ID: 1200239817

View in Genome Browser
Species Human (GRCh38)
Location X:154487573-154487595
Sequence GCCGCTCAGCGCCACAATGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200239812_1200239817 6 Left 1200239812 X:154487544-154487566 CCAATGACCAAGGCCAGCATCTC 0: 1
1: 0
2: 1
3: 11
4: 205
Right 1200239817 X:154487573-154487595 GCCGCTCAGCGCCACAATGAAGG 0: 1
1: 0
2: 0
3: 0
4: 45
1200239816_1200239817 -7 Left 1200239816 X:154487557-154487579 CCAGCATCTCGGAGGTGCCGCTC 0: 1
1: 0
2: 0
3: 9
4: 76
Right 1200239817 X:154487573-154487595 GCCGCTCAGCGCCACAATGAAGG 0: 1
1: 0
2: 0
3: 0
4: 45
1200239815_1200239817 -1 Left 1200239815 X:154487551-154487573 CCAAGGCCAGCATCTCGGAGGTG 0: 1
1: 0
2: 0
3: 15
4: 346
Right 1200239817 X:154487573-154487595 GCCGCTCAGCGCCACAATGAAGG 0: 1
1: 0
2: 0
3: 0
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200239817 Original CRISPR GCCGCTCAGCGCCACAATGA AGG Exonic
902237729 1:15068424-15068446 GCCACTAAGCTCCACAATGCAGG - Intronic
903478811 1:23638391-23638413 GCCTCTCAGGGCCACAGAGAAGG - Intronic
908478378 1:64511605-64511627 GCCGCTTCCCGCTACAATGATGG + Intronic
915396806 1:155590982-155591004 GCCGAACAGGGCCACAAGGAGGG + Intergenic
920019471 1:202943795-202943817 GTCCCACTGCGCCACAATGATGG + Exonic
923403560 1:233638644-233638666 GCCACTCAGCCCCAAAAGGATGG - Intronic
1076922148 10:133459679-133459701 GCGGCTCAGCGCCACCTGGACGG - Intergenic
1081773507 11:45663708-45663730 GCTGCTCACCGCCAGGATGAGGG + Intronic
1089656093 11:119948004-119948026 GCTGCTCAGGTGCACAATGAGGG - Intergenic
1093757789 12:22871834-22871856 ACAGCTGAGGGCCACAATGAAGG - Intergenic
1103272069 12:119681703-119681725 TCCGCTCAGAGCCACAAGAACGG - Intergenic
1103521228 12:121537859-121537881 CCCGCGCAGCGCCACAAAGGAGG + Intronic
1105223688 13:18408318-18408340 GACGCTCAGCGCCACCCTGGAGG + Intergenic
1125892514 15:43276915-43276937 GCTGCTCAGAGCCACCATTAAGG + Exonic
1128229693 15:66025828-66025850 GCATCTCAACCCCACAATGATGG + Intronic
1132336851 15:101053316-101053338 GCCGATGAGCGCCACGATGCAGG - Exonic
1133030562 16:3008851-3008873 GCCGCACAGGGCCACTGTGAAGG + Intergenic
1133032048 16:3015740-3015762 GCCGAACAGGGCCACAAGGAGGG + Exonic
1143620966 17:8080055-8080077 GCCGCTCAGCGCCAGGCTGGGGG - Exonic
1144872835 17:18381287-18381309 GGGGCTCAGGCCCACAATGATGG + Intronic
1146540293 17:33687616-33687638 GCCACCCAGAGCCACATTGAAGG - Intronic
932573085 2:72948568-72948590 GCTGCTCAGCACCACCATGCAGG + Intronic
938062239 2:128262856-128262878 TCCTCTCTGTGCCACAATGAAGG + Intronic
938528712 2:132162197-132162219 GACGCTCAGCGCCACCCTGGAGG - Intronic
939103203 2:137919958-137919980 GGTGTTCAGCGCCACAACGACGG - Intergenic
1171295903 20:24016773-24016795 GCCACTCAGTACGACAATGATGG + Intergenic
1172785350 20:37464866-37464888 GCAGCTCAGCCCAACACTGAGGG + Intergenic
1175939724 20:62532458-62532480 GCACCTCAGCGCCACCAGGACGG + Intergenic
1176767793 21:13037717-13037739 GACGCTCAGCGCCACCCTGGAGG + Intergenic
1179919631 21:44500389-44500411 GCCGCCCAGAGCAAGAATGAGGG - Intronic
1183688743 22:39376420-39376442 GCTGCTCTGCACCACAGTGAGGG - Intronic
956655626 3:71547548-71547570 GCCACTCAGAGCCACACTTAAGG + Intronic
961540931 3:127598733-127598755 TACGCTCAGCGCCACACAGATGG - Intronic
968969520 4:3786309-3786331 GCAGCCCAGGGCCACAAAGAGGG + Intergenic
988180236 5:27781840-27781862 GGCTCTCAGCACCACAGTGATGG + Intergenic
1014937895 6:127405252-127405274 ACCTCTCAGCCCCAGAATGATGG + Intergenic
1019620602 7:1990074-1990096 GCCGCTGAGTGCCAGAGTGAGGG + Intronic
1022043439 7:26602582-26602604 GCCACTCAGCCCCACACTCATGG - Intergenic
1029517438 7:101034557-101034579 GCCTGTCAGCACCACAATGGTGG + Exonic
1029517877 7:101038445-101038467 GCCTGTCAGCACCACAATGGTGG + Exonic
1034090821 7:148362513-148362535 GCACCTCAGCGCCACAAGGGTGG - Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1040504055 8:48030987-48031009 GTGGCCCAGAGCCACAATGAAGG - Intronic
1053067098 9:35076475-35076497 GGCTCTGAGTGCCACAATGAAGG + Exonic
1186510583 X:10127020-10127042 TCCCCTCAGCGGCACAATTAGGG + Intronic
1200239817 X:154487573-154487595 GCCGCTCAGCGCCACAATGAAGG + Exonic