGCCTGTGG + Intronic
1032419650 7:131767855-131767877 GAGCAGGGACGCAGCCTCTGCGG - Intergenic
1034899443 7:154898469-154898491 GACCAGAGCCGCCGTGTCTGCGG + Intergenic
1035315780 7:157997084-157997106 GGGCAGACACCCCACGTCAGGGG - Intronic
1039725085 8:40206810-40206832 GTGCTGAGAGGCAGCGTCTGCGG + Intergenic
1049194947 8:141309874-141309896 GGGCACAGAGGACGTGTCTGGGG + Intergenic
1049610646 8:143553317-143553339 GGGCAGAGGCGCCCCCTCTGAGG + Exonic
1049780224 8:144425483-144425505 GGGCAGAGGCGCAGCTCCTGGGG - Intronic
1052806721 9:33019976-33019998 TAGCAGAAACGCAGCGTCTGTGG - Intronic
1056691995 9:88815715-88815737 GAGCAGACACTCCGCTTCTGGGG - Intergenic
1057003632 9:91536022-91536044 GCGCAGACACGCAGCATCTGGGG + Intergenic
1060484985 9:124041103-124041125 GAGCTGGGACGCCGGGTCTGGGG + Intergenic
1062441139 9:136570394-136570416 GTCCAGAGACGCTGTGTCTGTGG - Intergenic
1062542634 9:137048417-137048439 GGGCAGAGACGCTGAGGGTGGGG + Exonic
1202790861 9_KI270719v1_random:89682-89704 TGGCGGCGACGCCGCGGCTGCGG + Intergenic
1203779275 EBV:91831-91853 GGGCCGAGGCCCCGCGCCTGCGG - Intergenic
1200238080 X:154478759-154478781 GGGCAGAGACGCCGCGTCTGCGG - Exonic