ID: 1200244649

View in Genome Browser
Species Human (GRCh38)
Location X:154516411-154516433
Sequence GCCTGAACGCACTGCGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200244649_1200244658 5 Left 1200244649 X:154516411-154516433 CCACCTCCGCAGTGCGTTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1200244658 X:154516439-154516461 CCACCGGCCGCCGAGTGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 46
1200244649_1200244659 6 Left 1200244649 X:154516411-154516433 CCACCTCCGCAGTGCGTTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1200244659 X:154516440-154516462 CACCGGCCGCCGAGTGGGAGGGG No data
1200244649_1200244653 0 Left 1200244649 X:154516411-154516433 CCACCTCCGCAGTGCGTTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1200244653 X:154516434-154516456 TGAACCCACCGGCCGCCGAGTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1200244649_1200244656 4 Left 1200244649 X:154516411-154516433 CCACCTCCGCAGTGCGTTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1200244656 X:154516438-154516460 CCCACCGGCCGCCGAGTGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 78
1200244649_1200244663 16 Left 1200244649 X:154516411-154516433 CCACCTCCGCAGTGCGTTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1200244663 X:154516450-154516472 CGAGTGGGAGGGGCCCACGTCGG No data
1200244649_1200244654 1 Left 1200244649 X:154516411-154516433 CCACCTCCGCAGTGCGTTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1200244654 X:154516435-154516457 GAACCCACCGGCCGCCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 30
1200244649_1200244664 27 Left 1200244649 X:154516411-154516433 CCACCTCCGCAGTGCGTTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1200244664 X:154516461-154516483 GGCCCACGTCGGTCCCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200244649 Original CRISPR GCCTGAACGCACTGCGGAGG TGG (reversed) Intergenic
901678591 1:10900677-10900699 GCCTGAGGCCACTGTGGAGGGGG + Intergenic
902226450 1:14999458-14999480 GGCTGAACGCACTGGGTAGGAGG - Intronic
902369203 1:15994730-15994752 GGCTGGTCACACTGCGGAGGGGG + Intergenic
903028795 1:20448273-20448295 GCCTGAACCCAGTGCTCAGGGGG - Intergenic
903338132 1:22638300-22638322 GCCTGAAGGGGCTGGGGAGGGGG - Intronic
905292670 1:36933362-36933384 GCCTGAACCGACTGCTGATGGGG + Intronic
917969330 1:180197032-180197054 GCCTGAACCACCTGGGGAGGAGG + Exonic
920961935 1:210671305-210671327 CCCTGAACCCACTGAGGAGCAGG + Intronic
922531568 1:226349156-226349178 GCGTGAAGGCACTGCGGAAGAGG + Intergenic
1064365863 10:14707288-14707310 CCCTGAACTCACTTAGGAGGTGG - Intronic
1067142495 10:43668886-43668908 GTCTGCACGCACTGCGGGTGAGG + Intergenic
1076149311 10:128149958-128149980 GGCTGGGGGCACTGCGGAGGGGG - Intergenic
1078328600 11:10400551-10400573 GCTTAAACGTACTGCGGAGAGGG - Intronic
1083952659 11:65965493-65965515 GCCTGACGGCACTGAGGCGGGGG + Intronic
1090265793 11:125352041-125352063 GCCAGAAGGCACTGCTGAGGAGG - Intronic
1096513830 12:52145751-52145773 GCCTGCCTGCCCTGCGGAGGTGG - Intergenic
1096645538 12:53032752-53032774 GCTTGAACCCACCGGGGAGGCGG - Intronic
1096782018 12:53997065-53997087 GCCTGCCCACTCTGCGGAGGCGG - Intronic
1108081678 13:46743654-46743676 GCCTCAATGCACTGCAGAGCTGG - Intronic
1112196815 13:97234482-97234504 GCCTGAGCACAGTGCGGGGGCGG + Intronic
1113084611 13:106555272-106555294 GCCTGAACCCACCCAGGAGGTGG + Intronic
1116950142 14:50872058-50872080 GCCTGACCGCGCGGAGGAGGAGG + Intronic
1118633788 14:67729203-67729225 GCCTGGGTGCACTGCGTAGGTGG - Exonic
1123985727 15:25644308-25644330 GCCTGACCACACTGGGCAGGAGG + Intergenic
1127275029 15:57435429-57435451 TCCTGAACACACTGCCCAGGAGG - Intronic
1132353256 15:101153618-101153640 GCTGGAACGCTCTGCAGAGGGGG + Intergenic
1132366988 15:101264924-101264946 GCCTGAACGGACTGCATAGAAGG + Intergenic
1133267116 16:4591908-4591930 GGCTGAAAGCACTGAGGAGGAGG + Intronic
1142997691 17:3770696-3770718 GCTTGAACACGCTGGGGAGGAGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146878139 17:36429073-36429095 GCCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147537412 17:41329524-41329546 GGCTGACCACACTGCGGAAGGGG + Intergenic
1149430562 17:56593502-56593524 GCCTGTACTCGCCGCGGAGGCGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1152368671 17:79871631-79871653 GCCTGAAGCCATTGGGGAGGAGG + Intergenic
1157856517 18:51110101-51110123 CCCTCAATGCACTGGGGAGGCGG + Intergenic
1160993491 19:1871339-1871361 GACTGGACGGGCTGCGGAGGTGG + Intergenic
1164912664 19:32025483-32025505 GCCTGAATGCACTGCAAAGCCGG - Intergenic
1167344581 19:48937247-48937269 GCCTGAGGGCACTGGGGAGCCGG - Intronic
1168364866 19:55777664-55777686 GCATGAACTCACTGCGAAAGGGG + Intergenic
929483557 2:42335689-42335711 GGCTGCACGGACTCCGGAGGCGG - Intronic
937907600 2:127059799-127059821 GCCAGAACCCAAGGCGGAGGTGG + Intronic
946187030 2:217986912-217986934 GGCTGCACGCAGCGCGGAGGAGG + Intronic
948625473 2:239265586-239265608 GCCTCAAGGCTCTGCGGAGCAGG - Intronic
1179815994 21:43906740-43906762 GCCTGTGTGCCCTGCGGAGGTGG + Intronic
952526532 3:34216338-34216360 TCCTGAAGGCACTGAAGAGGGGG + Intergenic
954450241 3:50567684-50567706 GCCGGGACCCACGGCGGAGGTGG + Exonic
954762932 3:52890119-52890141 GCCTGAACACACTGGAGAGGGGG - Intronic
954763868 3:52897199-52897221 GCCTGAACTCTCCGCGCAGGAGG + Intronic
961641351 3:128366517-128366539 GCCTGAGGGCACAGAGGAGGAGG + Intronic
966516671 3:180828378-180828400 GCCTGGAGGCACTGCGGCAGCGG - Intronic
967858328 3:194134497-194134519 GCCTGACCGCACTTAGGAAGCGG - Intergenic
967914994 3:194572113-194572135 GCCGGAATGCACTGCCGTGGGGG + Intergenic
968186059 3:196634270-196634292 GGCTGAAGGCAGTGCGGGGGTGG - Intergenic
988721292 5:33881643-33881665 GCTTGAACCCAGTGAGGAGGAGG - Intronic
991494490 5:67214218-67214240 GCCTGAAGGAGCTGAGGAGGTGG + Intergenic
998136053 5:139675290-139675312 GCCAGAAAGCACTGGGAAGGAGG - Intronic
999309413 5:150542309-150542331 GAATGAACTCACTGAGGAGGAGG + Intronic
1000209926 5:159099389-159099411 GCATGAACGCGGTGCGGACGTGG - Exonic
1000963726 5:167630389-167630411 GCCTCATCCCACTGCAGAGGTGG - Intronic
1014196360 6:118564127-118564149 GCCTCAAAGCAATGCAGAGGAGG - Intronic
1020347612 7:7182584-7182606 GCCTGGACGCGCTGCGGGGAGGG + Intronic
1033581465 7:142740967-142740989 GCCTGAAGGCCCTGCCAAGGTGG + Intergenic
1041507790 8:58620476-58620498 TCCTGAAGGCACTGGGGATGGGG + Intronic
1047381133 8:124364350-124364372 GTCTGAGAGCACTGAGGAGGAGG + Intronic
1049721239 8:144116445-144116467 GCCTGAACCCACAGTGGCGGCGG + Exonic
1059506307 9:114802847-114802869 GCCTGAATGCACAGGGAAGGAGG + Intronic
1060588080 9:124799273-124799295 GCCTTGATGCTCTGCGGAGGGGG - Exonic
1062267365 9:135693337-135693359 GCCTGAACGCTGAACGGAGGTGG + Intergenic
1186426096 X:9465210-9465232 GCCTGAGGGCGCTGCGGCGGCGG - Exonic
1188220687 X:27538059-27538081 ACCTGAAGGGACTGGGGAGGTGG - Intergenic
1195379034 X:104254218-104254240 GCGTGAACGCGGTGCGGCGGCGG + Exonic
1200244649 X:154516411-154516433 GCCTGAACGCACTGCGGAGGTGG - Intergenic