ID: 1200239491

View in Genome Browser
Species Human (GRCh38)
Location X:154486390-154486412
Sequence GCCCACGCGTCCGCCCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200239485_1200239491 -2 Left 1200239485 X:154486369-154486391 CCGCGGCCCCCAGACGGCGAAGC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1200239491 X:154486390-154486412 GCCCACGCGTCCGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 71
1200239487_1200239491 -9 Left 1200239487 X:154486376-154486398 CCCCAGACGGCGAAGCCCACGCG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1200239491 X:154486390-154486412 GCCCACGCGTCCGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 71
1200239484_1200239491 -1 Left 1200239484 X:154486368-154486390 CCCGCGGCCCCCAGACGGCGAAG 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1200239491 X:154486390-154486412 GCCCACGCGTCCGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 71
1200239488_1200239491 -10 Left 1200239488 X:154486377-154486399 CCCAGACGGCGAAGCCCACGCGT 0: 1
1: 0
2: 0
3: 2
4: 14
Right 1200239491 X:154486390-154486412 GCCCACGCGTCCGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 71
1200239479_1200239491 29 Left 1200239479 X:154486338-154486360 CCGCGCGGAGGGTGGGAGGCAAG 0: 1
1: 0
2: 4
3: 40
4: 338
Right 1200239491 X:154486390-154486412 GCCCACGCGTCCGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 71
1200239486_1200239491 -8 Left 1200239486 X:154486375-154486397 CCCCCAGACGGCGAAGCCCACGC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1200239491 X:154486390-154486412 GCCCACGCGTCCGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200239491 Original CRISPR GCCCACGCGTCCGCCCCCGA GGG Intronic