ID: 1200244772

View in Genome Browser
Species Human (GRCh38)
Location X:154517141-154517163
Sequence GGGCACCATTTGGAGCCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200244772_1200244783 5 Left 1200244772 X:154517141-154517163 CCCAGCGGCTCCAAATGGTGCCC No data
Right 1200244783 X:154517169-154517191 CCAGCTGGCTGTATGGACCTGGG No data
1200244772_1200244779 -2 Left 1200244772 X:154517141-154517163 CCCAGCGGCTCCAAATGGTGCCC No data
Right 1200244779 X:154517162-154517184 CCGGCACCCAGCTGGCTGTATGG No data
1200244772_1200244781 4 Left 1200244772 X:154517141-154517163 CCCAGCGGCTCCAAATGGTGCCC No data
Right 1200244781 X:154517168-154517190 CCCAGCTGGCTGTATGGACCTGG No data
1200244772_1200244786 16 Left 1200244772 X:154517141-154517163 CCCAGCGGCTCCAAATGGTGCCC No data
Right 1200244786 X:154517180-154517202 TATGGACCTGGGGTGGTCTCCGG No data
1200244772_1200244785 9 Left 1200244772 X:154517141-154517163 CCCAGCGGCTCCAAATGGTGCCC No data
Right 1200244785 X:154517173-154517195 CTGGCTGTATGGACCTGGGGTGG No data
1200244772_1200244788 23 Left 1200244772 X:154517141-154517163 CCCAGCGGCTCCAAATGGTGCCC No data
Right 1200244788 X:154517187-154517209 CTGGGGTGGTCTCCGGCCGCAGG No data
1200244772_1200244784 6 Left 1200244772 X:154517141-154517163 CCCAGCGGCTCCAAATGGTGCCC No data
Right 1200244784 X:154517170-154517192 CAGCTGGCTGTATGGACCTGGGG No data
1200244772_1200244776 -10 Left 1200244772 X:154517141-154517163 CCCAGCGGCTCCAAATGGTGCCC No data
Right 1200244776 X:154517154-154517176 AATGGTGCCCGGCACCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200244772 Original CRISPR GGGCACCATTTGGAGCCGCT GGG (reversed) Intergenic