ID: 1200242771

View in Genome Browser
Species Human (GRCh38)
Location X:154506561-154506583
Sequence CAGTGTTACGAAAAGGAGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200242771 Original CRISPR CAGTGTTACGAAAAGGAGGC GGG Exonic
900510947 1:3060829-3060851 CTGTGTTTGGAAAAGGAAGCTGG - Intergenic
901630623 1:10646511-10646533 CAGAGCTCCTAAAAGGAGGCAGG - Intronic
902418398 1:16257257-16257279 CACAGGTAAGAAAAGGAGGCAGG + Intronic
903314394 1:22490082-22490104 CAGGGTTTTGAACAGGAGGCTGG - Exonic
906953141 1:50350441-50350463 CTGTGATATGGAAAGGAGGCAGG + Intergenic
908532822 1:65049794-65049816 CAATGCTAAGAGAAGGAGGCAGG - Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911205779 1:95090382-95090404 CAGTGATAGGGACAGGAGGCAGG - Intergenic
912576864 1:110679939-110679961 GAGAGTTACCAAACGGAGGCGGG - Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
914434558 1:147648473-147648495 GTGTCTTACGTAAAGGAGGCAGG - Intronic
916045714 1:160998669-160998691 CAGTGGTAGGAAAGGGAGGGAGG + Exonic
916085943 1:161269570-161269592 TAATGATACAAAAAGGAGGCAGG + Intronic
923115451 1:230932946-230932968 TTGTGTTATGAAAAGGAGGTAGG - Intronic
1063523342 10:6760790-6760812 CTGTGATACGAACAGGAGACAGG + Intergenic
1063647990 10:7904949-7904971 CAGTGTGAGGGAAAGGATGCAGG - Intronic
1063969569 10:11372122-11372144 CAGTGGTCCCAAGAGGAGGCCGG - Intergenic
1064387020 10:14904413-14904435 CAGTGTTAAGAAAAGGTTGTAGG + Intronic
1066532693 10:36357754-36357776 AAGTGTTCCGAAAGGGATGCTGG - Intergenic
1070696175 10:78564875-78564897 CAGCGTTACTAACAGAAGGCTGG + Intergenic
1070955568 10:80461216-80461238 CAGCCTCAAGAAAAGGAGGCAGG - Intronic
1071033400 10:81212774-81212796 CAGTATTAAGCAAAGGAGGAGGG - Intergenic
1071960327 10:90803808-90803830 TAATGGTACGAACAGGAGGCAGG + Intronic
1072334861 10:94388945-94388967 TAGTGTTGGGAAACGGAGGCTGG - Intergenic
1072705206 10:97675921-97675943 CAGTGTCAGGGAATGGAGGCTGG + Exonic
1072818588 10:98533987-98534009 TTGTCTTAAGAAAAGGAGGCTGG + Intronic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1078653249 11:13215332-13215354 CAGTGTTACAAACTGCAGGCAGG - Intergenic
1081993183 11:47348347-47348369 TAGTGTTGGGAAAAGGAGGTAGG + Intronic
1082751487 11:57022868-57022890 CAGTGATACGGAAAGGAGACAGG - Intergenic
1088660826 11:112044461-112044483 CAATGTTAAGAAAAGGGGGTTGG - Intronic
1089400507 11:118161590-118161612 CAGTGTTAAACAAAGGTGGCTGG - Intergenic
1091402980 12:192056-192078 CAGAGTTAAGAAAAGAAGCCAGG + Intronic
1093937819 12:25019775-25019797 CAGTGATATAAACAGGAGGCAGG - Intergenic
1096392556 12:51240283-51240305 CAGAGCTACCAAAATGAGGCAGG - Intronic
1099243830 12:80170728-80170750 CAGTAATAAGAAAAGAAGGCTGG - Intergenic
1101217404 12:102597625-102597647 TAGTGATAGGGAAAGGAGGCAGG - Intergenic
1107780943 13:43901644-43901666 CAGTCTGAAAAAAAGGAGGCTGG - Intergenic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1110057408 13:70990919-70990941 CAGTGAGAAGAAAAGAAGGCTGG + Intergenic
1113362494 13:109644354-109644376 CAGTGCCACAGAAAGGAGGCTGG + Intergenic
1114345391 14:21789467-21789489 CAGTGATACGAACAGGAGGCAGG + Intergenic
1119592293 14:75900835-75900857 CAGTGTTATGAGAACGAGGCAGG - Intronic
1122299403 14:100723404-100723426 TAGTGTTTAGAAAAGGAGGAGGG + Intergenic
1122579153 14:102760941-102760963 CCGTGCTCTGAAAAGGAGGCGGG - Intergenic
1122740656 14:103869953-103869975 GAATGTCACGAAAAGGAGGTTGG - Intergenic
1122950631 14:105042548-105042570 CAGTGACACCACAAGGAGGCAGG + Intergenic
1123724354 15:23087309-23087331 CAGTTTGCAGAAAAGGAGGCAGG + Intergenic
1126414271 15:48401620-48401642 CAGTGGTATGGAGAGGAGGCAGG + Intergenic
1127547000 15:60001292-60001314 TGGTATTACGAAAAGGAGGAGGG - Intergenic
1128609869 15:69064967-69064989 CAGTGTTTGGAGAAGGATGCAGG - Intergenic
1133017875 16:2953015-2953037 GACTGTTTCAAAAAGGAGGCCGG - Intergenic
1134422560 16:14107976-14107998 CAGTGATAGGAATAGAAGGCAGG - Intronic
1135960356 16:26989904-26989926 CAGGGTGAGGAAAAGGAGGGCGG - Intergenic
1137413104 16:48245888-48245910 TAGAGTTAGGAATAGGAGGCGGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1140664503 16:77215084-77215106 CAGTGTTGCCAAAAGGCGGAAGG + Intergenic
1142523023 17:518370-518392 CTGTGTTATGAGAAGGAGTCTGG - Exonic
1148959077 17:51378058-51378080 CTGTGATACATAAAGGAGGCTGG - Intergenic
1149681663 17:58511923-58511945 CAGAGCTAGGAAAATGAGGCAGG + Intronic
1150786118 17:68164154-68164176 CAATGTAAAGAAAAGGTGGCCGG + Intergenic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1157772539 18:50361969-50361991 CTGTTTAAAGAAAAGGAGGCTGG - Intergenic
1158222242 18:55161643-55161665 CAGTGTTAGGATAAGAGGGCAGG - Intergenic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1164830191 19:31314254-31314276 CAGTGCTTGGCAAAGGAGGCTGG - Intronic
925749866 2:7078384-7078406 CATTGTTAGGAAGAGGTGGCTGG + Intergenic
926172036 2:10558606-10558628 CAGTGTGAGGAAACTGAGGCAGG + Intergenic
926751310 2:16200827-16200849 CAGTGTGAAGAAAATGTGGCTGG - Intergenic
927262264 2:21103151-21103173 CACTGATACAAACAGGAGGCAGG - Intergenic
927536180 2:23861180-23861202 CAGTATTGCAAAAAGGAGGTAGG + Intronic
931908608 2:66869914-66869936 CAGTGTTATGAATAGGAAGAAGG + Intergenic
933752938 2:85614883-85614905 GAGGGTTAGGAAAATGAGGCTGG - Intronic
935036990 2:99386839-99386861 CACTATTAAGAAAAGGAGGCTGG - Intronic
936052316 2:109233647-109233669 TGGTGATACGAACAGGAGGCAGG - Intronic
936065597 2:109329739-109329761 GAGTGTGACACAAAGGAGGCTGG + Intronic
936419538 2:112350082-112350104 CAGTGTTGGGAGACGGAGGCTGG + Intergenic
937597897 2:123691912-123691934 GGGTGTTACGGAAAGGAGGGAGG - Intergenic
938573634 2:132584710-132584732 CACCGTTTCGAAAAGCAGGCAGG + Intronic
938686049 2:133738939-133738961 CAGAGTTACTAAAAAGAGGTTGG - Intergenic
943997554 2:194789430-194789452 GAGGGCTAGGAAAAGGAGGCTGG - Intergenic
944748342 2:202681753-202681775 CAGTGATAGGGACAGGAGGCAGG + Intronic
946624424 2:221595317-221595339 GAGTTTTATGAAAAGCAGGCAGG + Intergenic
947643474 2:231720928-231720950 CAGTGTTATGAATAGGAGGGAGG + Intergenic
948825551 2:240571997-240572019 CATGGTCAGGAAAAGGAGGCTGG - Intronic
1170948121 20:20910057-20910079 CAGTGATACGGACAGGAGGCAGG - Intergenic
1173150280 20:40561456-40561478 CAGTCTCAGGCAAAGGAGGCTGG - Intergenic
1173594683 20:44251113-44251135 CACTTTTAAGAAAAGGAAGCAGG - Intronic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1174766648 20:53260593-53260615 CAGTGTTTGGAAAAGAATGCTGG + Intronic
1179769873 21:43606480-43606502 CAATGGTAGGAAAAGGAGGCAGG + Intronic
1180616377 22:17131017-17131039 CAGTGTTAAGAAATGAGGGCCGG - Intronic
1180790575 22:18573512-18573534 CAGTGTGACTAAAAGAAGGCAGG - Intergenic
1181231163 22:21421803-21421825 CAGTGTGACTAAAAGAAGGCAGG + Intronic
1181247488 22:21513065-21513087 CAGTGTGACTAAAAGAAGGCAGG - Intergenic
1181615231 22:24049714-24049736 CAGTCTTAACAAAAGGAGCCTGG - Intronic
1183695696 22:39420839-39420861 GGGTGTTCCGAAAAGGATGCAGG - Intronic
1183695712 22:39420948-39420970 GGGTGTTCCGAAAAGGATGCAGG - Intronic
950921351 3:16697846-16697868 CAGGGGGAAGAAAAGGAGGCAGG + Intergenic
952123173 3:30268497-30268519 CACTGGTACCAAGAGGAGGCTGG - Intergenic
952304246 3:32131236-32131258 CAGTTTTTTAAAAAGGAGGCAGG - Intronic
952509209 3:34036956-34036978 TAGTGTTATGAAATGGAGGAAGG + Intergenic
952974807 3:38684711-38684733 CACTGTTACCAAAAGGAGGAAGG - Intergenic
953271341 3:41448212-41448234 AAGTGTTAGGACTAGGAGGCTGG + Intronic
956254605 3:67270650-67270672 CAGAGTTAAGAAAAAGGGGCTGG - Intergenic
959290075 3:104462641-104462663 AAGTCTGAAGAAAAGGAGGCAGG - Intergenic
960039051 3:113130896-113130918 AAGTGTTAAGAAAAGGAGTATGG + Intergenic
960358114 3:116678409-116678431 GAGTGATACGGACAGGAGGCGGG + Intronic
961091774 3:124118982-124119004 CAGTATGATGAAAAGGAGACCGG - Intronic
962277125 3:134023968-134023990 TAGTGTTGGGAAACGGAGGCTGG - Intronic
962982827 3:140506385-140506407 GAGTGTGACGAAAGAGAGGCAGG - Intronic
963272141 3:143295960-143295982 GAGTGATAAGAAAAGGAAGCAGG - Intronic
965018022 3:163185987-163186009 AAGTGTTACAAAAAGTAGGAAGG + Intergenic
967090610 3:186131738-186131760 CAGTGTAACGGAAAGTAGGAAGG + Intronic
967859902 3:194142523-194142545 CAGAGTTACAAAATTGAGGCAGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968170674 3:196507275-196507297 CAGTGATAGCAATAGGAGGCAGG - Exonic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
970499088 4:16658699-16658721 CAGTGTTAAAAAAAGAAAGCAGG + Intronic
970831699 4:20347235-20347257 CTCTGTTAGGTAAAGGAGGCAGG + Intronic
971230295 4:24795894-24795916 TAGTGTTAGGAAAAGGAATCTGG + Intronic
973253504 4:48085469-48085491 CACTGATACCAACAGGAGGCAGG + Intronic
974024657 4:56722868-56722890 CAGAGTTACGTCAAGGGGGCAGG - Intergenic
978593973 4:110356674-110356696 AAGTGTTTGGCAAAGGAGGCTGG - Intergenic
984837295 4:184033755-184033777 CAGTGTGGTGAAAATGAGGCAGG - Intergenic
986821319 5:11469881-11469903 CAGTGAGACTAAATGGAGGCAGG - Intronic
987251083 5:16102297-16102319 CACTGATACGTACAGGAGGCAGG + Intronic
988037962 5:25852081-25852103 TAGTGATATGAACAGGAGGCAGG - Intergenic
988410756 5:30882886-30882908 CAGTGATATGAAAAGGAAGGAGG - Intergenic
992618442 5:78568876-78568898 CACTATTACTAAAAGGGGGCCGG + Intronic
994319001 5:98367872-98367894 CAGTGTTAAGAAAAAAATGCAGG + Intergenic
995121064 5:108535857-108535879 CAGTGATACGGACAGGAGGCAGG + Intergenic
997649518 5:135505314-135505336 TACTGTTAAGAAAATGAGGCCGG + Intergenic
997862912 5:137434795-137434817 CATTCTTAAGAAATGGAGGCCGG - Intronic
1000006552 5:157190456-157190478 CAGTGGTAAGTAATGGAGGCAGG + Intronic
1000780519 5:165474469-165474491 CTGTGTAAAGGAAAGGAGGCAGG + Intergenic
1001251947 5:170153348-170153370 CAGTGCTCAGAAAAGGAGGATGG - Intergenic
1002999058 6:2314044-2314066 TAGTGTTGGGAAATGGAGGCTGG + Intergenic
1005245186 6:23876065-23876087 AAGTGTTATGAAAAGCAGGATGG + Intergenic
1006401058 6:33817658-33817680 CAGTGTAAAGAAAAGTTGGCTGG + Intergenic
1006560553 6:34908100-34908122 CTGAGTAACTAAAAGGAGGCTGG - Intronic
1008923225 6:56864489-56864511 CAGTTTTATGGAAAGTAGGCAGG + Intronic
1011811238 6:91134519-91134541 CACTGATACGAAGAGGAGGGAGG - Intergenic
1011899597 6:92275456-92275478 CAGTGATAGGAACAGGAGACAGG - Intergenic
1012112906 6:95259723-95259745 AAATGATACGAACAGGAGGCAGG - Intergenic
1012769261 6:103408021-103408043 CAGTCTCAGGAAAAGGAGACAGG - Intergenic
1016069412 6:139721954-139721976 AACTGTTAGGAAAAGGAGCCAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1018526101 6:164711003-164711025 CAGTGATACGGACAGGAGACAGG - Intergenic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1024173186 7:46811057-46811079 CAGTGATATGAACAGGAGGCAGG - Intergenic
1028224542 7:88234361-88234383 CAATGTTAAGAAAAAGGGGCAGG - Intergenic
1030280583 7:107770552-107770574 CAGAGTTAAGAAACAGAGGCTGG - Intronic
1030512696 7:110503948-110503970 CAATGATACCAAAAGGAGGGAGG - Intergenic
1033144611 7:138860816-138860838 CAGTGTCACGGAATGGAGGTGGG - Intronic
1034882879 7:154775924-154775946 CAGAGGGACGTAAAGGAGGCCGG - Intronic
1034917051 7:155048951-155048973 CAGTGACCAGAAAAGGAGGCAGG - Intergenic
1037764029 8:21760886-21760908 AAGAGTTTCGAAAAGGAGGATGG + Intronic
1040557720 8:48496068-48496090 CAGGGTTACAAACAGCAGGCAGG + Intergenic
1041027630 8:53703394-53703416 CAGGCTTAGGAAAAGCAGGCAGG + Intergenic
1041177642 8:55213149-55213171 GAGGGTTAGGAAAATGAGGCTGG - Intronic
1042601501 8:70503515-70503537 CAGTGATATGGACAGGAGGCAGG - Intergenic
1043701939 8:83300454-83300476 TAGTGATACGAACAGGAGGCAGG + Intergenic
1044949554 8:97422264-97422286 GAGGGTTATGAAAATGAGGCTGG + Intergenic
1045593005 8:103619608-103619630 CAGAACTACAAAAAGGAGGCAGG + Intronic
1048531355 8:135253250-135253272 CAGTGATACAAACAGGAGACAGG + Intergenic
1048971382 8:139646932-139646954 CAGTGTTAGGACAGGGAGCCAGG - Intronic
1050703564 9:8368775-8368797 TAGTGTTAAAAACAGGAGGCTGG - Intronic
1051879934 9:21829527-21829549 CAGTGTAGGGAAAAGGAGCCTGG - Intronic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1055504427 9:76933196-76933218 GAGGGCTACGAAAAAGAGGCTGG + Intergenic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1058037468 9:100268484-100268506 GAGGGCTACGAAAATGAGGCTGG - Intronic
1059475106 9:114540306-114540328 CAGAATTATGCAAAGGAGGCCGG + Intergenic
1061214361 9:129212477-129212499 CTTGGTTAAGAAAAGGAGGCAGG - Intergenic
1186031686 X:5375801-5375823 TAATGATACGAACAGGAGGCAGG + Intergenic
1186797986 X:13065174-13065196 CAGTGCTCTGAAAAGGTGGCTGG - Intergenic
1189954509 X:46263620-46263642 TAGTGATAGGAACAGGAGGCAGG - Intergenic
1190407014 X:50098361-50098383 CAGAGGTAAGAACAGGAGGCTGG - Exonic
1195519535 X:105815189-105815211 GGGGGTTAGGAAAAGGAGGCAGG - Intergenic
1196493351 X:116293700-116293722 GAGGGTTAGGAAAATGAGGCTGG + Intergenic
1198129927 X:133683385-133683407 CAGTGATAGTAAAAGGAGACAGG + Intronic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic
1199969415 X:152848157-152848179 CAGTGTTAAGAATAGGGGCCAGG - Intronic
1200242771 X:154506561-154506583 CAGTGTTACGAAAAGGAGGCGGG + Exonic
1200763165 Y:7058369-7058391 TAGTGTTGGGAAACGGAGGCTGG + Intronic