ID: 1200242197

View in Genome Browser
Species Human (GRCh38)
Location X:154502810-154502832
Sequence CTGAAGGAACAAATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200242193_1200242197 17 Left 1200242193 X:154502770-154502792 CCAGTTCAGGCACTTGGTGAATG No data
Right 1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG No data
1200242191_1200242197 23 Left 1200242191 X:154502764-154502786 CCTGGACCAGTTCAGGCACTTGG No data
Right 1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200242197 Original CRISPR CTGAAGGAACAAATGGAGGA AGG Intergenic
No off target data available for this crispr